Accepted Manuscript Three new, early diverging Carex (Cariceae, Cyperaceae) lineages from East and Southeast Asia with important evolutionary and biogeographic implications Julian R. Starr, Francesco H. Janzen, Bruce A. Ford PII: DOI: Reference:
S1055-7903(15)00097-4 http://dx.doi.org/10.1016/j.ympev.2015.04.001 YMPEV 5160
To appear in:
Molecular Phylogenetics and Evolution
Received Date: Revised Date: Accepted Date:
22 January 2015 26 March 2015 1 April 2015
Please cite this article as: Starr, J.R., Janzen, F.H., Ford, B.A., Three new, early diverging Carex (Cariceae, Cyperaceae) lineages from East and Southeast Asia with important evolutionary and biogeographic implications, Molecular Phylogenetics and Evolution (2015), doi: http://dx.doi.org/10.1016/j.ympev.2015.04.001
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Three new, early diverging Carex (Cariceae, Cyperaceae) lineages from East and Southeast Asia with important evolutionary and biogeographic implications
Julian R. Starra,b,*, Francesco H. Janzena,b, and Bruce A. Fordc
a
Department of Biology, University of Ottawa, Ottawa, Ontario, K1N 6N5, Canada.
b
Canadian Museum of Nature, Ottawa, Ontario, K1P 6P4, Canada.
c
Department of Biological Sciences, University of Manitoba, Winnipeg, Manitoba, R3T 2N2, Canada.
*
Corresponding author at: Department of Biology, University of Ottawa, Gendron Hall, Room 160, 30 Marie Curie, Ottawa, Ontario, K1N 6N5, Canada, phone: 1-613-562-5800 ext. 6100; email: [email protected]
E-mail addresses: [email protected] (J.R. Starr), [email protected] (F.H. Janzen), [email protected] (B.A. Ford)
2
Abstract Traditional Cariceae and Carex (1966 spp.) classifications recognised five genera (Carex, Cymophyllus, Kobresia, Schoenoxiphium, Uncinia) and four subgenera (Carex, Vignea, Vigneastra, Psyllophora). However, molecular studies show that only Carex, divided into five major lineages (the Core Carex, Schoenoxiphium, Core Unispicate, Vignea and Siderostictae Clades), is natural. These studies have also suggested that many early diverging tribal lineages are East Asian in origin, but the sampling of East Asian groups has been poor, and support for relationships within and among major Cariceae clades has been weak. To test deep patterns of relationship in Carex we assembled the longest sequence dataset yet (ITS, ETS 1f, matK, ndhF, rps16; ca. 4400 bp) with taxonomic sampling focused on critical East and Southeast Asian Carex sections that have blurred subgeneric limits (Decorae, Graciles, Mundae) or have been at the heart of theories on tribal origins (Hemiscaposae, Indicae, Surculosae, Euprepes, Mapaniifoliae, Hypolytroides). Results indicate that subg. Vigneastra is highly polyphyletic (in five of seven major lineages recognised), and they provide the strongest support yet seen for all previously recognised major Cariceae clades in a single analysis (≥ 93% BS). Moreover, results provide strong evidence for three previously unrecognised early diverging East and Southeast Asian lineages: a “Hypolytroides Clade” (sect. Hypolytroides) sister to the Siderostictae Clade, and for a “Dissitiflora Lineage” (sect. Mundae) and a morphologically diverse “Small Core Carex Clade” (sects. Graciles, Decorae, Mapaniifoliae, Euprepes, Indicae) as successive sisters to approximately 1400 species in the Core Carex Clade. Our findings also suggest that morphological diversification may have occurred in clades dominated by Asian species followed by canalization to a narrower range of morphologies in species-rich, cosmopolitan lineages.
3
Keywords: Sedges, Insect Pollination, Biogeography, Major Clades
4
1. Introduction With approximately 1966 species (Govaerts et al., 2014) and a distribution spanning all continents except Antarctica, Carex L. and its tribe Cariceae Pax (sedges) represent one of the most diverse and floristically important temperate lineages of flowering plants (Ball, 1990; Reznicek, 1990; Starr and Ford, 2009). Although Carex species are of limited practical and economic importance (Le Cohu, 1967; Simpson and Inglis, 2001), except as weeds (Bryson and Carter, 2008), their ecological significance is considerable. Cariceae are found in nearly every habitat from arctic and alpine tundra to deserts and tropical forests, though they are generally most diverse and dominant in temperate wetlands and forests (Egorova, 1999). From an evolutionary perspective, Carex is interesting for many reasons. It is among the largest of all plant genera (Frodin, 2004) possessing a tropical-like diversity even in temperate zones (Starr et al., 2009). Its phytogeography is among the most diverse and complex of all plants with sedge taxa displaying almost every recognised biogeographic pattern (Croizat, 1952). Moreover, Carex is cytologically exceptional with pseudomonad development during microsporogenesis, postreductional meiosis and diffuse centromeres being involved in the evolution of the longest aneuploidy series known for any living group (Hipp et al., 2009). However, until recently it has been difficult to study the evolutionary history of Carex because our understanding of phylogenetic relationships within Cariceae was generally speculative (Starr and Ford, 2009; Starr et al., 2004). This has largely changed due to molecular data (Roalson et al., 2001; Starr et al., 1999, 2003, 2004, 2008; Waterway and Starr, 2007; Waterway et al., 2009; Yen and Olmstead, 2000), and the first studies to use molecular phylogenies to understand sedge character evolution, biogeography, niche differentiation and chromosome evolution are now
5
being published (Escudero and Hipp, 2013; Escudero et al., 2010, 2012a, 2012b, 2013; Gehrke and Linder, 2009; Starr et al., 2004, 2009). Traditional classifications divided the tribe into five genera (Carex L., Cymophyllus Mack., Kobresia Willd., Schoenoxiphium Nees, Uncinia Pers.) on the basis of perigynium, spikelet sexuality, rachillae and vegetative characters (Britton and Brown, 1913; Kükenthal, 1909) (terminology follows Table 1). Carex itself was divided into four subgenera (Carex, Psyllophora (Degl.) Peterm., Vignea (P. Beauv. ex Lestib. f.) Peterm., Vigneastra (Tuck.) Kük.) and over 135 sections based on the presence or absence of prophylls, stigma numbers, and the sexual arrangement and structure of inflorescences (Table 1), but the taxonomic makeup and status of these subgenera was often controversial (Reznicek, 1990; Starr and Ford, 2009). In contrast to traditional tribal classifications, molecular studies show that all Cariceae genera are nested within Carex (Cariceae = Carex hereafter), and with the exception of subg. Vignea, all Carex subgenera are unnatural (Starr and Ford, 2009). These studies indicate that there are at least five major lineages in Carex that largely separate out along non-traditional taxonomic boundaries (i.e, the Core Carex, Schoenoxiphium, Core Unispicate, Vignea and Siderostictae Clades) (Starr and Ford, 2009; Waterway and Starr, 2007; Waterway et al., 2009) (Table 2). Although the relationships among the Core Carex, Schoenoxiphium, Core Unispicate, and Vignea clades remain ambiguous, Waterway et al. (2009) demonstrated that they formed a strongly supported clade (hereafter the “Major Carex Alliance”) that was sister to section Siderostictae Franchet ex Ohwi (ca. 12 species), a small East Asian group placed in subgenus Carex. Moreover, their analysis confirmed that the Core Carex and Vignea Clades (1410 and 300 spp., respectively), were also sister to East Asian species (Starr and Ford, 2009), and that the
6
sister to the Major Carex Alliance itself was East Asian. This led Waterway et al. (2009) to conclude that the Siderostictae Clade was the earliest diverging lineage within the tribe and that the Cariceae was Asian in origin, an hypothesis held by several mid-twentieth century caricologists (Koyama, 1957a; Nelmes, 1951; Raymond, 1955, 1959). They also suggested that several rare and unusual characteristics shared by most Siderostictae species like broad oblanceolate leaves, fasciculate androgynous lateral inflorescence units, beakless perigynia with obtuse pistillate scales, and rachillae occasionally protruding from perigynia with terminal male flowers were features that might have been shared by the ancestor to the tribe. The seemingly special nature of section Siderostictae is further highlighted by other uncommon Carex features such as infundibuliform bracts, fertile culms not surrounded by green leaves (i.e., pseudolateral culms; Tang and Liang, 1987), and the lowest chromosome numbers known for Cariceae (n = 6 or 12; Tanaka, 1949). An analysis by Yano et al. (2014) has since shown that the “Siderostictae Clade” is closely related to two other East and Southeast Asian groups from Carex subgenus Vigneastra, sections Hemiscaposae C.B. Clarke (ca. 12 species) and Surculosae Raymond (ca. 4 species). Like Siderostictae, these two sections possess infundibuliform bracts, pseudolateral fertile culms, fasciculate androgynous lateral inflorescence units (Dai et al., 2010) and chromosome counts of n = 6 or 12 (Yano et al., 2014). However, their inflorescences are compound (paniculate) whereas the Siderostictae are multispicate, and their perigynium beaks are well developed. In addition, these sections possess rare characteristics of their own, such as pseudopetiolate leaves (sect. Hemiscaposae; Fig. 1) or well-developed sterile shoots (sect. Surculosae). This new concept for the Siderostictae Clade demonstrates that determining what Cariceae features may
7
be plesiomorphic for extant Carex is more complex than once believed. As all organisms are a composite of ancestral and derived characteristics, inferring the ancestral features of crown group Carex must consider the phylogenetic and morphologic diversity of both the Major Carex Alliance and the Siderostictae Clade, in addition to any other groups that may have diverged near the basal nodes of the tree (Omland et al., 2008). Despite the high diversity (Dai et al., 2010; Ohwi, 1965) and evolutionary significance of East Asian sedges (Waterway et al., 2009; Yano et al., 2014), only a handful of the species included in phylogenies are East Asian in origin (Starr and Ford, 2009). Asia contains many enigmatic species and groups with rare characteristics that have not been included in phylogenetic analyses. These include taxa such as the broad-leaved Carex sect. Mapaniifoliae Nelmes & Airy Shaw, the grass-like Carex sect. Euprepes Nelmes & Airy Shaw (pers. obs.; Raymond, 1959) and the morphologically striking Carex sect. Hypolytroides Nelmes, whose Scleria P. J. Bergius like stems and corymbiform panicles of unisexual spikes are unique in Carex (Nelmes, 1951; Nelmes, 1955; Raymond, 1959) (Fig. 1). Many of these East and Southeast Asian groups have long been proposed as “primitive” within Cariceae either close to the ancestor of the tribe or to the ancestors of the major groups within it (Koyama, 1957a; Kükenthal, 1909; Nelmes, 1951, 1955; Raymond, 1959; Reznicek, 1990). In the course of our continuing research on the evolution and relationships of Carex and its close relatives (Gilmour et al., 2013; Léveillé-Bourret et al., 2014; Starr and Ford, 2009), we constructed a nuclear ITS and ETS 1f dataset for approximately 300 taxa that included numerous unsequenced Vietnamese and East Asian species (Ford et al., 2013). Preliminary
8
results from this dataset (Ford et al., 2013) suggested that the small (2 species) East and Southeast Asian Carex section Hypolytroides could represent one of the earliest diverging lineages in Cariceae. It was also suggested that the East Asian Carex dissitiflora Franch., one of only six species to possess consistently fertile perigynium-like prophylls at the base of some branches (Jin et al., 2005), and a morphologically diverse assemblage of other East and Southeast Asian sections from subgenera Carex (Graciles Kük., Decorae (Kük.) Ohwi) and Vigneastra (Mapaniifoliae, Euprepes, Indicae Tuck.) (hereafter the “Small Core Carex Clade”) could be successive sisters to the entire Core Carex Clade (ca. 1410 species). As noted above, many of these sections have been proposed as “primitive” within Cariceae, and the Graciles and Decorae have been at the heart of a long-standing debate over the circumscription of subg. Vigneastra from subg. Carex (Koyama, 1957b, 1962; Ohwi, 1936; Raymond, 1959). Despite the insights gained from this nrDNA dataset, parsimony and Bayesian methods yielded different tree topologies with sect. Hypolytroides positioned either in a trichotomy with the Major Carex Alliance and Siderostictae Clade or as the sister to all other Cariceae. Moreover, very poor support (i.e., < 50% BS) was found for the monophyly of the Small Core Carex Clade and for the position of Carex dissitiflora and the Small Core Carex Clade as successive sisters to the Core Carex Clade. The goal of this study was to assemble multiple markers (ITS, ETS 1f plus chloroplast matK, ndhF, rps16) for a phylogenetically representative sample of all major Cariceae clades known in order to resolve whether the putatively new lineages noted above were natural and of significant evolutionary and biogeographic importance.
9
2. Methods and Materials 2.1. Taxon selection All taxa and the taxonomy used in this study are given with voucher data in Table 3. The results of prior molecular analyses were used to choose taxa that best represented the phylogenetic and morphological diversity of all five known major Cariceae clades. For example, to cover the morphological diversity known in the Core Unispicate Clade, we sampled Carex and Kobresia species (i.e., with closed and open perigynia) with strictly unispicate (e.g., Carex geyeri, Cymophyllus fraserianus), multispicate (e.g., Carex baldensis, Kobresia simpliciuscula) and compound inflorescences (e.g., Carex schiedeana, Kobresia laxa). Uncinia species were not sampled from this clade because prior analyses have placed them near Carex geyeri and Cymophyllus fraserianus whose general reproductive morphology is similar to Uncinia minus hooked rachillae. From a phylogenetic perspective, our sampling included Carex cruciata and Carex gibba as these taxa have been respectively positioned as sister to all other Core Carex and Vignea Clade species. Multiple individuals of Carex hypolytroides (sect. Hypolytroides) were sampled to better represent its distribution as initial analyses suggested C. moupinensis (sect. Hypolytroides) could be more closely related to Sumatran populations than to individuals found on the Indochinese mainland. Multiple individuals of Carex kucyniakii (sect. Hemiscaposae) were sampled after initial molecular analyses correlated with morphological variation noted in the field (i.e., strictly multispicate versus weakly compound individuals).
10
2.2. DNA isolation, amplification and sequencing All regions were PCR-amplified from total genomic DNA isolated from herbarium specimens or silica-dried leaves from field collections using a silica-column-based method (Alexander et al., 2007) with a modified binding buffer (Starr et al., 2009). Primer sequences and amplification procedures for the nuclear regions ITS and ETS 1f followed Starr et al. (2003), whereas primers and PCR protocols for the chloroplast coding regions matK and ndhF were the same as in Gilmour et al. (2013). For the chloroplast non-coding rps16 intron region, the primers rps16-F (5’AAACGATGTGGTAGAAAGCAAC3’) and rps16-R (5’AACATCAATTGCAACGATTCGATA3’) were used for PCR amplifications (modified from Shaw et al., 2005, to remove base ambiguities). Each PCR amplification for rps16 contained the following reactants dissolved in an end volume of 15 μl: 1X PCR buffer (Bioline), 0.2 mM of each dNTP, 0.25 μM of each primer, 1.5 mM MgCl2, 10–50 ng of template DNA, and 0.3 units of BIOTAQ DNA Polymerase (Bioline). PCR products were amplified on an Eppendorf© EPGradientS Mastercycler via a pretreatment of 94°C for 3 min, followed by 40 cycles of DNA denaturation at 94°C for 30s, primer annealing at 47°C for 60s, and DNA extension at 68°C for 90s. An extension phase at 68°C for 5 min was conducted at the end of cycling. A sample of each reaction was run on 2.0 % agarose gels stained with ethidium bromide. Successful products were purified using an Exonuclease I and Shrimp Alkaline Phosphatase protocol (MJS Biolynx Inc., Canada) and cycle sequenced with PCR primers using an ABI Prism™ Big Dye™ terminator kit version 3.1 (Applied Biosystems). Cyclesequencing products were purified following a sodium acetate/ethanol procedure (Applied
11
Biosystems) and run on a 3130xl Genetic Analyser. Sequence data were assembled and edited in Sequencher 4.10 (Gene Codes Corporation, Ann Arbor, MI, USA). 2.3. Phylogenetic analysis For the combined five marker Cariceae analysis (ITS, ETS 1f, rps16, matK, ndhF; hereafter the “combined analysis or matrix”), all sequences were novel to this study with the exception of ITS and ETS 1f for 28 taxa from the following analyses (Ford et al., 2006; Starr and Ford, 2009; Starr et al., 1999, 2004, 2008; Waterway and Starr, 2007) (Table 3). As the analysis of Yano et al. (2014) included some sect. Surculosae species and a wider sampling of sections Siderostictae and Hemiscaposae than the current study, a matrix of the one marker (ITS) shared by this study and Yano et al. (2014) was analysed to confirm that sect. Hypolytroides was not nested within the Siderostictae Clade. Genbank numbers for all the sequences used in analyses are given in Table 3. Sequences were initially aligned with Clustal X (Thompson et al., 1997) and then adjusted manually using parsimony as a criterion for choosing between alternative alignments (Starr et al., 2004). Complete sequences for the 5.8S gene (ITS region) were obtained for all taxa that were newly sequenced. However, as the middle portion of this highly conserved gene was missing for sequences used from Starr et al. (1999, 2004), only the first five and the last 17 base pairs of the 5.8S gene were used in analyses as they were common to all taxa (i.e., 144 bp were deleted). Owing to alignment ambiguity, characters 18-19, 237-238, 268-279, 331-351, 356-363, 1068-1070, 1170-1171, 4052-4061, and 4693-4700 from the combined matrix and characters 18-19, 240-241, 271-282, 334-354, and 359-366 from the ITS matrix were excluded from all
12
analyses. Aligned matrices for all analyses are available on TreeBASE (http://www.treebase.org/). Tree searches were performed using parsimony for the combined and ITS matrices, whereas a Bayesian analysis was conducted only for the combined data. For both methods, Eriophorum vaginatum and Scirpus polystachyus were used as outgroups as previous molecular analyses have placed them close to Cariceae (Léveillé-Bourret et al., 2014; Muasya et al., 1998; Simpson et al., 2007). Parsimony analyses were conducted in PAUP* 4.0b10 (Swofford, 2003) using heuristic searches and a random addition sequence of taxa for 50,000 (combined) or 10,000 (ITS) replicates with the MULTREES option on. Support for internal branches was assessed via the bootstrap (BS; Felsenstein, 1985) using a simple addition sequence for 50,000 (combined) or 10,000 (ITS) replicates with the MULTREES option on (combined) or off (ITS; DeBry and Olmstead, 2000). Clade support was subjectively described (strong, weak, etc.) according to the explicit intervals in BS values defined in Starr et al. (2004). Posterior probabilities (PP, see below) were not considered when describing clade support. Bayesian analyses were performed in MrBayes 3.2.2 (Ronquist and Huelsenback, 2003). The posterior tree distribution was estimated via a Metropolis-coupled Markov Chain Monte Carlo (MC3) analysis of two independent runs of 10,000,000 generations with a tree sampled every 500th generation from one of four simultaneously run Markov chains. All five data partitions were treated separately in a mixed model where a general-time-reversible (GTR) model incorporating a gamma distribution (G) and invariant sites (I) was enforced for ITS and ndhF during the running of the chain, and a GTR + G model for ETS, matK and rps16. The model
13
for each partition was chosen using the Akaike Information Criterion (AIC; Akaike, 1974) as implemented in MrModeltest 2.3 (Nylander, 2004). A plot of log-likelihoods versus generation number was used to determine when chains levelled off and began to fluctuate around a stable value. As the stationary phase was reached rather rapidly, only 10% of trees were discarded as unrepresentative of the posterior distribution. To assess whether enough generations had been run to reach convergence and to determine whether sufficient mixing of the chain had occurred to provide reliable parameter estimates, three further independent analyses using the same initial parameters as above were conducted. Convergence and mixing were assessed by a comparison of likelihood values, the standard deviation of split frequencies between runs, the potential scale reduction factor (“sump” command), and the topologies of 50% majority rule consensus trees that were generated via the “sumt contype = allcompat” command. TreeAnnotator v1.8.0 was used to determine the maximum clade credibility tree for all trees sampled from the stationary phase of all four Bayesian analyses conducted. This tree was used in PAUP to estimate the number of unambiguous character changes or apomorphies supporting the major Cariceae clades by using the DESCRIBETREES apolist = yes command.
14
3. Results 3.1. Phylogenetic analysis The combined matrix of ITS, ETS 1f, matK, ndhF, and rps16 sequences for 67 terminals produced 4733 aligned characters of which 68 were excluded, and 927 were parsimony informative. Parsimony searches found 7 trees, 3942 steps long (CI = 0.52; RI=0.70). As the strict consensus of parsimony analyses was fully compatible with Bayesian analyses with the exception of one branch (see below), the results of parsimony analyses were summarized on the Bayesian tree presented in Fig. 2. A full description of the relationships and major clades within this tree are given below. For Bayesian analyses of the combined matrix, plots of log-likelihood values versus generation number indicated that the stationary phase was quickly reached around 35,000 generations for all runs. Nonetheless, 10% of trees were excluded from each run to be certain that trees unrepresentative of the posterior distribution would be excluded from majority rule consensus trees. Comparisons of likelihood values, the standard deviation of split frequencies between runs (1 lateral order), multispicate (1 lateral order) or unispicate (no lateral orders) with the ultimate axis of a grouping of male or female flowers on terminal or lateral inflorescence units referred to as a “spike”. The first lateral order of a lateral inflorescence unit is typically subtended by a tubular cladoprophyll with subsequent orders subtended by perigynium-like inflorescence prophylls that are also present on the lateral orders of the terminal inflorescence unit (no cladoprophyll being possible). Cymophyllus has a similar spikelet and inflorescence morphology to unispicate Carex and is largely segregated on the basis of vegetative characters. See Starr and Ford (2009) for stylised figures of Cariceae spikelets and inflorescence morphology as well as a full discussion on the circumscription of major groups and their characters.
Carex subg. Carex Psyllophora Vignea Vigneastra Cymophyllus
Perigynia
Perigynial Complex
Rachilla
Inflorescence
Inflorescence units
Inflorescence prophyll
Cladoprophyll
Stigmas
Fused to apex Fused to apex Fused to apex Fused to apex Fused
Unisexual
+/Insert +/Insert +/Insert +/Insert +
Multispicate
-
+
3
-
-
2-3
-
-
2
Compound
Terminal male, lateral female Androgynous or dioecious Androgynous or gynaecandrous Androgynous
+
+
3
Unispicate
Androgynous
-
-
3
Unisexual Unisexual Unisexual Unisexual
Unispicate Multispicate
41
Uncinia
to apex Fused to apex
Unisexual
Kobresia
Unfused to apex
Bisexual
Schoenoxiphium
Unfused to apex
Bisexual
Insert + Exsert, hooked + Exsert, terete + Exert, flat
Unispicate
Androgynous
-
-
3
Unispicate to Compound
Androgynous
-
+/-
2-3
Compound
Androgynous
-
+
3
42
17 18 19 20 21
Table 2. The taxonomic composition, diversity and distribution of species from the five major Cariceae clades discovered in molecular analyses. Species number estimates are extrapolations based on the known taxonomic composition of clades and the number of species recognised for genera in Govaerts et al. (2014) and for Carex subgenera and sections in standard works such as Dai et al. (2010), Ball and Reznicek (2002), and Chater (1980). Major Cariceae Clades
Core Carex Clade
Vignea Clade
Core Unispicate Clade
Schoenoxiphium Clade
Siderostictae Clade
Traditional Genera and Carex Subgenera included in clade Carex subgenera Carex p.p., Psyllophora p.p., Vigneastra p.p. Carex subgenera Vignea and Psyllophora p.p. Cymophyllus, Uncinia, Kobresia, Carex subgenenera Psyllophora p.p., Vignea p.p., Vigneastra p.p. Schoenoxiphium, Carex subgenera Psyllophora p.p., Vigneastra p.p. Carex subgenera Carex p.p., Vigneastra p.p.
Approximate number of Species in clade
Distribution
1410
All continents, except Antarctica
300
All continents, except Antarctica
183
All continents, except Antarctica
45
Africa, Europe, South America, Oceania
28
East Asia
43
22 23 24 25 26 27 28
Table 3. Classification, voucher data and Genbank numbers for Cariceae taxa used in ITS and in combined ITS, ETS 1f, matK, ndhF, and rps16 analyses. Ingroup taxa are arranged in alphabetical order to section, with outgroup taxa placed last. Generic delimitation follows Kükenthal (1909) and Ball et al. (2002). Subgeneric circumscription adheres to Kükenthal (1909) and Zhang (2001), whilst sections follow Kükenthal (1909), Raymond (1959), Chater (1980), Wheeler (1989), Dai et al. (2010), Zhang (2001) and Ball and Reznicek (2002). Individuals sampled from the same species are numbered (1) to (7). Species names followed by an asterisk “*” denote taxa whose sequences were combined from two vouchers to form a single terminal for phylogenetic analyses. Sequences without voucher details come from Yano et al. (2014). Herbarium acronyms follow Thiers (2014). Genus
Carex L.
Subgenus
Carex
Section
Species
Voucher
Cryptostachyae Franch.
Carex cryptostachys Brongn.
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1202 et al., (WIN)
Decorae (Kük.) Ohwi
Carex dielsiana Kük.
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1248A et al., (WIN)
Carex perakensis var. perakensis C.B.Clarke
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1211A et al., (WIN)
Carex aff. perakensis var. vansteensii (Kük.) Noot.
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1235A et al., (WIN)
Genbank (ITS, ETS 1f, matK, ndhF, rps16) KP273638, KP273604, KP273677, KP273731, KP273788 KP273639, KP273605, KP273679, KP273733, KP273790 KP273631, KP273597, KP273668, KP273722, KP273777 KP273630, KP273596, KP273665, KP273719, KP273773
44
Graciles Kük.
Carex brunnea Thunb.
China. Guizhou: Yinjiang Xian, Bartholomew 1574 et al. (TRTE)
Carex teinogyna Boott
Japan. Honshu: Kyoto prefecture, Tsugaru 22920 & Murata (MO)
Gynobasidae Trabut
Carex illegitima Ces.
Greece. Rhodes: SW Rhodes City, Alanko 92256, (TRTE)
Hymenochlaenae (Drejer) L.H.Bailey
Carex cherokeensis Schwein.*
(1) USA. Florida: Holmes Co., Waterway 2000.044, (MTMG) (2) USA. Tennessee: Haywood Co., Reznicek 10044 & Naczi, (DOV) Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1206 et al., (WIN)
Lageniformes (Ohwi) Nelmes
Carex breviscapa C.B. Clarke
Laxiflorae Kunth
Carex blanda Dewey
Canada. Ontario: Peterborough, Bakowsky 96-176, (WIN)
Mitratae Kük.
Carex breviculmis var.
Vietnam. Lao Cai:
KP273636, KP273602, KP273674, KP273728, KP273784 KP273661, KP273627, KP273709, KP273763, KP273821 −, KP273613, KP273691, KP273745, KP273801 AY757619, AY757680, −, −, − −, −, KP273675, KP273729, KP273786 KP273635, KP273601, KP273673, KP273727, KP273783 AF027484, AY241983, KJ513583, KJ513491, KP273782 KP273652,
45
Phacocystis Dumort.
breviculmis R. Br.
Hoang Lien National Park, Ford 1238A et al., (WIN)
Carex aquatilis Wahlenb.*
(1) Canada. Québec: Lac St. Francois, Bérubé 99.009, (MTMG) (2) Canada. Newfoundland: Strait of Belle Isle Dist, Bouchard 92251 et al., (CAN) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1245A et al., (WIN)
Praelongae (Kük.) Nelmes
Carex pruinosa Boott
Radicales (Kük.) Nelmes
Carex speciosa Kunth
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1236A et al., (WIN)
Rhomboidales (Kük.)
Carex aff. anomocarya Nelmes
Vietnam. Hanoi City: Mount Bavi National Park, Ford 1218 et al., (WIN)
Siderostictae Franch. ex Owhi
Carex ciliatomarginata Nakai
(1) (2)
KP273618, KP273696, KP273750, KP273806 AY757590, AY757651, −, −, − −, −, KP273666, KP273720, KP273775
KP273655, KP273621, KP273701, KP273755, KP273812 KP273659, KP273625, KP273706, KP273760, KP273818 KP273629, KP273595, KP273664, KP273718, KP273772 AB725706, −, −, −, − AB725707, −, −, −, −
46
Carex glossostigma Hand.Mazz.
(1) China. Jiangxi: City of Jing-De-Zhen, Shushen 5682 & Hanrong, (MO) (2)
Carex grandiligulata Kük. Carex longshengensis Y.C. Tang & S.Y. Liang Carex okamotoi Ohwi Carex pachygyna Franch. & Sav. Carex siderosticta Hance
(1) Cultivated, LéveilléBourret 545 (CAN)
(2) (3) (4) (5) (6) (7)
KP273644, −, KP273686, KP273740, − AB725708, −, −, −, − AB725709, −, −, −, − AB725710, −, −, −, − AB725711, −, −, −, − AB725712, −, −, −, − KP273658, KP273624, KJ513592, KJ513499, KP273817 AB725713, −, −, −, − AB725714, −, −, −, − AB725715, −, −, −, − AB725716, −, −, −, − AB725717, −, −, −, − AB725718, −, −, −, −
47
Carex sp. Carex subcapitata X.F. Jin, C. Z. Zheng & B.Y. Ding
(1) (2)
Carex tumidula Ohwi Squarrosae J.Carey
Psyllophora (Degl.) Peterm.
Aciculares (Kük.) G.A. Wheeler
Carex squarrosa L.*
Carex acicularis Boott*
Firmiculmes (Kük.) Mack.
Carex geyeri Boott
Junciformes (Boeckl.) Kük.
Carex aphylla Kunth*
(1) USA. Illinois: Pope Co., Waterway 98.020, (MTMG) (2) USA. Georgia: Meriwether Co., Naczi 9159, (DOV) (1) New Zealand. Fiordland: Southland Land District, Ford 113/98, (FHO) (2) New Zealand. Ford 29/94, (CHR)
AB725722, −, −, −, − AB725719, −, −, −, − AB725720, −, −, −, − AB725721, −, −, −, − AY757587, AY757648, −, −, − −, −, KP273707, KP273761, KP273819 AY242012, AY242013, −, −, −
−, −, KP273662, KP273716, KP273770 USA. Montana: Cascade AF027434, Co., Starr MT96039, AF027474, (WIN) KP273684, KP273738, KP273795 (1) Argentina. Prov. Rio AY242014, Negro, Laegaard AY242015, −, −, − 13496, (AAU) (2) Argentina. Prov. −, −,KJ513582, Neuquén: Parque KJ513490,
48
Leucoglochin Dumortier
Carex camptoglochin V.I.Krecz.
Carex microglochin Wahlenb.*
Physoglochin Dumort.
Carex gynocrates Wormsk.*
Psyllophora (Degl.) Koch
Carex pulicaris L.
Scirpinae (Tuck.) Kük.
Carex scirpoidea Michx.*
Nacional Lanín, J. Starr 10025 & T. Villaverde (CAN) Ecuador. Chimborazo, Molau 2329 et al., (GB)
(1) UK. Scotland: Meall Greigh, Starr 98017 & Scott, (FHO) (2) Argentina. Tierra del Fuego: between Ushuaia and Tolhuin, J. Starr 10008 et al., (CAN) (1) Canada. Québec: Schefferville region, Dabros s. n., (MTMG) (2) Canada. Manitoba: Wapusk National Park, Ford 02283 et al. (WIN) UK. England: North Yorkshire/Cumbria, Starr 98001 & Scott, (FHO) (1) Canada. Alberta: Jasper National Park, Bayer AB-96010 et al.,
KP273774)
AY244519, AY244520, KJ513584, KJ513492, KP273785 AY244517, AY244518, −, −, − −, −, KP273698, KP273752, KP273808
AY757417, AY757383, −, −, − −, −, KJ513587, KJ513495, KP273797 AY242018, AY242019, KJ513590, KJ513576, KP273813 AF027486, AY241991, −, −, −
49
Vignea (P. Bauv. ex Lestib. f.) Peterm.
Ammoglochin Dumort.
Carex arenaria L.
Carex siccata Dewey*
Baldenses Tuck.
Carex baldensis L.
Deweyanae (Tuck. ex Mack.) Mack.
Carex deweyana Schwein.
Gibbae Kük.
Carex gibba Wahlenb.*
(WIN) (2) USA. Alaska: Eklutna Lake, Reznicek 11727, (DOV) UK. Scotland: Lunan Bay Sand Dunes, Starr 98020 & Scott, (FHO)
−, −, KP273704, KP273758, KP273815 AY242003, AY242004, KP273667, KP273721, KP273776 DQ115274, DQ115275, −, −, −
(1) Canada. Manitoba: ca. 1.5 km N of town of Falcon Lake, Naczi 9862 & Ford, (DOV) (2) USA. Colorado: Park −, −, KP273705, Co., Lea 3453, (DOV) KP273759, KP273816 Switzerland. EF363120, Montreaux: (cultivated EF363121, by A. A. Reznicek), KP273671, Reznicek 8250, (MICH) KP273725, KP273780 Canada. Alberta: AF027476, Edmonton, Starr 96007, AY242007, (WIN) KP273678, KP273732, KP273789 (1) China. Hunan: Li DQ115174, Ling, Da Lin County, Liu DQ115175, −, −, − 6741, (MO) (2) China. Shaanxi: −, −, KP273685, Yang Xian, Zhu 2776 et KP273739,
50
Vigneastra (Tuck.) Kük.
al., (MO) Macrocephalae Kük. Carex macrocephala Willd. (1) Canada. British ex Spreng.* Columbia: Tsawwassen, Boundary Bay Regional Park, Ford 9715, (WIN) (2) USA. Alaska: Yakutat forelands, Stensvold 8154, (DOV) Multiflorae (J.Carey) Kük. Carex vulpinoidea Michx.* (1) USA. Kentucky: Monroe Co., Ford 9872 & Naczi, (WIN) (2) USA. Maine: Washington Co., Reznicek 11687, (DOV) Euprepes Nelmes & Airy Carex euprepes Nelmes Vietnam. Lao Cai: Liem Shaw Phu Commune, Ford 1262A et al., (WIN)
Hemiscaposae C. B. Clarke
Carex adrienii E.G.Camus
Carex densifimbriata F.T. Wang & Tang ex S.Y. Liang Carex kucyniakii Raymond
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1203 et al., (WIN)
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1258C et al., (WIN)
KP273796 DQ115210, DQ115211, −, −, −
−, −, KP273697, KP273751, KP273807 DQ115308, DQ115309, −, −, − −, −, KP273710, KP273764, KP273822 KP273641, KP273607, KP273681, KP273735, KP273792 KP273628, KP273594, KP273663, KP273717, KP273771 AB725723, −, −, −, − KP273651, KP273617, KP273695, KP273749, KP273805
51
Carex aff. kucyniakii Raymond
(1) Vietnam. Lao Cai: Liem Phu Commune, Ford 1261A et al., (WIN) (2) Vietnam. Lao Cai: Nam Xe Commune, Ford 1263A et al., (WIN) (3) Vietnam. Lao Cai: Van Ban Nature Reserve, Ford 1265A et al., (WIN)
Carex lingii F.T. Wang & Tang Carex scaposa C.B. Clarke
(1) China. Guizhou: Songtao Xian, Bartholomew 2160 et al., (TRTE) (2) (3)
Hypolytroides Nelmes
Carex hypolytroides Ridl.
(1) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1222C et al., (WIN) (2) Vietnam. Lao Cai: Hoang Lien National
KP273649, KP273615, KP273693, KP273747, KP273803 KP273650, KP273616, KP273694, KP273748, KP273804 KP273648, KP273614, KP273692, KP273746, KP273802 AB725724, −, −, −, − KP273656, KP273622, KP273702, KP273756, − AB725725, −, −, −, − AB725726, −, −, −, − KP273645, −, KP273687, KP273741, KP273798 KP273646, KP273610,
52
Park, Ford 1255A et al., (WIN) (3) Vietnam. Kon Tum: NW Slopes of Mt. Ngoc Linh, Averyanov VH107 et al., (MO)
Carex moupinensis Franch.
Indicae Tuck.
Carex balansae Franch.
Carex cruciata Wahlenb.
Carex filicina Nees
KP273688, KP273742, − KP273647, KP273612, KP273690, KP273744, KP273800 (4) Indonesia. Sumatra: −, KP273611, Mt. Kinabalu, Sinclair KP273689, 9220, (L) KP273743, KP273799 China. Sichuan: Dongla KP273653, Canyon, Kyong-Sook KP273619, Chung and Rong Li 40KP273699, 7, (MOR) KP273753, KP273809 Vietnam. Hanoi City: KP273633, Mount Bavi National KP273599, Park, Ford 1273A et al., KP273670, (WIN) KP273724, KP273779 (1) Vietnam. Hanoi City, KP273637, Ford 1214A et al., KP273603, (WIN) KP273676, KP273730, KP273787 (2) AB725727, −, −, −, − (1) Vietnam. Lao Cai: KP273642, Hoang Lien National KP273608, Park, Ford 1247A et al., KP273682,
53
(WIN) (2) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1229 et al., (WIN) Carex stramentitia Boott ex Boeckeler
Japonicae Kük. Mapaniifoliae Nelmes & Airy-Shaw
Carex satsumensis Franch. & Sav. Carex bavicola Raymond
Vietnam. Ninh Binh: Cuc Phuong National Park, Ford 1271 & Regalado, (WIN)
Vietnam. Hanoi City: Mount Bavi National Park, Ford 1215B et al., (WIN)
Mundae Kük.
Carex dissitiflora Franch.
Japan. Honshu: Kyoto prefecture, Tsugaru 26239 et al., (MO)
Polystachyae Tuck.
Carex baccans Nees
Dahai 102, (MO)
Carex myosurus Nees
(1) Vietnam. Lao Cai: Hoang Lien National
KP273736, KP273793 KP273643, KP273609, KP273683, KP273737, KP273794 KP273660, KP273626, KP273708, KP273762, KP273820 AB725728, −, −, −, − KP273634, KP273600, KP273672, KP273726, KP273781 KP273640, KP273606, KP273680, KP273734, KP273791 KP273632, KP273598, KP273669, KP273723, KP273778 KP273654, KP273620,
54
Park, Ford 1246A et al., (WIN)
Carex polystachya Sw. ex Wahlenb.
Schiedeanae Kük.
Carex schiedeana Kunze
Surculosae Raymond
Carex tsiangii F.T. Wang & Tang Carex kwangsiensis F.T. Wang & Tang ex P.C. Li Cymophyllus fraserianus (Ker-Gawler) Kartesz & Gandhi
Cymophyllus Mack.
Kobresia Willd.
Kobresia
Compositae (C.B. Clarke) Kukkonen
Kobresia laxa Nees
Hemicarex (Benth.) C.B.
Kobresia esenbeckii
KP273700, KP273754, KP273810 (2) AB725729, −, −, −, − Belize. Cayo, Jones AF027487, 11275 & Wipff, (MICH) AY241998, KJ513589, KJ513497, KP273811 Mexico. San Luis Potosi, KP273657, Jones 5588 & KP273623, Manrique, (MO) KP273703, KP273757, KP273814 AB725731, −, −, −, − AB725730, −, −, −, − USA. Tennessee: Blount AY241969, Co., Sharp s.n. AY241970, (cultivated at K), Starr KP273711, 98024 ex RBG Kew, KP273765, (FHO) KP273823 India. Sikkim: North AY241975, district, Long 211 & AY241976, Noltie, (E) KP273713, KP273767, KP273825 India. Sikkim: East AY242032,
55
Clarke
(Kunth) Noltie
district, Long 335 et al., (E)
Kobresia nepalensis (Nees) India. Sikkim: North Kük. district, Long 291 & Noltie, (E)
Kobresia Willd.
Kobresia myosuroides (Vill.) Fiori*
Kobresia simpliciuscula (Wahlenb.) Mack.*
Schoenoxiphium Nees
Schoenoxiphium lanceum (Thunb.) Kük.*
(1) France. Col du Galibier, Playford 9804 et al., (FHO) (2) Canada. British Columbia: W of Teepee Heart Ranch, Jones 146, (UBC) (1) Canada. British Colombia: Emerald Lake, Ford 9710, (FHO) (2) Canada. Yukon, Porsild 1825, (CAN)
(1) South Africa. Western Cape: Stellenbosch, McDonald 829, (PRE) (2) South Africa. Western Cape: Stellenbosch, Dahlstrand 1302, (PRE) Schoenoxiphium lehmannii South Africa. Natal:
AY242033, KP273712, KP273766, KP273824 AY242034, AY242035, KP273714, KP273768, KP273827 AY242036, AY242037, −, −, − −, −, KJ513622, KJ513529, KP273826 AY241971, AY241972, −, −, − −, −, JX065088, JX074644, KP273828 AY242028, AY242029, −, −, −
−, −, KJ513625, KJ513532, KP273829 AY242026,
56
Outgroups
(Nees) Kunth ex Steud.
Ngoye Forest Reserve, Williams 1007, (PRE)
Schoenoxiphium sparteum (Wahlenb.) C.B.Clarke*
South Africa: Orange Free State, Ladybrand, De Lange FA 57, (PRE) (2) South Africa. Smook 6625, (PRE) UK. England, Starr 98007 & Scott, (FHO)
Eriophorum vaginatum L.
Scirpus polystachyus F. Muell.
Australia. New South Wales, Wilson MCW 5927, (K)
AY242027, KP273715, KP273769, − AY242022, AY242023, −, −, − −, −, KJ513626, KJ513533, − AY242008, AY242009, KJ513615, KJ513522, KP273830 AY242010, AY242011, KJ513651, KJ513558, −
57
29 30
58 31 32 33 34 35 36 37 38 39
• • • • •
Carex/Cariceae is comprised of seven major lineages Three newly discovered early diverging lineages are comprised of East Asian/Southeast Asian taxa New lineages, though small are composed of extremely diverse and unusual morphologies Carex subg. Vigneastra is highly polyphyletic with taxa placed in five of seven major lineages recognised Strongest support yet seen for all previously recognised major Carex/Cariceae clades
59
40
60
41
61
42 43
62
44
63
45
S1055-7903(15)00097-4 http://dx.doi.org/10.1016/j.ympev.2015.04.001 YMPEV 5160
To appear in:
Molecular Phylogenetics and Evolution
Received Date: Revised Date: Accepted Date:
22 January 2015 26 March 2015 1 April 2015
Please cite this article as: Starr, J.R., Janzen, F.H., Ford, B.A., Three new, early diverging Carex (Cariceae, Cyperaceae) lineages from East and Southeast Asia with important evolutionary and biogeographic implications, Molecular Phylogenetics and Evolution (2015), doi: http://dx.doi.org/10.1016/j.ympev.2015.04.001
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Three new, early diverging Carex (Cariceae, Cyperaceae) lineages from East and Southeast Asia with important evolutionary and biogeographic implications
Julian R. Starra,b,*, Francesco H. Janzena,b, and Bruce A. Fordc
a
Department of Biology, University of Ottawa, Ottawa, Ontario, K1N 6N5, Canada.
b
Canadian Museum of Nature, Ottawa, Ontario, K1P 6P4, Canada.
c
Department of Biological Sciences, University of Manitoba, Winnipeg, Manitoba, R3T 2N2, Canada.
*
Corresponding author at: Department of Biology, University of Ottawa, Gendron Hall, Room 160, 30 Marie Curie, Ottawa, Ontario, K1N 6N5, Canada, phone: 1-613-562-5800 ext. 6100; email: [email protected]
E-mail addresses: [email protected] (J.R. Starr), [email protected] (F.H. Janzen), [email protected] (B.A. Ford)
2
Abstract Traditional Cariceae and Carex (1966 spp.) classifications recognised five genera (Carex, Cymophyllus, Kobresia, Schoenoxiphium, Uncinia) and four subgenera (Carex, Vignea, Vigneastra, Psyllophora). However, molecular studies show that only Carex, divided into five major lineages (the Core Carex, Schoenoxiphium, Core Unispicate, Vignea and Siderostictae Clades), is natural. These studies have also suggested that many early diverging tribal lineages are East Asian in origin, but the sampling of East Asian groups has been poor, and support for relationships within and among major Cariceae clades has been weak. To test deep patterns of relationship in Carex we assembled the longest sequence dataset yet (ITS, ETS 1f, matK, ndhF, rps16; ca. 4400 bp) with taxonomic sampling focused on critical East and Southeast Asian Carex sections that have blurred subgeneric limits (Decorae, Graciles, Mundae) or have been at the heart of theories on tribal origins (Hemiscaposae, Indicae, Surculosae, Euprepes, Mapaniifoliae, Hypolytroides). Results indicate that subg. Vigneastra is highly polyphyletic (in five of seven major lineages recognised), and they provide the strongest support yet seen for all previously recognised major Cariceae clades in a single analysis (≥ 93% BS). Moreover, results provide strong evidence for three previously unrecognised early diverging East and Southeast Asian lineages: a “Hypolytroides Clade” (sect. Hypolytroides) sister to the Siderostictae Clade, and for a “Dissitiflora Lineage” (sect. Mundae) and a morphologically diverse “Small Core Carex Clade” (sects. Graciles, Decorae, Mapaniifoliae, Euprepes, Indicae) as successive sisters to approximately 1400 species in the Core Carex Clade. Our findings also suggest that morphological diversification may have occurred in clades dominated by Asian species followed by canalization to a narrower range of morphologies in species-rich, cosmopolitan lineages.
3
Keywords: Sedges, Insect Pollination, Biogeography, Major Clades
4
1. Introduction With approximately 1966 species (Govaerts et al., 2014) and a distribution spanning all continents except Antarctica, Carex L. and its tribe Cariceae Pax (sedges) represent one of the most diverse and floristically important temperate lineages of flowering plants (Ball, 1990; Reznicek, 1990; Starr and Ford, 2009). Although Carex species are of limited practical and economic importance (Le Cohu, 1967; Simpson and Inglis, 2001), except as weeds (Bryson and Carter, 2008), their ecological significance is considerable. Cariceae are found in nearly every habitat from arctic and alpine tundra to deserts and tropical forests, though they are generally most diverse and dominant in temperate wetlands and forests (Egorova, 1999). From an evolutionary perspective, Carex is interesting for many reasons. It is among the largest of all plant genera (Frodin, 2004) possessing a tropical-like diversity even in temperate zones (Starr et al., 2009). Its phytogeography is among the most diverse and complex of all plants with sedge taxa displaying almost every recognised biogeographic pattern (Croizat, 1952). Moreover, Carex is cytologically exceptional with pseudomonad development during microsporogenesis, postreductional meiosis and diffuse centromeres being involved in the evolution of the longest aneuploidy series known for any living group (Hipp et al., 2009). However, until recently it has been difficult to study the evolutionary history of Carex because our understanding of phylogenetic relationships within Cariceae was generally speculative (Starr and Ford, 2009; Starr et al., 2004). This has largely changed due to molecular data (Roalson et al., 2001; Starr et al., 1999, 2003, 2004, 2008; Waterway and Starr, 2007; Waterway et al., 2009; Yen and Olmstead, 2000), and the first studies to use molecular phylogenies to understand sedge character evolution, biogeography, niche differentiation and chromosome evolution are now
5
being published (Escudero and Hipp, 2013; Escudero et al., 2010, 2012a, 2012b, 2013; Gehrke and Linder, 2009; Starr et al., 2004, 2009). Traditional classifications divided the tribe into five genera (Carex L., Cymophyllus Mack., Kobresia Willd., Schoenoxiphium Nees, Uncinia Pers.) on the basis of perigynium, spikelet sexuality, rachillae and vegetative characters (Britton and Brown, 1913; Kükenthal, 1909) (terminology follows Table 1). Carex itself was divided into four subgenera (Carex, Psyllophora (Degl.) Peterm., Vignea (P. Beauv. ex Lestib. f.) Peterm., Vigneastra (Tuck.) Kük.) and over 135 sections based on the presence or absence of prophylls, stigma numbers, and the sexual arrangement and structure of inflorescences (Table 1), but the taxonomic makeup and status of these subgenera was often controversial (Reznicek, 1990; Starr and Ford, 2009). In contrast to traditional tribal classifications, molecular studies show that all Cariceae genera are nested within Carex (Cariceae = Carex hereafter), and with the exception of subg. Vignea, all Carex subgenera are unnatural (Starr and Ford, 2009). These studies indicate that there are at least five major lineages in Carex that largely separate out along non-traditional taxonomic boundaries (i.e, the Core Carex, Schoenoxiphium, Core Unispicate, Vignea and Siderostictae Clades) (Starr and Ford, 2009; Waterway and Starr, 2007; Waterway et al., 2009) (Table 2). Although the relationships among the Core Carex, Schoenoxiphium, Core Unispicate, and Vignea clades remain ambiguous, Waterway et al. (2009) demonstrated that they formed a strongly supported clade (hereafter the “Major Carex Alliance”) that was sister to section Siderostictae Franchet ex Ohwi (ca. 12 species), a small East Asian group placed in subgenus Carex. Moreover, their analysis confirmed that the Core Carex and Vignea Clades (1410 and 300 spp., respectively), were also sister to East Asian species (Starr and Ford, 2009), and that the
6
sister to the Major Carex Alliance itself was East Asian. This led Waterway et al. (2009) to conclude that the Siderostictae Clade was the earliest diverging lineage within the tribe and that the Cariceae was Asian in origin, an hypothesis held by several mid-twentieth century caricologists (Koyama, 1957a; Nelmes, 1951; Raymond, 1955, 1959). They also suggested that several rare and unusual characteristics shared by most Siderostictae species like broad oblanceolate leaves, fasciculate androgynous lateral inflorescence units, beakless perigynia with obtuse pistillate scales, and rachillae occasionally protruding from perigynia with terminal male flowers were features that might have been shared by the ancestor to the tribe. The seemingly special nature of section Siderostictae is further highlighted by other uncommon Carex features such as infundibuliform bracts, fertile culms not surrounded by green leaves (i.e., pseudolateral culms; Tang and Liang, 1987), and the lowest chromosome numbers known for Cariceae (n = 6 or 12; Tanaka, 1949). An analysis by Yano et al. (2014) has since shown that the “Siderostictae Clade” is closely related to two other East and Southeast Asian groups from Carex subgenus Vigneastra, sections Hemiscaposae C.B. Clarke (ca. 12 species) and Surculosae Raymond (ca. 4 species). Like Siderostictae, these two sections possess infundibuliform bracts, pseudolateral fertile culms, fasciculate androgynous lateral inflorescence units (Dai et al., 2010) and chromosome counts of n = 6 or 12 (Yano et al., 2014). However, their inflorescences are compound (paniculate) whereas the Siderostictae are multispicate, and their perigynium beaks are well developed. In addition, these sections possess rare characteristics of their own, such as pseudopetiolate leaves (sect. Hemiscaposae; Fig. 1) or well-developed sterile shoots (sect. Surculosae). This new concept for the Siderostictae Clade demonstrates that determining what Cariceae features may
7
be plesiomorphic for extant Carex is more complex than once believed. As all organisms are a composite of ancestral and derived characteristics, inferring the ancestral features of crown group Carex must consider the phylogenetic and morphologic diversity of both the Major Carex Alliance and the Siderostictae Clade, in addition to any other groups that may have diverged near the basal nodes of the tree (Omland et al., 2008). Despite the high diversity (Dai et al., 2010; Ohwi, 1965) and evolutionary significance of East Asian sedges (Waterway et al., 2009; Yano et al., 2014), only a handful of the species included in phylogenies are East Asian in origin (Starr and Ford, 2009). Asia contains many enigmatic species and groups with rare characteristics that have not been included in phylogenetic analyses. These include taxa such as the broad-leaved Carex sect. Mapaniifoliae Nelmes & Airy Shaw, the grass-like Carex sect. Euprepes Nelmes & Airy Shaw (pers. obs.; Raymond, 1959) and the morphologically striking Carex sect. Hypolytroides Nelmes, whose Scleria P. J. Bergius like stems and corymbiform panicles of unisexual spikes are unique in Carex (Nelmes, 1951; Nelmes, 1955; Raymond, 1959) (Fig. 1). Many of these East and Southeast Asian groups have long been proposed as “primitive” within Cariceae either close to the ancestor of the tribe or to the ancestors of the major groups within it (Koyama, 1957a; Kükenthal, 1909; Nelmes, 1951, 1955; Raymond, 1959; Reznicek, 1990). In the course of our continuing research on the evolution and relationships of Carex and its close relatives (Gilmour et al., 2013; Léveillé-Bourret et al., 2014; Starr and Ford, 2009), we constructed a nuclear ITS and ETS 1f dataset for approximately 300 taxa that included numerous unsequenced Vietnamese and East Asian species (Ford et al., 2013). Preliminary
8
results from this dataset (Ford et al., 2013) suggested that the small (2 species) East and Southeast Asian Carex section Hypolytroides could represent one of the earliest diverging lineages in Cariceae. It was also suggested that the East Asian Carex dissitiflora Franch., one of only six species to possess consistently fertile perigynium-like prophylls at the base of some branches (Jin et al., 2005), and a morphologically diverse assemblage of other East and Southeast Asian sections from subgenera Carex (Graciles Kük., Decorae (Kük.) Ohwi) and Vigneastra (Mapaniifoliae, Euprepes, Indicae Tuck.) (hereafter the “Small Core Carex Clade”) could be successive sisters to the entire Core Carex Clade (ca. 1410 species). As noted above, many of these sections have been proposed as “primitive” within Cariceae, and the Graciles and Decorae have been at the heart of a long-standing debate over the circumscription of subg. Vigneastra from subg. Carex (Koyama, 1957b, 1962; Ohwi, 1936; Raymond, 1959). Despite the insights gained from this nrDNA dataset, parsimony and Bayesian methods yielded different tree topologies with sect. Hypolytroides positioned either in a trichotomy with the Major Carex Alliance and Siderostictae Clade or as the sister to all other Cariceae. Moreover, very poor support (i.e., < 50% BS) was found for the monophyly of the Small Core Carex Clade and for the position of Carex dissitiflora and the Small Core Carex Clade as successive sisters to the Core Carex Clade. The goal of this study was to assemble multiple markers (ITS, ETS 1f plus chloroplast matK, ndhF, rps16) for a phylogenetically representative sample of all major Cariceae clades known in order to resolve whether the putatively new lineages noted above were natural and of significant evolutionary and biogeographic importance.
9
2. Methods and Materials 2.1. Taxon selection All taxa and the taxonomy used in this study are given with voucher data in Table 3. The results of prior molecular analyses were used to choose taxa that best represented the phylogenetic and morphological diversity of all five known major Cariceae clades. For example, to cover the morphological diversity known in the Core Unispicate Clade, we sampled Carex and Kobresia species (i.e., with closed and open perigynia) with strictly unispicate (e.g., Carex geyeri, Cymophyllus fraserianus), multispicate (e.g., Carex baldensis, Kobresia simpliciuscula) and compound inflorescences (e.g., Carex schiedeana, Kobresia laxa). Uncinia species were not sampled from this clade because prior analyses have placed them near Carex geyeri and Cymophyllus fraserianus whose general reproductive morphology is similar to Uncinia minus hooked rachillae. From a phylogenetic perspective, our sampling included Carex cruciata and Carex gibba as these taxa have been respectively positioned as sister to all other Core Carex and Vignea Clade species. Multiple individuals of Carex hypolytroides (sect. Hypolytroides) were sampled to better represent its distribution as initial analyses suggested C. moupinensis (sect. Hypolytroides) could be more closely related to Sumatran populations than to individuals found on the Indochinese mainland. Multiple individuals of Carex kucyniakii (sect. Hemiscaposae) were sampled after initial molecular analyses correlated with morphological variation noted in the field (i.e., strictly multispicate versus weakly compound individuals).
10
2.2. DNA isolation, amplification and sequencing All regions were PCR-amplified from total genomic DNA isolated from herbarium specimens or silica-dried leaves from field collections using a silica-column-based method (Alexander et al., 2007) with a modified binding buffer (Starr et al., 2009). Primer sequences and amplification procedures for the nuclear regions ITS and ETS 1f followed Starr et al. (2003), whereas primers and PCR protocols for the chloroplast coding regions matK and ndhF were the same as in Gilmour et al. (2013). For the chloroplast non-coding rps16 intron region, the primers rps16-F (5’AAACGATGTGGTAGAAAGCAAC3’) and rps16-R (5’AACATCAATTGCAACGATTCGATA3’) were used for PCR amplifications (modified from Shaw et al., 2005, to remove base ambiguities). Each PCR amplification for rps16 contained the following reactants dissolved in an end volume of 15 μl: 1X PCR buffer (Bioline), 0.2 mM of each dNTP, 0.25 μM of each primer, 1.5 mM MgCl2, 10–50 ng of template DNA, and 0.3 units of BIOTAQ DNA Polymerase (Bioline). PCR products were amplified on an Eppendorf© EPGradientS Mastercycler via a pretreatment of 94°C for 3 min, followed by 40 cycles of DNA denaturation at 94°C for 30s, primer annealing at 47°C for 60s, and DNA extension at 68°C for 90s. An extension phase at 68°C for 5 min was conducted at the end of cycling. A sample of each reaction was run on 2.0 % agarose gels stained with ethidium bromide. Successful products were purified using an Exonuclease I and Shrimp Alkaline Phosphatase protocol (MJS Biolynx Inc., Canada) and cycle sequenced with PCR primers using an ABI Prism™ Big Dye™ terminator kit version 3.1 (Applied Biosystems). Cyclesequencing products were purified following a sodium acetate/ethanol procedure (Applied
11
Biosystems) and run on a 3130xl Genetic Analyser. Sequence data were assembled and edited in Sequencher 4.10 (Gene Codes Corporation, Ann Arbor, MI, USA). 2.3. Phylogenetic analysis For the combined five marker Cariceae analysis (ITS, ETS 1f, rps16, matK, ndhF; hereafter the “combined analysis or matrix”), all sequences were novel to this study with the exception of ITS and ETS 1f for 28 taxa from the following analyses (Ford et al., 2006; Starr and Ford, 2009; Starr et al., 1999, 2004, 2008; Waterway and Starr, 2007) (Table 3). As the analysis of Yano et al. (2014) included some sect. Surculosae species and a wider sampling of sections Siderostictae and Hemiscaposae than the current study, a matrix of the one marker (ITS) shared by this study and Yano et al. (2014) was analysed to confirm that sect. Hypolytroides was not nested within the Siderostictae Clade. Genbank numbers for all the sequences used in analyses are given in Table 3. Sequences were initially aligned with Clustal X (Thompson et al., 1997) and then adjusted manually using parsimony as a criterion for choosing between alternative alignments (Starr et al., 2004). Complete sequences for the 5.8S gene (ITS region) were obtained for all taxa that were newly sequenced. However, as the middle portion of this highly conserved gene was missing for sequences used from Starr et al. (1999, 2004), only the first five and the last 17 base pairs of the 5.8S gene were used in analyses as they were common to all taxa (i.e., 144 bp were deleted). Owing to alignment ambiguity, characters 18-19, 237-238, 268-279, 331-351, 356-363, 1068-1070, 1170-1171, 4052-4061, and 4693-4700 from the combined matrix and characters 18-19, 240-241, 271-282, 334-354, and 359-366 from the ITS matrix were excluded from all
12
analyses. Aligned matrices for all analyses are available on TreeBASE (http://www.treebase.org/). Tree searches were performed using parsimony for the combined and ITS matrices, whereas a Bayesian analysis was conducted only for the combined data. For both methods, Eriophorum vaginatum and Scirpus polystachyus were used as outgroups as previous molecular analyses have placed them close to Cariceae (Léveillé-Bourret et al., 2014; Muasya et al., 1998; Simpson et al., 2007). Parsimony analyses were conducted in PAUP* 4.0b10 (Swofford, 2003) using heuristic searches and a random addition sequence of taxa for 50,000 (combined) or 10,000 (ITS) replicates with the MULTREES option on. Support for internal branches was assessed via the bootstrap (BS; Felsenstein, 1985) using a simple addition sequence for 50,000 (combined) or 10,000 (ITS) replicates with the MULTREES option on (combined) or off (ITS; DeBry and Olmstead, 2000). Clade support was subjectively described (strong, weak, etc.) according to the explicit intervals in BS values defined in Starr et al. (2004). Posterior probabilities (PP, see below) were not considered when describing clade support. Bayesian analyses were performed in MrBayes 3.2.2 (Ronquist and Huelsenback, 2003). The posterior tree distribution was estimated via a Metropolis-coupled Markov Chain Monte Carlo (MC3) analysis of two independent runs of 10,000,000 generations with a tree sampled every 500th generation from one of four simultaneously run Markov chains. All five data partitions were treated separately in a mixed model where a general-time-reversible (GTR) model incorporating a gamma distribution (G) and invariant sites (I) was enforced for ITS and ndhF during the running of the chain, and a GTR + G model for ETS, matK and rps16. The model
13
for each partition was chosen using the Akaike Information Criterion (AIC; Akaike, 1974) as implemented in MrModeltest 2.3 (Nylander, 2004). A plot of log-likelihoods versus generation number was used to determine when chains levelled off and began to fluctuate around a stable value. As the stationary phase was reached rather rapidly, only 10% of trees were discarded as unrepresentative of the posterior distribution. To assess whether enough generations had been run to reach convergence and to determine whether sufficient mixing of the chain had occurred to provide reliable parameter estimates, three further independent analyses using the same initial parameters as above were conducted. Convergence and mixing were assessed by a comparison of likelihood values, the standard deviation of split frequencies between runs, the potential scale reduction factor (“sump” command), and the topologies of 50% majority rule consensus trees that were generated via the “sumt contype = allcompat” command. TreeAnnotator v1.8.0 was used to determine the maximum clade credibility tree for all trees sampled from the stationary phase of all four Bayesian analyses conducted. This tree was used in PAUP to estimate the number of unambiguous character changes or apomorphies supporting the major Cariceae clades by using the DESCRIBETREES apolist = yes command.
14
3. Results 3.1. Phylogenetic analysis The combined matrix of ITS, ETS 1f, matK, ndhF, and rps16 sequences for 67 terminals produced 4733 aligned characters of which 68 were excluded, and 927 were parsimony informative. Parsimony searches found 7 trees, 3942 steps long (CI = 0.52; RI=0.70). As the strict consensus of parsimony analyses was fully compatible with Bayesian analyses with the exception of one branch (see below), the results of parsimony analyses were summarized on the Bayesian tree presented in Fig. 2. A full description of the relationships and major clades within this tree are given below. For Bayesian analyses of the combined matrix, plots of log-likelihood values versus generation number indicated that the stationary phase was quickly reached around 35,000 generations for all runs. Nonetheless, 10% of trees were excluded from each run to be certain that trees unrepresentative of the posterior distribution would be excluded from majority rule consensus trees. Comparisons of likelihood values, the standard deviation of split frequencies between runs (1 lateral order), multispicate (1 lateral order) or unispicate (no lateral orders) with the ultimate axis of a grouping of male or female flowers on terminal or lateral inflorescence units referred to as a “spike”. The first lateral order of a lateral inflorescence unit is typically subtended by a tubular cladoprophyll with subsequent orders subtended by perigynium-like inflorescence prophylls that are also present on the lateral orders of the terminal inflorescence unit (no cladoprophyll being possible). Cymophyllus has a similar spikelet and inflorescence morphology to unispicate Carex and is largely segregated on the basis of vegetative characters. See Starr and Ford (2009) for stylised figures of Cariceae spikelets and inflorescence morphology as well as a full discussion on the circumscription of major groups and their characters.
Carex subg. Carex Psyllophora Vignea Vigneastra Cymophyllus
Perigynia
Perigynial Complex
Rachilla
Inflorescence
Inflorescence units
Inflorescence prophyll
Cladoprophyll
Stigmas
Fused to apex Fused to apex Fused to apex Fused to apex Fused
Unisexual
+/Insert +/Insert +/Insert +/Insert +
Multispicate
-
+
3
-
-
2-3
-
-
2
Compound
Terminal male, lateral female Androgynous or dioecious Androgynous or gynaecandrous Androgynous
+
+
3
Unispicate
Androgynous
-
-
3
Unisexual Unisexual Unisexual Unisexual
Unispicate Multispicate
41
Uncinia
to apex Fused to apex
Unisexual
Kobresia
Unfused to apex
Bisexual
Schoenoxiphium
Unfused to apex
Bisexual
Insert + Exsert, hooked + Exsert, terete + Exert, flat
Unispicate
Androgynous
-
-
3
Unispicate to Compound
Androgynous
-
+/-
2-3
Compound
Androgynous
-
+
3
42
17 18 19 20 21
Table 2. The taxonomic composition, diversity and distribution of species from the five major Cariceae clades discovered in molecular analyses. Species number estimates are extrapolations based on the known taxonomic composition of clades and the number of species recognised for genera in Govaerts et al. (2014) and for Carex subgenera and sections in standard works such as Dai et al. (2010), Ball and Reznicek (2002), and Chater (1980). Major Cariceae Clades
Core Carex Clade
Vignea Clade
Core Unispicate Clade
Schoenoxiphium Clade
Siderostictae Clade
Traditional Genera and Carex Subgenera included in clade Carex subgenera Carex p.p., Psyllophora p.p., Vigneastra p.p. Carex subgenera Vignea and Psyllophora p.p. Cymophyllus, Uncinia, Kobresia, Carex subgenenera Psyllophora p.p., Vignea p.p., Vigneastra p.p. Schoenoxiphium, Carex subgenera Psyllophora p.p., Vigneastra p.p. Carex subgenera Carex p.p., Vigneastra p.p.
Approximate number of Species in clade
Distribution
1410
All continents, except Antarctica
300
All continents, except Antarctica
183
All continents, except Antarctica
45
Africa, Europe, South America, Oceania
28
East Asia
43
22 23 24 25 26 27 28
Table 3. Classification, voucher data and Genbank numbers for Cariceae taxa used in ITS and in combined ITS, ETS 1f, matK, ndhF, and rps16 analyses. Ingroup taxa are arranged in alphabetical order to section, with outgroup taxa placed last. Generic delimitation follows Kükenthal (1909) and Ball et al. (2002). Subgeneric circumscription adheres to Kükenthal (1909) and Zhang (2001), whilst sections follow Kükenthal (1909), Raymond (1959), Chater (1980), Wheeler (1989), Dai et al. (2010), Zhang (2001) and Ball and Reznicek (2002). Individuals sampled from the same species are numbered (1) to (7). Species names followed by an asterisk “*” denote taxa whose sequences were combined from two vouchers to form a single terminal for phylogenetic analyses. Sequences without voucher details come from Yano et al. (2014). Herbarium acronyms follow Thiers (2014). Genus
Carex L.
Subgenus
Carex
Section
Species
Voucher
Cryptostachyae Franch.
Carex cryptostachys Brongn.
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1202 et al., (WIN)
Decorae (Kük.) Ohwi
Carex dielsiana Kük.
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1248A et al., (WIN)
Carex perakensis var. perakensis C.B.Clarke
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1211A et al., (WIN)
Carex aff. perakensis var. vansteensii (Kük.) Noot.
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1235A et al., (WIN)
Genbank (ITS, ETS 1f, matK, ndhF, rps16) KP273638, KP273604, KP273677, KP273731, KP273788 KP273639, KP273605, KP273679, KP273733, KP273790 KP273631, KP273597, KP273668, KP273722, KP273777 KP273630, KP273596, KP273665, KP273719, KP273773
44
Graciles Kük.
Carex brunnea Thunb.
China. Guizhou: Yinjiang Xian, Bartholomew 1574 et al. (TRTE)
Carex teinogyna Boott
Japan. Honshu: Kyoto prefecture, Tsugaru 22920 & Murata (MO)
Gynobasidae Trabut
Carex illegitima Ces.
Greece. Rhodes: SW Rhodes City, Alanko 92256, (TRTE)
Hymenochlaenae (Drejer) L.H.Bailey
Carex cherokeensis Schwein.*
(1) USA. Florida: Holmes Co., Waterway 2000.044, (MTMG) (2) USA. Tennessee: Haywood Co., Reznicek 10044 & Naczi, (DOV) Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1206 et al., (WIN)
Lageniformes (Ohwi) Nelmes
Carex breviscapa C.B. Clarke
Laxiflorae Kunth
Carex blanda Dewey
Canada. Ontario: Peterborough, Bakowsky 96-176, (WIN)
Mitratae Kük.
Carex breviculmis var.
Vietnam. Lao Cai:
KP273636, KP273602, KP273674, KP273728, KP273784 KP273661, KP273627, KP273709, KP273763, KP273821 −, KP273613, KP273691, KP273745, KP273801 AY757619, AY757680, −, −, − −, −, KP273675, KP273729, KP273786 KP273635, KP273601, KP273673, KP273727, KP273783 AF027484, AY241983, KJ513583, KJ513491, KP273782 KP273652,
45
Phacocystis Dumort.
breviculmis R. Br.
Hoang Lien National Park, Ford 1238A et al., (WIN)
Carex aquatilis Wahlenb.*
(1) Canada. Québec: Lac St. Francois, Bérubé 99.009, (MTMG) (2) Canada. Newfoundland: Strait of Belle Isle Dist, Bouchard 92251 et al., (CAN) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1245A et al., (WIN)
Praelongae (Kük.) Nelmes
Carex pruinosa Boott
Radicales (Kük.) Nelmes
Carex speciosa Kunth
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1236A et al., (WIN)
Rhomboidales (Kük.)
Carex aff. anomocarya Nelmes
Vietnam. Hanoi City: Mount Bavi National Park, Ford 1218 et al., (WIN)
Siderostictae Franch. ex Owhi
Carex ciliatomarginata Nakai
(1) (2)
KP273618, KP273696, KP273750, KP273806 AY757590, AY757651, −, −, − −, −, KP273666, KP273720, KP273775
KP273655, KP273621, KP273701, KP273755, KP273812 KP273659, KP273625, KP273706, KP273760, KP273818 KP273629, KP273595, KP273664, KP273718, KP273772 AB725706, −, −, −, − AB725707, −, −, −, −
46
Carex glossostigma Hand.Mazz.
(1) China. Jiangxi: City of Jing-De-Zhen, Shushen 5682 & Hanrong, (MO) (2)
Carex grandiligulata Kük. Carex longshengensis Y.C. Tang & S.Y. Liang Carex okamotoi Ohwi Carex pachygyna Franch. & Sav. Carex siderosticta Hance
(1) Cultivated, LéveilléBourret 545 (CAN)
(2) (3) (4) (5) (6) (7)
KP273644, −, KP273686, KP273740, − AB725708, −, −, −, − AB725709, −, −, −, − AB725710, −, −, −, − AB725711, −, −, −, − AB725712, −, −, −, − KP273658, KP273624, KJ513592, KJ513499, KP273817 AB725713, −, −, −, − AB725714, −, −, −, − AB725715, −, −, −, − AB725716, −, −, −, − AB725717, −, −, −, − AB725718, −, −, −, −
47
Carex sp. Carex subcapitata X.F. Jin, C. Z. Zheng & B.Y. Ding
(1) (2)
Carex tumidula Ohwi Squarrosae J.Carey
Psyllophora (Degl.) Peterm.
Aciculares (Kük.) G.A. Wheeler
Carex squarrosa L.*
Carex acicularis Boott*
Firmiculmes (Kük.) Mack.
Carex geyeri Boott
Junciformes (Boeckl.) Kük.
Carex aphylla Kunth*
(1) USA. Illinois: Pope Co., Waterway 98.020, (MTMG) (2) USA. Georgia: Meriwether Co., Naczi 9159, (DOV) (1) New Zealand. Fiordland: Southland Land District, Ford 113/98, (FHO) (2) New Zealand. Ford 29/94, (CHR)
AB725722, −, −, −, − AB725719, −, −, −, − AB725720, −, −, −, − AB725721, −, −, −, − AY757587, AY757648, −, −, − −, −, KP273707, KP273761, KP273819 AY242012, AY242013, −, −, −
−, −, KP273662, KP273716, KP273770 USA. Montana: Cascade AF027434, Co., Starr MT96039, AF027474, (WIN) KP273684, KP273738, KP273795 (1) Argentina. Prov. Rio AY242014, Negro, Laegaard AY242015, −, −, − 13496, (AAU) (2) Argentina. Prov. −, −,KJ513582, Neuquén: Parque KJ513490,
48
Leucoglochin Dumortier
Carex camptoglochin V.I.Krecz.
Carex microglochin Wahlenb.*
Physoglochin Dumort.
Carex gynocrates Wormsk.*
Psyllophora (Degl.) Koch
Carex pulicaris L.
Scirpinae (Tuck.) Kük.
Carex scirpoidea Michx.*
Nacional Lanín, J. Starr 10025 & T. Villaverde (CAN) Ecuador. Chimborazo, Molau 2329 et al., (GB)
(1) UK. Scotland: Meall Greigh, Starr 98017 & Scott, (FHO) (2) Argentina. Tierra del Fuego: between Ushuaia and Tolhuin, J. Starr 10008 et al., (CAN) (1) Canada. Québec: Schefferville region, Dabros s. n., (MTMG) (2) Canada. Manitoba: Wapusk National Park, Ford 02283 et al. (WIN) UK. England: North Yorkshire/Cumbria, Starr 98001 & Scott, (FHO) (1) Canada. Alberta: Jasper National Park, Bayer AB-96010 et al.,
KP273774)
AY244519, AY244520, KJ513584, KJ513492, KP273785 AY244517, AY244518, −, −, − −, −, KP273698, KP273752, KP273808
AY757417, AY757383, −, −, − −, −, KJ513587, KJ513495, KP273797 AY242018, AY242019, KJ513590, KJ513576, KP273813 AF027486, AY241991, −, −, −
49
Vignea (P. Bauv. ex Lestib. f.) Peterm.
Ammoglochin Dumort.
Carex arenaria L.
Carex siccata Dewey*
Baldenses Tuck.
Carex baldensis L.
Deweyanae (Tuck. ex Mack.) Mack.
Carex deweyana Schwein.
Gibbae Kük.
Carex gibba Wahlenb.*
(WIN) (2) USA. Alaska: Eklutna Lake, Reznicek 11727, (DOV) UK. Scotland: Lunan Bay Sand Dunes, Starr 98020 & Scott, (FHO)
−, −, KP273704, KP273758, KP273815 AY242003, AY242004, KP273667, KP273721, KP273776 DQ115274, DQ115275, −, −, −
(1) Canada. Manitoba: ca. 1.5 km N of town of Falcon Lake, Naczi 9862 & Ford, (DOV) (2) USA. Colorado: Park −, −, KP273705, Co., Lea 3453, (DOV) KP273759, KP273816 Switzerland. EF363120, Montreaux: (cultivated EF363121, by A. A. Reznicek), KP273671, Reznicek 8250, (MICH) KP273725, KP273780 Canada. Alberta: AF027476, Edmonton, Starr 96007, AY242007, (WIN) KP273678, KP273732, KP273789 (1) China. Hunan: Li DQ115174, Ling, Da Lin County, Liu DQ115175, −, −, − 6741, (MO) (2) China. Shaanxi: −, −, KP273685, Yang Xian, Zhu 2776 et KP273739,
50
Vigneastra (Tuck.) Kük.
al., (MO) Macrocephalae Kük. Carex macrocephala Willd. (1) Canada. British ex Spreng.* Columbia: Tsawwassen, Boundary Bay Regional Park, Ford 9715, (WIN) (2) USA. Alaska: Yakutat forelands, Stensvold 8154, (DOV) Multiflorae (J.Carey) Kük. Carex vulpinoidea Michx.* (1) USA. Kentucky: Monroe Co., Ford 9872 & Naczi, (WIN) (2) USA. Maine: Washington Co., Reznicek 11687, (DOV) Euprepes Nelmes & Airy Carex euprepes Nelmes Vietnam. Lao Cai: Liem Shaw Phu Commune, Ford 1262A et al., (WIN)
Hemiscaposae C. B. Clarke
Carex adrienii E.G.Camus
Carex densifimbriata F.T. Wang & Tang ex S.Y. Liang Carex kucyniakii Raymond
Vietnam. Vinh Phuc: Tam Dao National Park, Ford 1203 et al., (WIN)
Vietnam. Lao Cai: Hoang Lien National Park, Ford 1258C et al., (WIN)
KP273796 DQ115210, DQ115211, −, −, −
−, −, KP273697, KP273751, KP273807 DQ115308, DQ115309, −, −, − −, −, KP273710, KP273764, KP273822 KP273641, KP273607, KP273681, KP273735, KP273792 KP273628, KP273594, KP273663, KP273717, KP273771 AB725723, −, −, −, − KP273651, KP273617, KP273695, KP273749, KP273805
51
Carex aff. kucyniakii Raymond
(1) Vietnam. Lao Cai: Liem Phu Commune, Ford 1261A et al., (WIN) (2) Vietnam. Lao Cai: Nam Xe Commune, Ford 1263A et al., (WIN) (3) Vietnam. Lao Cai: Van Ban Nature Reserve, Ford 1265A et al., (WIN)
Carex lingii F.T. Wang & Tang Carex scaposa C.B. Clarke
(1) China. Guizhou: Songtao Xian, Bartholomew 2160 et al., (TRTE) (2) (3)
Hypolytroides Nelmes
Carex hypolytroides Ridl.
(1) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1222C et al., (WIN) (2) Vietnam. Lao Cai: Hoang Lien National
KP273649, KP273615, KP273693, KP273747, KP273803 KP273650, KP273616, KP273694, KP273748, KP273804 KP273648, KP273614, KP273692, KP273746, KP273802 AB725724, −, −, −, − KP273656, KP273622, KP273702, KP273756, − AB725725, −, −, −, − AB725726, −, −, −, − KP273645, −, KP273687, KP273741, KP273798 KP273646, KP273610,
52
Park, Ford 1255A et al., (WIN) (3) Vietnam. Kon Tum: NW Slopes of Mt. Ngoc Linh, Averyanov VH107 et al., (MO)
Carex moupinensis Franch.
Indicae Tuck.
Carex balansae Franch.
Carex cruciata Wahlenb.
Carex filicina Nees
KP273688, KP273742, − KP273647, KP273612, KP273690, KP273744, KP273800 (4) Indonesia. Sumatra: −, KP273611, Mt. Kinabalu, Sinclair KP273689, 9220, (L) KP273743, KP273799 China. Sichuan: Dongla KP273653, Canyon, Kyong-Sook KP273619, Chung and Rong Li 40KP273699, 7, (MOR) KP273753, KP273809 Vietnam. Hanoi City: KP273633, Mount Bavi National KP273599, Park, Ford 1273A et al., KP273670, (WIN) KP273724, KP273779 (1) Vietnam. Hanoi City, KP273637, Ford 1214A et al., KP273603, (WIN) KP273676, KP273730, KP273787 (2) AB725727, −, −, −, − (1) Vietnam. Lao Cai: KP273642, Hoang Lien National KP273608, Park, Ford 1247A et al., KP273682,
53
(WIN) (2) Vietnam. Lao Cai: Hoang Lien National Park, Ford 1229 et al., (WIN) Carex stramentitia Boott ex Boeckeler
Japonicae Kük. Mapaniifoliae Nelmes & Airy-Shaw
Carex satsumensis Franch. & Sav. Carex bavicola Raymond
Vietnam. Ninh Binh: Cuc Phuong National Park, Ford 1271 & Regalado, (WIN)
Vietnam. Hanoi City: Mount Bavi National Park, Ford 1215B et al., (WIN)
Mundae Kük.
Carex dissitiflora Franch.
Japan. Honshu: Kyoto prefecture, Tsugaru 26239 et al., (MO)
Polystachyae Tuck.
Carex baccans Nees
Dahai 102, (MO)
Carex myosurus Nees
(1) Vietnam. Lao Cai: Hoang Lien National
KP273736, KP273793 KP273643, KP273609, KP273683, KP273737, KP273794 KP273660, KP273626, KP273708, KP273762, KP273820 AB725728, −, −, −, − KP273634, KP273600, KP273672, KP273726, KP273781 KP273640, KP273606, KP273680, KP273734, KP273791 KP273632, KP273598, KP273669, KP273723, KP273778 KP273654, KP273620,
54
Park, Ford 1246A et al., (WIN)
Carex polystachya Sw. ex Wahlenb.
Schiedeanae Kük.
Carex schiedeana Kunze
Surculosae Raymond
Carex tsiangii F.T. Wang & Tang Carex kwangsiensis F.T. Wang & Tang ex P.C. Li Cymophyllus fraserianus (Ker-Gawler) Kartesz & Gandhi
Cymophyllus Mack.
Kobresia Willd.
Kobresia
Compositae (C.B. Clarke) Kukkonen
Kobresia laxa Nees
Hemicarex (Benth.) C.B.
Kobresia esenbeckii
KP273700, KP273754, KP273810 (2) AB725729, −, −, −, − Belize. Cayo, Jones AF027487, 11275 & Wipff, (MICH) AY241998, KJ513589, KJ513497, KP273811 Mexico. San Luis Potosi, KP273657, Jones 5588 & KP273623, Manrique, (MO) KP273703, KP273757, KP273814 AB725731, −, −, −, − AB725730, −, −, −, − USA. Tennessee: Blount AY241969, Co., Sharp s.n. AY241970, (cultivated at K), Starr KP273711, 98024 ex RBG Kew, KP273765, (FHO) KP273823 India. Sikkim: North AY241975, district, Long 211 & AY241976, Noltie, (E) KP273713, KP273767, KP273825 India. Sikkim: East AY242032,
55
Clarke
(Kunth) Noltie
district, Long 335 et al., (E)
Kobresia nepalensis (Nees) India. Sikkim: North Kük. district, Long 291 & Noltie, (E)
Kobresia Willd.
Kobresia myosuroides (Vill.) Fiori*
Kobresia simpliciuscula (Wahlenb.) Mack.*
Schoenoxiphium Nees
Schoenoxiphium lanceum (Thunb.) Kük.*
(1) France. Col du Galibier, Playford 9804 et al., (FHO) (2) Canada. British Columbia: W of Teepee Heart Ranch, Jones 146, (UBC) (1) Canada. British Colombia: Emerald Lake, Ford 9710, (FHO) (2) Canada. Yukon, Porsild 1825, (CAN)
(1) South Africa. Western Cape: Stellenbosch, McDonald 829, (PRE) (2) South Africa. Western Cape: Stellenbosch, Dahlstrand 1302, (PRE) Schoenoxiphium lehmannii South Africa. Natal:
AY242033, KP273712, KP273766, KP273824 AY242034, AY242035, KP273714, KP273768, KP273827 AY242036, AY242037, −, −, − −, −, KJ513622, KJ513529, KP273826 AY241971, AY241972, −, −, − −, −, JX065088, JX074644, KP273828 AY242028, AY242029, −, −, −
−, −, KJ513625, KJ513532, KP273829 AY242026,
56
Outgroups
(Nees) Kunth ex Steud.
Ngoye Forest Reserve, Williams 1007, (PRE)
Schoenoxiphium sparteum (Wahlenb.) C.B.Clarke*
South Africa: Orange Free State, Ladybrand, De Lange FA 57, (PRE) (2) South Africa. Smook 6625, (PRE) UK. England, Starr 98007 & Scott, (FHO)
Eriophorum vaginatum L.
Scirpus polystachyus F. Muell.
Australia. New South Wales, Wilson MCW 5927, (K)
AY242027, KP273715, KP273769, − AY242022, AY242023, −, −, − −, −, KJ513626, KJ513533, − AY242008, AY242009, KJ513615, KJ513522, KP273830 AY242010, AY242011, KJ513651, KJ513558, −
57
29 30
58 31 32 33 34 35 36 37 38 39
• • • • •
Carex/Cariceae is comprised of seven major lineages Three newly discovered early diverging lineages are comprised of East Asian/Southeast Asian taxa New lineages, though small are composed of extremely diverse and unusual morphologies Carex subg. Vigneastra is highly polyphyletic with taxa placed in five of seven major lineages recognised Strongest support yet seen for all previously recognised major Carex/Cariceae clades
59
40
60
41
61
42 43
62
44
63
45
