Research
F L M Peçanha et al.
T3increases T3 increases mitochondrial mitochondrial hexokinaseactivity hexokinase activity
311–322 6:5
311–322 6 : 311
Open Access
Thyroid states regulate subcellular glucose phosphorylation activity in male mice Flavia Letícia Martins Peçanha, Reinaldo Sousa dos Santos† and Wagner Seixas da-Silva Instituto de Bioquímica Médica Leopoldo de Meis, Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Universidade Federal do Rio de Janeiro, Cidade Universitária, Rio de Janeiro, Rio de Janeiro, Brazil † (R S dos Santos is now at ULB Center for Diabetes Research, Medical Faculty, Université Libre de Bruxelles (ULB), Brussels, Belgium)
Correspondence should be addressed to W S da-Silva Email [email protected]
Endocrine Connections
Abstract The thyroid hormones (THs), triiodothyronine (T3) and thyroxine (T4), are very important in organism metabolism and regulate glucose utilization. Hexokinase (HK) is responsible for the first step of glycolysis, catalyzing the conversion of glucose to glucose 6-phosphate. HK has been found in different cellular compartments, and new functions have been attributed to this enzyme. The effects of hyperthyroidism on subcellular glucose phosphorylation in mouse tissues were examined. Tissues were removed, subcellular fractions were isolated from eu- and hyperthyroid (T3, 0.25 µg/g, i.p. during 21 days) mice and HK activity was assayed. Glucose phosphorylation was increased in the particulate fraction in soleus (312.4% ± 67.1, n = 10), gastrocnemius (369.2% ± 112.4, n = 10) and heart (142.2% ± 13.6, n = 10) muscle in the hyperthyroid group compared to the control group. Hexokinase activity was not affected in brain or liver. No relevant changes were observed in HK activity in the soluble fraction for all tissues investigated. Acute T3 administration (single dose of T3, 1.25 µg/g, i.p.) did not modulate HK activity. Interestingly, HK mRNA levels remained unchanged and HK bound to mitochondria was increased by T3 treatment, suggesting a posttranscriptional mechanism. Analysis of the AKT pathway showed a 2.5-fold increase in AKT and GSK3B phosphorylation in the gastrocnemius muscle in the hyperthyroid group compared to the euthyroid group. Taken together, we show for the first time that THs modulate HK activity specifically in particulate fractions and that this action seems to be under the control of the AKT and GSK3B pathways.
Key Words ff glucose metabolism ff thyroid ff muscle ff mitochondria ff T3 action
Endocrine Connections (2017) 6, 311–322
Introduction Thyroid hormones exert important effects on basal and adaptive metabolism (1). Although several studies have shown that triiodothyronine (T3) may regulate glucose uptake and oxygen consumption (2, 3, 4, 5, 6, 7, 8), the effects of T3 on glucose metabolism remain unclear. Glycemic control can be achieved through different factors such as hormone action and cell metabolism. Insulin and glucagon are hormones that stimulate glucose http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
uptake and synthesis, respectively. Insulin stimulates glucose uptake in muscle and adipose tissues through glucose transporter (GLUT4) translocation to cell surface. Besides that, other crucial step to glucose uptake is its phosphorylation in a reaction catalyzed by the enzyme hexokinase (HK) (9, 10). The increase in glucose uptake observed in models of hyperthyroidism has been studied by many research groups, with a particular focus on This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Endocrine Connections
Research
F L M Peçanha et al.
the effects of THs on GLUT expression (11, 12, 13, 14). However, little is known about the roles of these hormones on glucose phosphorylation by hexokinase. There are four important mammalian hexokinase isozymes, namely HK I–IV, which differ with respect to kinetic parameters, subcellular localization and physiological roles. Different levels of HK isoforms are co-expressed. The prevalence of each isoform varies in a species-specific manner. For instance, in rat skeletal muscle, HK II predominates over HK I, whereas the total quantity of HK I is similar to HK II in human skeletal muscle (15). In addition, HK activities may also differ depending on the organ and subcellular fraction in which they are located (16). An important characteristic of HK I and II is the ability to interact with the outer-mitochondrial membrane specifically through a mitochondria binding motif (10). This mitochondrial interaction occurs through the voltage-dependent anion channel (VDAC), also known as the mitochondrial porin, which is an integral protein of the mitochondrial outer membrane (17, 18). Its main function is to transport anions, cations, adenine nucleotides and other metabolites into and out of the mitochondria (19). The HK-VDAC complex has been described as an important mechanism coupling oxidative phosphorylation to glycolysis as the ATP synthesized by the Fo–F1 ATPase can be used promptly by the enzyme to fix glucose inside the cell (20). Additionally, many other functions have been proposed for this interaction with mitochondria, such as higher cell resistance to chemotherapy (21) and modulation of reactive oxygen species generation (22). The amount of HK bound to the mitochondria is under the regulation of different factors, such as PKCε activity and glucose 6-phosphate concentration. While the accumulation of the HK reaction product glucose 6-phosphate leads to conformational changes and the consequent detachment of HK from mitochondrial VDAC, PKCε promotes HK binding through phosphorylation of this channel (23, 24, 25, 26, 27). In the last decade, many other mediators have been directly or indirectly identified as regulators of hexokinase binding to the mitochondria, including phosphorylation by some protein kinases. Curiously, some of these pathways are also related to increase in glucose uptake. Gottlob (28) and Majewski (29) found that AKT, also known as protein kinase B, increases the basal levels of HK units bound to mitochondria. A few years later, it was demonstrated that this interaction was a consequence of direct phosphorylation of HK by AKT (30). However, glycogen synthase kinase 3β (GSK3B),
http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
T3 increases mitochondrial hexokinase activity
312–322
6:312
a downstream target of AKT, can negatively affect the mitochondria-HK interaction by phosphorylating VDAC. Thus, although part of the same pathway, AKT and GSK3B have opposing effects on the regulation of HK binding to mitochondria. Because thyroid hormones modulate glucose metabolism and HK compartmentalization is a dynamic process, our hypothesis is that THs alter the distribution of HK activity in mouse tissues. Using a hyperthyroidism mouse model, which was compared to a euthyroid group, we provide novel evidence that T3 increases mitochondriabound hexokinase activity and that this phenomenon seems to occur as result of the AKT–GSK3B pathway activation.
Materials and methods Reagents and materials Unless otherwise specified, all reagents were purchased from Sigma Chemical, Vetec Química Fina Ltda. (Duque de Caxias, RJ, Brazil), Invitrogen Corporation, Applied Biosystems, Millipore and Fermentas/Thermo Fisher Scientific.
Hyperthyroidism induction Male BALB/c mice (3 weeks old) were treated with vehicle or T3 to induce eu- and hyperthyroidism, respectively. T3 was first solubilized in 0.04 mol/L NaOH, diluted in PBS and then administered i.p. daily (supraphysiological dose: 0.25 µg/g body mass) for 21 days. The same volume of PBS plus 0.04 mol/L NaOH was injected into the euthyroid group as vehicle. Animals were killed after 24 h of last T3 administration. Acute treatment was achieved by a single i.p. injection of T3 (1.25 µg/g body mass), and animals were killed after 2, 4, 8 or 24 h of T3 administration. Animal handling and killed were approved by the Institutional Animal Care and Use Committee (Comissão de Ética no Uso de Animais do Centro de Ciências da Saúde, CEUA/CCS) of the Federal University of Rio de Janeiro (protocol number IBQM40).
Tissue subcellular fractionation Soluble and particulate fractions were obtained through differential centrifugation. For this purpose, tissues were minced and homogenized in buffer containing 0.32 mol/L
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Research
F L M Peçanha et al.
sucrose, 1 mmol/L EDTA, 1 mmol/L EGTA and 10 mmol/L Tris–HCl, pH 7.4. The total homogenate was centrifuged at 2500 g for 10 min. The supernatant was collected and then centrifuged at 20,000 g for 40 min. The resulting supernatant was saved (soluble fraction), and the pellet (particulate fraction) was resuspended in the same buffer. All steps were performed at 4°C. Both of the fractions were stored at −80°C. Protein concentrations were determined by the Folin-Lowry method using bovine serum albumin as a standard (31).
Hormone measurements
Endocrine Connections
Serum total T4, total T3 and free T3 were measured using, respectively, a total thyroxine (total T4) antibody coated tube (125I RIA kit); a total triiodothyronine (total T3) antibody coated tube (125I RIA kit); and a free triiodothyronine (free T3) antibody coated tube (125I RIA kit) (MP Biomedicals, Santa Ana, CA, USA), following the manufacturer’s instructions.
Cell culture The C2C12 myoblast cell line was obtained from BCRJ (Banco de Células do Rio de Janeiro) and certified to be free from mycoplasma contamination. The cells were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 nmol/L sodium selenite and 2 mmol/L glutamine and maintained at 37°C in a 5% CO2 atmosphere. To induce differentiation into myotubes, the cells were seeded in petri dishes with DMEM plus 10% FBS until 90% confluence was achieved. Afterward, the culture medium was changed to DMEM supplemented with 2% horse serum for 7 days, and the medium was changed on days 2, 4 and 7 of differentiation. At the end of differentiation, the culture medium was changed to DMEM plus 0.1% BSA for 24 h, and the cells were subsequently treated with vehicle or 1.85 nmol/L T3 for an additional 24 h.
Cell culture subcellular fractionation At the end of treatment, cells were washed with PBS and trypsinized. To stop trypsin action, cells were resuspended in DMEM plus 0.1% BSA with vehicle or T3, collected in conical tubes and centrifuged at 200 g for 5 min. The cell pellet was washed with PBS and centrifuged at 200 g for 5 min. The new pellet was resuspended in extraction buffer containing 10 mmol/L Tris–HCl, pH 7.4, 0.25 mol/L http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
T3 increases mitochondrial hexokinase activity
313–322
6:313
sucrose, 1 mmol/L EDTA, 1 mmol/L sodium vanadate, 1 mmol/L NaF, 0.5 mmol/L PMSF, 1 mmol/L EGTA and 1 mmol/L β-mercaptoethanol, homogenized in a glass potter and centrifuged at 100 g for 5 min. The resultant supernatant was collected and centrifuged at 10,000 g for 15 min. The supernatant (soluble fraction) was collected, and the pellet (particulate fraction) was resuspended in extraction buffer. All steps were performed at 4°C. Both fractions were stored at −80°C. The protein concentration was determined using the bicinchoninic acid method (Thermo Scientific Pierce BCA Protein Assay Kit), using bovine serum albumin as a standard.
Hexokinase activity HK and glucokinase (GK) specific activities were determined by NADH formation, following the absorbance at 340 nm, using a coupled assay. Tissue extract HK assay medium contained 50 mmol/L Tris–HCl, pH 7.4, 6 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 0.5 U/mL Glucose 6-Phosphate Dehydrogenase (G6PDH) from Leuconostoc mesenteroides, 2 mmol/L ATP, 0.1% Triton (v/v) and 5 mmol/L glucose. GK activity was determined by the difference between the activities measured in the media containing 100 mmol/L glucose or 0.5 mmol/L glucose. Besides this difference in glucose concentrations, both media contained 50 mmol/L Tris–HCl, pH 7.4, 6 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 0.5 U/mL G6PDH, 2 mmol/L ATP, 0.1% Triton (v/v) and 5 mmol/L dithiothreitol. The cell extract HK assay medium contained 50 mmol/L Tris–HCl, pH 7.4, 7.7 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 6.7 mmol/L ATP, 0.05% triton, 4.2 mmol/L glucose, 0.1 µmol/L rotenone, 45 mmol/L KCl, 0.5 mmol/L EDTA, 5 mmol/L NaN3 and 1 unit/mL G6PDH. All enzymatic assays were performed at 35°C, and the final protein concentration was 0.05 mg/mL (tissue extract) or 0.02 mg/mL (cell extract). The effects of T3 on enzyme activity were reproducible in all of the experiments. To better compare and decrease inter-experimental variability, enzyme activities were normalized to the euthyroid experimental group (considered 100% in each experiment).
RNA isolation and quantification Liver and gastrocnemius muscle RNA were isolated from eu- and hyperthyroid animals using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA synthesis and quantitative realtime PCR were performed using a High-Capacity This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Research
F L M Peçanha et al.
cDNA Reverse Transcription Kit protocol (Applied Biosystems) and a Power SYBR Green Master Mix (Thermo Fischer Scientific), according to manufacturer’s instructions. The following primers were used: hexokinase (Forward 3′ CAAGCGTGGACTGCTCTTCC 5′; Reverse 3′ TGTTGCAGGATGGCTCGGAC 5′), Dio1 (Forward 3′CCACCTTCTTCAGCATCC-5′; Reverse 3′AGTCATCTACGAGTCTCTTG-5′) and 36β4 (Forward 3′TGTTTGACAACGGCAGCATTT-5′; Reverse 3′CCGAGGCAACAGTTGGGTA 5′). The 36β4 gene was used as a housekeeping gene.
Endocrine Connections
Western blot analysis Immunoblot analyses were performed with the antibodies listed in Supplementary Table 1 (see section on Supplementary data given at the end of this article). The proteins from the soluble fraction were separated in 10% polyacrylamide gels and then transferred to PVDF membranes. The membranes were blocked using 3% BSA (w/v) or 3% low fat milk (w/v) in Tris-buffered saline with 0.1% Tween 20 (v/v) (TBS-T) for 1 h. Then, they were washed with TBS-T and probed overnight with the following primary antibodies. After primary antibody incubation, the membranes were incubated with secondary antibodies conjugated to horseradish peroxidase for 1 h. The membranes were developed using Luminata Forte Western HRP Substrate (Millipore), and images were quantified using NIH ImageJ software (32).
T3 increases mitochondrial hexokinase activity
314–322
6:314
found a broad range of doses and decided to use a dose that is considered as supraphysiological and frequently used (33, 34). To confirm whether this pathological condition was achieved, we measured physiological parameters of hyperthyroidism, such as total T3 and T4 levels (Fig. 1). As expected, total T3 levels were 10 times higher in hyperthyroid animals (Fig. 1A), while total T4 levels were decreased by T3 treatment (Fig. 1B), in agreement with the negative feedback exerted by thyroid hormones at the pituitary and hypothalamic levels (35). Hyperthyroid mice showed increased heart weight to body weight ratio (Fig. 1C), suggestive of heart hypertrophy, which is commonly observed in hyperthyroidism. Moreover, Dio1 mRNA expression, a marker of thyroid hormone action, was 50-fold higher in the livers of the hyperthyroid groups (Fig. 1D). It is important to note that there was no difference in housekeeping gene expression (Fig. 1D, inset). Collectively, these results confirm the induction of a hyperthyroid state in our experimental model and tissue responsiveness to increased serum T3 levels.
Statistical analysis All data were analyzed using PRISM software (GraphPad Software) and are expressed as mean ± s.e.m. One-way ANOVA was used to compare more than two groups, followed by Student–Newman–Keuls test to detect differences between groups. Student’s t-test was used to compare the differences between two groups. P
F L M Peçanha et al.
T3increases T3 increases mitochondrial mitochondrial hexokinaseactivity hexokinase activity
311–322 6:5
311–322 6 : 311
Open Access
Thyroid states regulate subcellular glucose phosphorylation activity in male mice Flavia Letícia Martins Peçanha, Reinaldo Sousa dos Santos† and Wagner Seixas da-Silva Instituto de Bioquímica Médica Leopoldo de Meis, Laboratório de Adaptações Metabólicas, Programa de Bioquímica e Biofísica Celular, Universidade Federal do Rio de Janeiro, Cidade Universitária, Rio de Janeiro, Rio de Janeiro, Brazil † (R S dos Santos is now at ULB Center for Diabetes Research, Medical Faculty, Université Libre de Bruxelles (ULB), Brussels, Belgium)
Correspondence should be addressed to W S da-Silva Email [email protected]
Endocrine Connections
Abstract The thyroid hormones (THs), triiodothyronine (T3) and thyroxine (T4), are very important in organism metabolism and regulate glucose utilization. Hexokinase (HK) is responsible for the first step of glycolysis, catalyzing the conversion of glucose to glucose 6-phosphate. HK has been found in different cellular compartments, and new functions have been attributed to this enzyme. The effects of hyperthyroidism on subcellular glucose phosphorylation in mouse tissues were examined. Tissues were removed, subcellular fractions were isolated from eu- and hyperthyroid (T3, 0.25 µg/g, i.p. during 21 days) mice and HK activity was assayed. Glucose phosphorylation was increased in the particulate fraction in soleus (312.4% ± 67.1, n = 10), gastrocnemius (369.2% ± 112.4, n = 10) and heart (142.2% ± 13.6, n = 10) muscle in the hyperthyroid group compared to the control group. Hexokinase activity was not affected in brain or liver. No relevant changes were observed in HK activity in the soluble fraction for all tissues investigated. Acute T3 administration (single dose of T3, 1.25 µg/g, i.p.) did not modulate HK activity. Interestingly, HK mRNA levels remained unchanged and HK bound to mitochondria was increased by T3 treatment, suggesting a posttranscriptional mechanism. Analysis of the AKT pathway showed a 2.5-fold increase in AKT and GSK3B phosphorylation in the gastrocnemius muscle in the hyperthyroid group compared to the euthyroid group. Taken together, we show for the first time that THs modulate HK activity specifically in particulate fractions and that this action seems to be under the control of the AKT and GSK3B pathways.
Key Words ff glucose metabolism ff thyroid ff muscle ff mitochondria ff T3 action
Endocrine Connections (2017) 6, 311–322
Introduction Thyroid hormones exert important effects on basal and adaptive metabolism (1). Although several studies have shown that triiodothyronine (T3) may regulate glucose uptake and oxygen consumption (2, 3, 4, 5, 6, 7, 8), the effects of T3 on glucose metabolism remain unclear. Glycemic control can be achieved through different factors such as hormone action and cell metabolism. Insulin and glucagon are hormones that stimulate glucose http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
uptake and synthesis, respectively. Insulin stimulates glucose uptake in muscle and adipose tissues through glucose transporter (GLUT4) translocation to cell surface. Besides that, other crucial step to glucose uptake is its phosphorylation in a reaction catalyzed by the enzyme hexokinase (HK) (9, 10). The increase in glucose uptake observed in models of hyperthyroidism has been studied by many research groups, with a particular focus on This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Endocrine Connections
Research
F L M Peçanha et al.
the effects of THs on GLUT expression (11, 12, 13, 14). However, little is known about the roles of these hormones on glucose phosphorylation by hexokinase. There are four important mammalian hexokinase isozymes, namely HK I–IV, which differ with respect to kinetic parameters, subcellular localization and physiological roles. Different levels of HK isoforms are co-expressed. The prevalence of each isoform varies in a species-specific manner. For instance, in rat skeletal muscle, HK II predominates over HK I, whereas the total quantity of HK I is similar to HK II in human skeletal muscle (15). In addition, HK activities may also differ depending on the organ and subcellular fraction in which they are located (16). An important characteristic of HK I and II is the ability to interact with the outer-mitochondrial membrane specifically through a mitochondria binding motif (10). This mitochondrial interaction occurs through the voltage-dependent anion channel (VDAC), also known as the mitochondrial porin, which is an integral protein of the mitochondrial outer membrane (17, 18). Its main function is to transport anions, cations, adenine nucleotides and other metabolites into and out of the mitochondria (19). The HK-VDAC complex has been described as an important mechanism coupling oxidative phosphorylation to glycolysis as the ATP synthesized by the Fo–F1 ATPase can be used promptly by the enzyme to fix glucose inside the cell (20). Additionally, many other functions have been proposed for this interaction with mitochondria, such as higher cell resistance to chemotherapy (21) and modulation of reactive oxygen species generation (22). The amount of HK bound to the mitochondria is under the regulation of different factors, such as PKCε activity and glucose 6-phosphate concentration. While the accumulation of the HK reaction product glucose 6-phosphate leads to conformational changes and the consequent detachment of HK from mitochondrial VDAC, PKCε promotes HK binding through phosphorylation of this channel (23, 24, 25, 26, 27). In the last decade, many other mediators have been directly or indirectly identified as regulators of hexokinase binding to the mitochondria, including phosphorylation by some protein kinases. Curiously, some of these pathways are also related to increase in glucose uptake. Gottlob (28) and Majewski (29) found that AKT, also known as protein kinase B, increases the basal levels of HK units bound to mitochondria. A few years later, it was demonstrated that this interaction was a consequence of direct phosphorylation of HK by AKT (30). However, glycogen synthase kinase 3β (GSK3B),
http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
T3 increases mitochondrial hexokinase activity
312–322
6:312
a downstream target of AKT, can negatively affect the mitochondria-HK interaction by phosphorylating VDAC. Thus, although part of the same pathway, AKT and GSK3B have opposing effects on the regulation of HK binding to mitochondria. Because thyroid hormones modulate glucose metabolism and HK compartmentalization is a dynamic process, our hypothesis is that THs alter the distribution of HK activity in mouse tissues. Using a hyperthyroidism mouse model, which was compared to a euthyroid group, we provide novel evidence that T3 increases mitochondriabound hexokinase activity and that this phenomenon seems to occur as result of the AKT–GSK3B pathway activation.
Materials and methods Reagents and materials Unless otherwise specified, all reagents were purchased from Sigma Chemical, Vetec Química Fina Ltda. (Duque de Caxias, RJ, Brazil), Invitrogen Corporation, Applied Biosystems, Millipore and Fermentas/Thermo Fisher Scientific.
Hyperthyroidism induction Male BALB/c mice (3 weeks old) were treated with vehicle or T3 to induce eu- and hyperthyroidism, respectively. T3 was first solubilized in 0.04 mol/L NaOH, diluted in PBS and then administered i.p. daily (supraphysiological dose: 0.25 µg/g body mass) for 21 days. The same volume of PBS plus 0.04 mol/L NaOH was injected into the euthyroid group as vehicle. Animals were killed after 24 h of last T3 administration. Acute treatment was achieved by a single i.p. injection of T3 (1.25 µg/g body mass), and animals were killed after 2, 4, 8 or 24 h of T3 administration. Animal handling and killed were approved by the Institutional Animal Care and Use Committee (Comissão de Ética no Uso de Animais do Centro de Ciências da Saúde, CEUA/CCS) of the Federal University of Rio de Janeiro (protocol number IBQM40).
Tissue subcellular fractionation Soluble and particulate fractions were obtained through differential centrifugation. For this purpose, tissues were minced and homogenized in buffer containing 0.32 mol/L
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Research
F L M Peçanha et al.
sucrose, 1 mmol/L EDTA, 1 mmol/L EGTA and 10 mmol/L Tris–HCl, pH 7.4. The total homogenate was centrifuged at 2500 g for 10 min. The supernatant was collected and then centrifuged at 20,000 g for 40 min. The resulting supernatant was saved (soluble fraction), and the pellet (particulate fraction) was resuspended in the same buffer. All steps were performed at 4°C. Both of the fractions were stored at −80°C. Protein concentrations were determined by the Folin-Lowry method using bovine serum albumin as a standard (31).
Hormone measurements
Endocrine Connections
Serum total T4, total T3 and free T3 were measured using, respectively, a total thyroxine (total T4) antibody coated tube (125I RIA kit); a total triiodothyronine (total T3) antibody coated tube (125I RIA kit); and a free triiodothyronine (free T3) antibody coated tube (125I RIA kit) (MP Biomedicals, Santa Ana, CA, USA), following the manufacturer’s instructions.
Cell culture The C2C12 myoblast cell line was obtained from BCRJ (Banco de Células do Rio de Janeiro) and certified to be free from mycoplasma contamination. The cells were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 nmol/L sodium selenite and 2 mmol/L glutamine and maintained at 37°C in a 5% CO2 atmosphere. To induce differentiation into myotubes, the cells were seeded in petri dishes with DMEM plus 10% FBS until 90% confluence was achieved. Afterward, the culture medium was changed to DMEM supplemented with 2% horse serum for 7 days, and the medium was changed on days 2, 4 and 7 of differentiation. At the end of differentiation, the culture medium was changed to DMEM plus 0.1% BSA for 24 h, and the cells were subsequently treated with vehicle or 1.85 nmol/L T3 for an additional 24 h.
Cell culture subcellular fractionation At the end of treatment, cells were washed with PBS and trypsinized. To stop trypsin action, cells were resuspended in DMEM plus 0.1% BSA with vehicle or T3, collected in conical tubes and centrifuged at 200 g for 5 min. The cell pellet was washed with PBS and centrifuged at 200 g for 5 min. The new pellet was resuspended in extraction buffer containing 10 mmol/L Tris–HCl, pH 7.4, 0.25 mol/L http://www.endocrineconnections.org DOI: 10.1530/EC-17-0059
© 2017 The authors Published by Bioscientifica Ltd
T3 increases mitochondrial hexokinase activity
313–322
6:313
sucrose, 1 mmol/L EDTA, 1 mmol/L sodium vanadate, 1 mmol/L NaF, 0.5 mmol/L PMSF, 1 mmol/L EGTA and 1 mmol/L β-mercaptoethanol, homogenized in a glass potter and centrifuged at 100 g for 5 min. The resultant supernatant was collected and centrifuged at 10,000 g for 15 min. The supernatant (soluble fraction) was collected, and the pellet (particulate fraction) was resuspended in extraction buffer. All steps were performed at 4°C. Both fractions were stored at −80°C. The protein concentration was determined using the bicinchoninic acid method (Thermo Scientific Pierce BCA Protein Assay Kit), using bovine serum albumin as a standard.
Hexokinase activity HK and glucokinase (GK) specific activities were determined by NADH formation, following the absorbance at 340 nm, using a coupled assay. Tissue extract HK assay medium contained 50 mmol/L Tris–HCl, pH 7.4, 6 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 0.5 U/mL Glucose 6-Phosphate Dehydrogenase (G6PDH) from Leuconostoc mesenteroides, 2 mmol/L ATP, 0.1% Triton (v/v) and 5 mmol/L glucose. GK activity was determined by the difference between the activities measured in the media containing 100 mmol/L glucose or 0.5 mmol/L glucose. Besides this difference in glucose concentrations, both media contained 50 mmol/L Tris–HCl, pH 7.4, 6 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 0.5 U/mL G6PDH, 2 mmol/L ATP, 0.1% Triton (v/v) and 5 mmol/L dithiothreitol. The cell extract HK assay medium contained 50 mmol/L Tris–HCl, pH 7.4, 7.7 mmol/L MgCl2, 0.5 mmol/L β-NAD+, 6.7 mmol/L ATP, 0.05% triton, 4.2 mmol/L glucose, 0.1 µmol/L rotenone, 45 mmol/L KCl, 0.5 mmol/L EDTA, 5 mmol/L NaN3 and 1 unit/mL G6PDH. All enzymatic assays were performed at 35°C, and the final protein concentration was 0.05 mg/mL (tissue extract) or 0.02 mg/mL (cell extract). The effects of T3 on enzyme activity were reproducible in all of the experiments. To better compare and decrease inter-experimental variability, enzyme activities were normalized to the euthyroid experimental group (considered 100% in each experiment).
RNA isolation and quantification Liver and gastrocnemius muscle RNA were isolated from eu- and hyperthyroid animals using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA synthesis and quantitative realtime PCR were performed using a High-Capacity This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
Research
F L M Peçanha et al.
cDNA Reverse Transcription Kit protocol (Applied Biosystems) and a Power SYBR Green Master Mix (Thermo Fischer Scientific), according to manufacturer’s instructions. The following primers were used: hexokinase (Forward 3′ CAAGCGTGGACTGCTCTTCC 5′; Reverse 3′ TGTTGCAGGATGGCTCGGAC 5′), Dio1 (Forward 3′CCACCTTCTTCAGCATCC-5′; Reverse 3′AGTCATCTACGAGTCTCTTG-5′) and 36β4 (Forward 3′TGTTTGACAACGGCAGCATTT-5′; Reverse 3′CCGAGGCAACAGTTGGGTA 5′). The 36β4 gene was used as a housekeeping gene.
Endocrine Connections
Western blot analysis Immunoblot analyses were performed with the antibodies listed in Supplementary Table 1 (see section on Supplementary data given at the end of this article). The proteins from the soluble fraction were separated in 10% polyacrylamide gels and then transferred to PVDF membranes. The membranes were blocked using 3% BSA (w/v) or 3% low fat milk (w/v) in Tris-buffered saline with 0.1% Tween 20 (v/v) (TBS-T) for 1 h. Then, they were washed with TBS-T and probed overnight with the following primary antibodies. After primary antibody incubation, the membranes were incubated with secondary antibodies conjugated to horseradish peroxidase for 1 h. The membranes were developed using Luminata Forte Western HRP Substrate (Millipore), and images were quantified using NIH ImageJ software (32).
T3 increases mitochondrial hexokinase activity
314–322
6:314
found a broad range of doses and decided to use a dose that is considered as supraphysiological and frequently used (33, 34). To confirm whether this pathological condition was achieved, we measured physiological parameters of hyperthyroidism, such as total T3 and T4 levels (Fig. 1). As expected, total T3 levels were 10 times higher in hyperthyroid animals (Fig. 1A), while total T4 levels were decreased by T3 treatment (Fig. 1B), in agreement with the negative feedback exerted by thyroid hormones at the pituitary and hypothalamic levels (35). Hyperthyroid mice showed increased heart weight to body weight ratio (Fig. 1C), suggestive of heart hypertrophy, which is commonly observed in hyperthyroidism. Moreover, Dio1 mRNA expression, a marker of thyroid hormone action, was 50-fold higher in the livers of the hyperthyroid groups (Fig. 1D). It is important to note that there was no difference in housekeeping gene expression (Fig. 1D, inset). Collectively, these results confirm the induction of a hyperthyroid state in our experimental model and tissue responsiveness to increased serum T3 levels.
Statistical analysis All data were analyzed using PRISM software (GraphPad Software) and are expressed as mean ± s.e.m. One-way ANOVA was used to compare more than two groups, followed by Student–Newman–Keuls test to detect differences between groups. Student’s t-test was used to compare the differences between two groups. P
