Developmental and Comparative Immunology 44 (2014) 76–85

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Thioredoxin peroxidase gene is involved in resistance to biocontrol fungus Nomuraea rileyi in Spodoptera litura: Gene cloning, expression, localization and function Huan Chen a,b, Youping Yin a, Eryan Feng a, Yan Li a, Xiang Xie a, Zhongkang Wang a,⇑ a b

Genetic Engineering Research Centre, College of Life Science, Chongqing University, Chongqing 400030, China Institute of Plant Physiology and Ecology, Chinese Academy of Sciences Key Laboratory of Insect Developmental and Evolutionary Biology, CAS, Shanghai 200032, China

a r t i c l e

i n f o

Article history: Received 5 September 2013 Revised 25 November 2013 Accepted 25 November 2013 Available online 1 December 2013 Keywords: Thioredoxin peroxidase Nomuraea rileyi Spodoptera litura Reactive oxygen species

a b s t r a c t Thioredoxin peroxidases (Tpxs) are a ubiquitous family of antioxidant enzymes that play important roles in protecting organisms against oxidative stress. Here, one Tpx was cloned from Spodoptera litura named as SlTpx. The full-length cDNA consists of 1165 bp with 588 bp open reading frame, encoding 195 amino acids. The putative amino acid sequence shared >70% identity with Tpxs from other insects. Phylogenetic analysis revealed that SlTpx is closely related to other available lepidopteran Tpxs. Real-time PCR analysis showed that SlTpx can be induced by Nomuraea rileyi infection in some detected tissues at the mRNA level. The strongest expression was found in hemocytes of unchallenged and N. rileyi-challenged S. litura. Western blotting showed SlTpx protein in the hemocytes, head and cuticle from normal S. litura. However, when N. rileyi was inoculated into the body cavity of S. litura larvae, SlTpx protein was detected in head, hemocytes, fatbody, midgut, malpighian tubule, but not in the hemolymph and cuticle. Moreover, time-course analysis showed that SlTpx mRNA/protein expression levels were up-regulated in the hemocytes, when S. litura were infected by N. rileyi or injected with H2O2. The levels of N. rileyiinduced reactive oxygen species (ROS) in hemocytes were evaluated, and revealed that N. rileyi infection caused generation of ROS, and induced changes in expression of SlTpx. In addition, the heterologously expressed protein of this gene in Escherichia coli showed antioxidant activity; it removed H2O2 and protected DNA. Knocking down SlTpx transcripts by dsRNA interference resulted in accelerated insect death with N. rileyi infection. This is believed to be the first report showing that SlTpx has a significant role in resisting oxidative stress caused by N. rileyi infection. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction Organisms living in aerobic environments are constantly challenged by oxidative stress and require defense mechanisms that prevent oxidative damage caused by reactive oxygen species (ROS). In general, major ROS in cells include superoxide anion (O2–), H2O2 and hydroxyl radical (OH), and they are important in many biochemical processes including immunity, cell proliferation, and signal transduction (Aguirre et al., 2005). However, accumulation of damage caused by ROS contributes to the development of certain diseases and aging (Gertz et al., 2009). To protect against the toxicity from ROS, organisms have developed antioxidant enzymatic systems to scavenge ROS, including thioredoxin peroxidases (Tpxs), glutathione peroxidases (Gpxs), and glutathione S-transferases (GSTs) (Corona et al., 2006). Among these, with thioredoxin or glutaredoxin–glutathione as immediate electron donor, Tpxs are a

⇑ Corresponding author. Tel./fax: +86 023 65120489. E-mail address: [email protected] (Z. Wang). 0145-305X/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2013.11.012

new family of antioxidant enzymes that eliminate H2O2, organic hydroperoxides, and peroxynitrite (Immenschuh et al., 2005). Since cytosolic Tpx of Saccharomyces cerevisiae was the first of these enzymes to be isolated from eukaryotic cells (Kim et al., 1988), the Tpx family has been identified in all living organisms from bacteria to mammals, including parasitic nematodes, plasmodia, and mice (Aran et al., 2009; Hu et al., 2010). All Tpxs are cysteine-based peroxidases that are classified into 1-Cys and 2-Cys based on the number of conserved cysteine residues, with the 2Cys being further subdivided into typical 2-Cys and atypical 2Cys on the basis of structural and mechanistic information. In insects, Tpx genes have been isolated from Spodoptera frugiperda, Apis cerana cerana, Bombyx mori, Bombus ignites, and Drosophila melanogaster (Hambarde et al., 2010, 2013; Yu et al., 2011; Shi et al., 2012; Hu 2012; Radyuk et al., 2001). Five Tpx genes have been identified in D. melanogaster comprising three 2-Cys and two 1-Cys Tpxs. All types of Tpxs from D. melanogaster have been shown to have classical peroxidase activity as oxidant defense enzymes (Radyuk et al., 2001). Moreover, Radyuk et al. (2003) have indicated that transfected cell lines overexpressing Tpx have higher

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

resistance to oxidative stress, while silencing of Tpx results in an increase in susceptibility. Studies of insect antioxidant proteins have indicated that Tpx genes are highly up-regulated after exposure to stressors, such as H2O2, paraquat, external temperature and microbial infection (Lee et al., 2005; Yu et al., 2011; Shi et al., 2012). All these studies support that Tpxs play an important role in the enzymatic removal of ROS in insects. S. litura is an important polyphagous insect pest and responsible for widespread economic damage of vegetables and ornamental plants in tropical and subtropical regions. This pest is hard to be controlled due to its development of insecticide resistance and subsequent control failure (Kranthi et al., 2001, 2002; Ahmad et al., 2007). The fungus Nomuraea rileyi is the most important suppressive factor of S. litura in the field, and shows promise for control of this pest. For better control of S. litura using N. rileyi, an understanding of the molecular response between S. litura and N. rileyi is essential. When screening immune-response-related genes in S. litura against N. rileyi by subtractive hybridization, a Tpx gene was isolated (Chen et al., 2012). In the present study, we characterized the function and role of SlTpx in resistance of S. litura to N. rileyi. We also demonstrated that N. rileyi infection caused generation of ROS. Our results suggest that SlTpx plays important roles in S. litura for protection against oxidative stress caused by N. rileyi infection.

77

DNA Purification Kit (Omega, Norcross, GA, USA) according to the manufacturer’s instructions. 2.4. Cloning of full-length cDNA of SlTpx and application of its genomic sequence Based on the partial sequence data of Tpx (Chen et al., 2012); its 30 and 50 ends were obtained by SMART-RACE approaches. The 30 end RACE PCR was performed with a cDNA template from S. litura RNA using the gene-specific primer FTpxf1 and CDSIII. For 50 end RACE PCR, the gene-specific primer FTpxr1 and 50 PCR primer were used. Both the 50 -RACE and 30 -RACE products were cloned into pMD-19 Teasy vector (TaKaRa Bio Inc., Shiga, Japan) and sequenced. Full-length SlTpx was also obtained by overlapping the two fragments. To confirm the assembled cDNA sequence from overlapping PCR products, the entire coding regions of SlTpx were amplified by PCR with the forward and reverse primers FTpxf and FTpxr. To acquire the genomic DNA sequence of SlTpx, two pairs of primers (JTpxf1/JTpxr1 and JTpxf2/JTpxr2) were designed and synthesized according to the full-length cDNA of SlTpx. Cloning and sequencing of these PCR products were carried out in the same manner as described above. The sequences of the PCR primer pairs, expected size of PCR product, and the program parameters of each PCR are listed in Table 1.

2. Materials and methods

2.5. Bioinformatics analysis of SlTpx

2.1. S litura and N. rileyi

Conserved domains in SlTpx were detected with the help of bioinformatics tools available at the NCBI server (http://www. ncbi.nlm.nih.gov/Blast.cgi). We identified the ORF and conducted multiple alignments among homologs using DNAMAN software 5.2.2. In order to reconstruct the phylogenetic tree for Tpx genes, the protein sequences of the candidate genes were used as the query sequence to search for the homologous sequences of other species in the NCBI database (http://www.ncbi.nlm.nih.gov/). The phylogenetic tree was reconstructed by the neighbor-joining method (Saitou and Nei, 1987) implemented in MEGA 5.0.

S. litura larvae were reared on an artificial diet at 27 ± 1 °C in 75 ± 5% humidity and a photoperiod of 16 h light: 8 h dark until they reached the last (sixth) instar. N. rileyi strain CQNr129 was provided by the Genetic Engineering Center of Chongqing University. The fungus was cultured on 1/4 strength Sabouraud dextrose agar medium at 28 °C for 10 days. Conidial suspensions were prepared in PBS at 1  107 spores/mL. 2.2. Treatments and tissue collection The last instar larvae were divided into three groups. Group 1 was challenged with 5 lL conidial suspension (Zheng and Xia, 2012; Wang et al., 2012). Group 2 was challenged with 5 lL PBS as a control. For oxidative stress, Group 3 was treated with 5 lL H2O2 at a final concentration of 100 mM by diluting a 30% stock in distilled water. All the larvae at the indicated time points were placed on ice and carefully dissected to isolate different tissues such as midgut, fat body, hemocytes, head and cuticle, and then washed in diethylpyrocarbonate (DEPC)-treated phosphate buffered saline (PBS) solution for RNA/protein extraction, or immediately put into liquid nitrogen and stored at 80 °C until use. To study encroach process of spores in haemocoele after N. rileyi inoculation, 50 ll hemolymph was collected from larvae at 1, 2 and 3 day post-inoculation (DPI) or in normal control group, respectively. Slides were prepared to observe under optical digital microscope (Motic, China). 2.3. RNA extraction, cDNA synthesis, and DNA preparation TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from the pooled tissues of each group, according to the manufacturer’s protocol. DNAse-I-treated total RNA was converted to cDNA using the First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania) following the manufacturer’s instructions. Genomic DNA was isolated from larvae using a Genomic

2.6. Recombinant expression, purification of recombinant thioredoxin peroxidase (rSlTpx) in E. coli, and antibody preparation An entire coding sequence of SlTpx was amplified with Pfu DNA polymerase (TaKaRa) using the primers BTpxf and BTpxr (Table. 1) containing the BamHI and HindIII restriction sites, respectively. The amplified fragments were cloned into the expression vector pET-30a (+) and then introduced into E. coli BL21 (DE3) by transformation. A single positive colony was selected to be cultured in Luria–Bertani (LB) medium with 50 lg/mL kanamycin at 37 °C overnight. Subsequently, 1 mL of the E. coli culture was added to 100 mL LB medium. When OD600 reached 0.6, the culture was induced with 0.1 mM IPTG and cultured for a further 12 h at 17 °C. The cells were collected by centrifugation and then resuspended in 1 binding buffer (50 mM sodium polyphosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). The suspension was sonicated for 30 min on ice, and centrifuged again at 10,000g for 20 min at 4 °C. The suspension was subjected to 10% SDS–PAGE to measure the expression of the target recombinant protein. The suspension was also purified under natural conditions by Ni2+-NTA binding resin (Qiagen, Shanghai, China) according to the manufacturer’s instructions, and 10% SDS–PAGE was utilized to analyze the purified fusion protein. The concentration of the fusion protein was quantified with a bicinchoninic acid (BCA) protein assay. To generate rSlTpx polyclonal antibodies, 400 lg of purified rSlTpx in 1 mL of PBS was mixed with 1 mL of Freund’s complete

78

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

Table 1 Primers used in the current study. Primer pairs 0

Primer sequence

PCR product size (bp)

Tm (°C)

Description

1145

61

170

58

717

60

578

59

630

60

579

62

Expression of protein forward primer Expression of protein reverse primer

92

60

178

60

99

60

Quantitative RT-PCR forward primer Quantitative RT-PCR reverse primer Standard control forward primer Standard control reverse primer Standard control forward primer Standard control reverse primer

328

61

403

59

/ /

65 65

0

5 - and 3 -Race PCR FTpxf1 CGTGTTGTTCGTCGTTCTTT CDSIII ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30 N–1 N GCCCTTGTAGTCGGAGAGAG FTpxr1 50 PCR AAGCAGTGGTATCAACGCAGAGT Cloning SlTpx fragments FTpxf ATGCCTCTCCAGCTGACCAAACCCG FTpxr GGCTGAATTTCGATATGTTGGA JTpxf1 ATGCCTCTCCAGCTGACCAAACCCG JTpxr1 GTCGATGAAGTATTCCTGGGCAG GCAACCGGACGCTGGACGTGCG JTpxf2 JTpxr2 GGGGAGCGGGTTTGGTCAGCTGG Heterologous expression of SlTpx proteins BTpxf CGCGGATCCATGCCTCTCCAGCTGACCAAACC BTpxr GGCAAGCTTGTCGATGAAGTATTCCTGGGCAG SYBER-Green qRT-PCR DTpxf GACTACGGAGTGCTGAACGA DTpxr TTGACGGTGATCTGCCTAAG Dactinf TGAGACCTTCAACTCCCCCG Dactinr GCGACCAGCCAAGTCCAGAC DGapdhf GTATGGCTTTCCGTGTTCCT DGapdhr TGACCTTCTGCTTGATAGCG DsRNA synthesis TTpxf TAATACGACTCACTATAGGGAGAGGGTGAAGGTGATGC TTpxr TAATACGACTCACTATAGGGCTTGAAGTTGGCTTTGA TGfpf TAATACGACTCACTATAGGGAGGGTGAAGGTGATGC TGfpr TAATACGACTCACTATAGGGCTTGAAGTTGGCTTTGAT First stand cDNA synthesis OligodG AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG CDSIII ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30 N–1 N

30 RACE forward primer 30 RACE universal adaptor primer 50 RACE reverse primer Abridged universal amplification primer Full-length cDNA forward primer Full-length cDNA reverse primer Genomic sequence forward primer Genomic sequence reverse primer Genomic sequence forward primer Genomic sequence reverse primer

SlTpx dsRNA synthesis forward primer SlTpx dsRNA synthesis reverse primer GFP dsRNA synthesis forward primer GFP dsRNA synthesis reverse primer First stand cDNA synthesis anchor primer First stand cDNA synthesis adaptor primer

Underline showed the Hind III (AAGCTT) and BamH I (GGATCC) restriction enzyme sites in the forward and reverse primer, respectively.

adjuvant and hypodermically injected into the backs of rabbits at two-week intervals. After the fourth immunization, the antibody titers were assessed with an enzyme-linked immunosorbent assay. The rabbit immunoglobulin G fraction was precipitated from the antiserum with 50% saturated ammonium sulfate and purified with DEAE–Sepharose column chromatography. The concentration of the resulting purified antibody in PBS was determined using an ultraviolet spectrophotometer, with sterile-filtered 0.02% sodium azide as the antiseptic. 2.7. rSlTpx activity assay in vitro The SlTpx activity was assayed in 1-mL reaction volumes as described previously by Yu et al. (2011), with slight modifications. A 1-mL reaction mixture contained 100 mM HEPES buffer (pH 7.0), 10 mM DTT, and increasing concentrations (0, 25, 50, 75, 100 lg/ mL) of rSlTpx or BSA, which were all incubated at 37 °C for 10 min. H2O2 was added at a final concentration of 200 lmol and then the mixtures were incubated at 37 °C for 0, 2.5, 5, 7.5, and 10 min, respectively. The reactions were quenched by adding 100 lL 100% (w/v) trichloroacetic acid to stop the reaction. This was followed by the addition of 200 lL 100 mM Fe(NH4)2(SO4)2 and 100 lL 2.5 M KSCN to change the reaction mixture color to red. The rSlTpx activity was determined by measurement of the absorbance intensity of the red ferrithiocyanate complex at 470 nm. The same amounts of BSA were used as negative controls. Determination of DNA-protecting function of rSlTpx was carried out with a modification of the method of Lim et al. (1993). A reaction mixture of 50 lL, containing 100 mM HEPES buffer, 3 lM FeCl3, 10 mM DTT, and increasing concentrations of rSlTpx ranging from 6 to 100 lg/ml, was incubated at 37 °C for 2 h, followed by addition of 1000 ng pET-30a (+) supercoiled plasmid DNA for 2.5 h at 37 °C. BSA was also assayed separately under similar reaction conditions as control experiments.

2.8. Semi-quantitative RT-PCR and fluorescence real-time quantitative (q)PCR Total RNA was extracted from samples after different treatments and treated with RNase-free DNase (Fermentas). DNAse-I-treated total RNA (2 lg) from each sample was used to synthesize first-strand cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Fermentas), following the manufacturer’s instructions. The resulting cDNAs were used as templates for RT-PCR and qPCR with the SlTpx-specific primers DTpxf and DTpxr. The PCRs were performed at 94 °C for 30 s, followed by 25 cycles of amplification (94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s) using 1 lL first-strand cDNA in each 25-lL reaction mixture. Equal amounts of amplified products were analyzed on 2% agarose gel. qRT-PCR was performed using 1 lL first-strand cDNA in each 25-lL reaction mixture. The cycling conditions using SYBR green detection were 95 °C for 15 s followed by 40 repetitive cycles at 95 °C for 5 s, 58 °C for 15 s and 72 °C for 30 s. After cycling completion, melting curve analysis was performed at 58 °C. Two reference genes, b-actin gene and GAPDH gene (Guo et al., 2009; He et al., 2012; Meng et al., 2013) were used for normalizing the target gene expression and correcting for sample-to-sample variation. Amplification and expression quantification was performed using the CFX96 Real-time PCR detection system (Bio-Rad, USA). Relative expression was calculated using the comparative cycle threshold method (Pfaffl, 2001) with normalization of data to the geometric average of the reference genes (Vandesompele et al., 2002). A 6-fold dilution series of pooled cDNA was used to assess the efficiency of the qPCR reaction for each gene-specific primer pair. A no template control (NTC) was also included to detect possible contamination. Experiments were performed using 3 biological and 3 technical replicates for each gene. The primers used for RT-PCR and qRT-PCR are shown in Table. 1.

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

79

Fig. 1. Characterization of SlTpx gene. (A) ORF sequence and predicted amino acid sequence of the SlTpx gene. (B) Comparison of the deduced amino acid sequences of SlTpx from S. litura, HaTpx (ABW96360.1) from H. armigera, BmTpx (NP_001037083.1) from B. mori, DmTpx (NP_477510.1) from D. melanogaster, AccTpx (ADT65134.1) from A. cerana cerana and AgTpx (XP_308081.2) from An. gambiae. Identical amino acid residues are shared in blue. The amino acids conserved in catalytic regions are marked by 4. Conserved regions are boxed, and two sequences motifs (Regions I and II) essential for decamer formation in 2-Cys Tpx are underlined. (C) A phylogenetic tree generated by MEGA version 5.0 with Tpxs from various species, including S. litura, H. armigera (ABW96360.), B. mori (NP_001037083.1), D. melanogaster (NP_477510.1), A. cerana cerana (ADT65134.1), Apis mellifera (XP_003249289.1), Bombus impatiens (XP_003484863.1), Artemia franciscana (ABY62745.1), Bursaphelenchus xylophilus (ABW81468.1), Rattus norvegicus (XP_002726107.1), Fenneropenaeus chinensis (ABB05538.1), Acyrthosiphon pisum (XP_001946137.1), Oryctolagus cuniculus (XP_002709844.1), Litopenaeus vannamei (ACX53642.1), Bos taurus (NP_776856.1), Mus musculus (NP_035164.1), Meleagris gallopavo (XP_003208850.1), Fenneropenaeus indicus (ACS91344.1), Nomascus leucogenys (XP_003278704.1), Culex quinquefasciatus (XP_001844844.1), Tribolium castaneum (XP_970797.1), Homo sapiens (NP_002565.1), Thunnus maccoyii (ABW88997.1) and An. gambiae (XP_308081.2). (D). Lengths of exons and introns of genomic DNA from An. gambiae, B. mori, D. melanogaster, A. cerana cerana and S. litura were indicated. Light grey and black are used to highlighted exons and introns separately. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

2.9. SDS–PAGE and Western blotting analysis Insect tissues were homogenized in insect physiological saline, and centrifuged at 4 °C at 12,000g for 15 min. Supernatants containing soluble proteins were stored at 80 °C. Protein samples were denatured at 100 °C for 5 min, followed by centrifugation at 10,000g for 15 min. The protein concentration was determined by BCA protein assay. SDS–PAGE was performed in 10–12% acrylamide gels in Tris–glycine–SDS buffer. The gel was stained with Coomassie Blue R-250. For Western blotting analysis, proteins were transformed from the acrylamide gels to polyvinylidene difluroride membranes (Millipore, Blilerica, USA), and blots were incubated with rabbit anti-SlTpx antibody and anti-b-actin antibody (Beyotime Biotech, Jiangshu, China), followed by incubation with secondary goat horseradish peroxidase (HRP)-conjugated antibody. Bands were detected by ECL Plus Western Blotting Detection Reagents (Pierce, Rockford, IL, USA).

2.10. Measurement of ROS accumulation and lipid peroxidation To study ROS production in hemocytes after H2O2, N. rileyi and PBS treatments, hemolymph was collected from S. litura at 6 h post-inoculation (PI). The hemolymph was centrifuged immediately at 3500g at 4 °C for 5 min to isolate the hemocytes. ROS were measured as previously described with some modification (Yang et al., 2007). Hemocytes were incubated with 6-carboxy-20 70 dichorodihydrofluorenscein diacetate at a final concentration of 10 mM for 20 min. ROS production in hemocytes was measured

fluorometrically with excitation and emission settings at 488 and 525 nm, respectively. Hemocyte morphology was observed by fluorescence microscope (488 nm filter; Olympus IX-71, Tokyo, Japan). Malonyl dialdehyde (MDA), a terminal product of lipid peroxidation, was measured to estimate the content of lipid peroxidation in hemolymph. MDA concentration in hemolymph was determined by the thiobarbituric acid method (Jain, 1985).

2.11. RNA interference and survival assay dsRNA was prepared as previously described (Wang et al., 2012). One pair of primers (TTpxf and TTpxr) was designed to synthesize the 328-bp region of the SlTpx gene that included a T7 promoter region in both the sense and antisense strands. The quantity of SlTpx dsRNA was determined at 260 nm and by agarose gel analysis. dsRNA of green fluorescence protein (GFP) was made using the same method and used as a negative control. The final dsRNA was dissolved in diethylpyrocarbonate (DEPC)-treated water, stored at 80 °C and used within 1 week. The primers used for dsRNA synthesized are illustrated in Table. 1. Larvae that had just molted into the sixth instar stage were used for dsRNA injection. The larvae were anesthetized on ice for 5 min prior to injection. Five micrograms of dsRNA was injected into the larvae 6 h prior to inoculation of N. rileyi conidial suspensions at the intersegment behind the second abdominal segment. The larvae were then returned to the artificial diet and reared at 27 °C until they were sacrificed for sample collection for RNA and protein

80

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

analysis at the indicated time points. The hemolymph and hemocytes were collected from 30 individual larvae for RNA and protein analysis. 20 animals were the reared for survival assay. We set another four controls: (1) DEPC-treated water with GFP dsRNA in the primary injections (DsGFP-infected); (2) DEPC-treated water without dsRNA in the primary injections (DEPC-infected); (3) 20 animals were injected only with PBS without N. rileyi conidial suspensions (PBS-injected); and (4) 20 animals were inoculated with N. rileyi conidial suspensions only (infected). The larval mortality rate was recorded 24 h after treatment. All assays were performed three times. 2.12. Statistical analysis The quantitative data are presented as mean ± SD for each experiment. Student’s t test (SPSS version 17.0; SPSS, Chicago, IL, USA) was used to compare the relative expression of SlTpx gene among various tissues, or between controls and challenged S. litura at each sampling time. The fold expression was analyzed using one-way ANOVA to determine the expression significance. ⁄ denotes p < 0.05, ⁄⁄ denotes p < 0.01. 3. Results 3.1. Gene cloning, molecular characterization and structural analysis of the genome of SlTpx The full-length cDNA sequence of SlTpx (GenBank accession number: KC685523) was obtained by RT-PCR and RACE-PCR, which generated an 1165-bp product that included a 75-bp 50 untranslated region (UTR) and a 503-bp 30 UTR with a polyadenylation signal (AATAAA) (Fig. 1A). Sequence analysis showed that the fulllength cDNA of SlTpx contained a 588-bp ORF encoding a protein of 195 amino acids with a predicted molecular mass of 21.958 kDa and an isoelectric point of 6.27 (Fig. 1A). Multiple sequence alignment of the deduced protein sequence of SlTpx indicated that the SlTpx sequence had 95.4%, 90.8%, 78.5%, 76.0%, and 71.9% similarity to Tpxs from Helicoverpa armigera (ABW96360.1), B. mori (NP_001037083.1), D. melanogaster (NP_477510.1), A. cerana cerana (ADT65134.1) and Anopheles gambiae (XP_308081.2), respectively (Fig. 1B). Moreover, as shown in Fig. 1B, The SlTpx deduced amino sequences exhibited two highly conserved N- and C-terminal cysteine (C) residues positioned in the two valine–cysteine–proline (VCP) regions, which are conserved in the catalytic motif of Tpxs, and two signature motifs (Regions I and II), which are essential to decamer formation in 2-Cys Tpxs. Generally, the motif sequences Xds/TxF/YxHx2Wx2T/S/Vx in Region II indicate that SlTpx belong to the typical 2-Cys Tpxs (Wood et al., 2003). To determine the relative position of the SlTpx in evolution, a phylogenetic analysis of the Tpxs from various species was performed by neighbor-joining (NJ) method using MEGA 5.0 (Saitou and Nei, 1987). Phylogenetic relationship analysis showed that the SlTpx protein had its closest genetic relationship with other available lepidopteran Tpx from H. armigera and B. mori (Fig. 1C). In agreement with this finding, they shared high protein sequence identity (95.4% and 90.8%). PCR was performed to obtain the genomic sequence to investigate the genomic DNA structure of SlTpx. The full-length SlTpx genomic sequence was approximately 1690 bp long and corresponds to a 1165-bp cDNA sequence. The exon/intron composition of the gene was determined by comparing the genomic sequence with the SlTpx cDNA sequence. The SlTpx gene comprised only one intron that exhibited a high AT content and had a typical 50 GT splice donor and 30 -AG splice acceptor, which was located in

the 50 UTR region. Alignment of exons and introns in the ORF region was preformed among the Tpxs from B. mori, D. melanogaster, A. cerana cerana and An. gambiae (Fig. 1D). This revealed that SlTpx, DmTpx and AgTpx contained no intron in their ORF regions, while AccTpx and BmTpx contained two and three introns, respectively. 3.2. Expression, purification and characterization of recombinant SlTpx protein To assess the SlTpx gene, the complete ORF of SlTpx was cloned into the pET-30a (+) vector and expressed as a His-tagged fusion protein in E. coli BL21(DE3) with IPTG treatment. SDS–PAGE analysis showed that the recombinant protein had a molecular mass of 25 kDa and was produced predominantly as a soluble protein (Fig. 2A). The soluble recombinant protein was further purified by Ni–NTA spin columns, and the concentration of the purified rSlTpx was 0.5 mg/ml. The purified fusion proteins were then injected into rabbits to generate the specific antibodies. The purified proteins and total proteins from S. litura were used in Western blotting analyses to determine the specificity of the antibodies. The results showed that one specific band corresponded to a molecular weight of 25.0 kDa (Fig. 2A). Therefore, the antibodies were suitable for further research. Tpx can maintain H2O2 at its normal level by clearing excess H2O2 (Folmer et al., 2008). To examine the antioxidant activity of recombinant protein, its ability to remove H2O2 was measured in vitro by the decrease of H2O2 in the reaction mixture with or without DTT (Fig. 2B and C). As expected, when DTT was present in the reaction mixture, the rate of H2O2 degradation was gradually increased as the concentration of recombinant protein increased. It was higher than the control group with BSA. In comparison, there was no significant degradation of H2O2 observed without DTT (Fig. 2B). As shown in 2C, the results clearly revealed that purified rSlTpx protein with DTT catalyzed the removal of H2O2 in a concentration-dependent and time-dependent manner. In conclusion, rSlTpx possesses the ability to remove H2O2, and its peroxide activity is thiol-dependent. The DNA protection activity of recombinant SlTpx was examined by DNA nicking assay with super-coiled plasmid DNA in a metal-catalyzed oxidation (MCO) system. In the absence of rSlTpx, the hydroxyl radicals produce in the system resulted in nicking of the super-coiled pET-30a (+) DNA into linear form, as evidenced by a shift in gel mobility. DNA protection was increased by rSlTpx in a concentration-dependent manner (Fig. 2D). 3.3. Characterization of host hemolymph during N. rileyi infection As shown in fig. 3B, N. rileyi entered and colonized the host hemolymph by 24 h post-inoculation. Hyphal bodies (short hyphal lengths and yeast-like blastospores) had attached to hemocytes and appeared to be stimulating hemocytes aggression and becoming phagocytosed or encapsultated. Days 1–2 post-inoculation are the key stages of fungal pathogenesis, when hyphal bodies utilize diverse mechanisms to cope with insect immune responses, a large number of hyphal bodies were phagocytosed and encapsulated by hemocytes during this period, and few hyphal bodies circulated freely in the hemolymph (Fig. 3B and C). by 3 days post-inoculation, hyphal bodies freely floating in the hemolymph increased in concentration, accompanied by a decreased in hemocytes counts (Fig. 3D). 3.4. Tissue distribution and expression profiles of SlTpx during different infection stages The expression profiles of the SlTpx gene in different tissues were investigated at the transcriptional and translation levels by

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

81

Fig. 2. Expression, purification and activity assay of recombinant SlTpx fusion proteins. (A) Protein samples were analyzed by SDS–PAGE and stained with Coomassie brilliant blue. 1: protein marker (kDa); 2: extract induced E. coli BL21(DE3) with PET-30a (+) as a control; 3: crude extract from IPTG-induced cells with PET-SlTpx; 4: purified rSlTpx fusion protein; 5: purified rSlTpx characterized by Western blotting. 6: total protein from S. litura. 7: Western blotting analysis of SlTpx from S. litura. (B) H2O2 elimination in the presence or absence of DTT with different concentration of rSlTpx protein or BSA. The incubation time of the reaction mixture was 10 min. (C) Antioxidant activity of various concentrations of rSlTpx protein for different incubation times. Removal of H2O2 by rSlTpx was monitored by measurement of the decrease in absorbance at 470 nm. Each value is given as the mean ± SD of three replicates. (D) Protection of DNA from oxidative damage by rSlTpx in the mixed-function oxidation system. Lane 1, pET-30a (+) plasmid DNA alone with no incubation; lane 2, pET-30a (+) plasmid DNA in HEPES buffer and incubated at 37 °C for 2.5 h; lane 3, pET-30a (+) plasmid DNA + FeCl3; lane 4, pET-30a (+) plasmid DNA + FeCl3 + DTT; lane 5, pET-30a (+) plasmid DNA + FeCl3 + DTT + BSA; lane 6–10, pET-30a (+) plasmid DNA + FeCl3 + DTT + purified rSlTpx (6, 12, 25, 50 and 100 lg/ml, respectively). SF, supercoiled form; NF, nicked form.

Fig. 3. Different patterns of hemocytes and hyphal bodies after inoculation with N. rileyi. (A) The normal hemocytes. (B) and (C) at 24 and 48 h post-inoculation, the presence of the fungus appeared to stimulate hemocytes aggregation. And hyphal bodies were phagocytosed and encapsulated by hemocytes. (D). at 72 h post-inoculation, hyphal bodies were free floating in hemolymph. HB, Hyphal bodies.

qPCR and Western blotting analysis (Fig. 4). The qPCR analysis showed that the SlTpx was distributed in the examined tissues with the highest expression levels in the hemocytes. After infection with N. rileyi for 24 h, expression of SlTpx was significantly induced

in some tissues where it was also constitutively expressed (Fig. 4A), with the strongest expression in hemocytes of unchallenged and N. rileyi-challenged S. litura (Fig. 4B). However, the translational expression profile differed slightly from the transcrip-

82

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

Fig. 4. Tissue distribution and expression profile of SlTpx in S. litura. (A) and (B) Real-time qPCR analysis of SlTpx expression pattern in different tissues from normal or N. rileyi-challenged S. litura 24 h PI. Relative gene expression was normalized against expression of the two internal reference genes in each tissue sample. (C) Western blotting analysis of SlTpx distribution in different tissues from normal (left panel) or N. rileyi-challenged S. litura 24 h PI (right panel), respectively. Real-time qPCR (D) and Western blotting analysis (E) of SlTpx expression pattern in the hemocytes of S. litura induced by PBS, N. rileyi and H2O2 overload. Non-injected samples were used as controls. Total RNA/protein from S. litura treated with N. rileyi, PBS, or H2O2 was extracted from hemocytes at different time points. Values shown are the mean (±SD) of three biological replicates. ⁄ and ⁄⁄ indicate statistical significance expression values to 1 at p < 0.05 and p < 0.01, respectively.

tional one. The SlTpx protein was present in hemocytes, head and cuticle from normal S. litura. When N. rileyi was inoculated into the body cavity of S. litura larvae, SlTpx protein was detected in head, hemocytes, fatbody, midgut, malpighian tubule, but not in the hemolymph and cuticle. The highest expression levels were found in hemocytes (Fig. 4C). To examine the expression profiles of the SlTpx gene activated by N. rileyi, we performed time-course analysis of the larval hemocytes by real-time qPCR. The results showed that SlTpx expression was increased and peaked at 6 h PI with N. rileyi infection, then its transcripts levels gradually declined. Marked up-regulation of SlTpx was observed after 1 h H2O2 treatment and sharply peaked, followed by a gradually decreased, then rising at 48 h PI (Fig. 4D). This gene expression was maintained at very low expression level In PBS-challenged controls. Expression patterns of the SlTpx protein were also examined in the larval hemocytes using Western blotting. The level of translational expression In PBS-challenged controls remained a normal level from 1 to 6 h PI, and then declined. However, this expression pattern was in contrast with N. rileyi treatment. As shown in (Fig. 4E), the protein level of SlTpx significantly increased and kept a high level from 3 to 24 h PI after

inoculation with N. rileyi, afterwards declined at 48 h PI. The protein expression of SlTpx gene peaked at 1 h after H2O2 injection, after which it decreased gradually. Here, real-time qPCR assays and Western blotting demonstrated that SlTpx was induced by both conidial suspension and H2O2 treatment.

3.5. N. rileyi caused oxidative stress and induced changes in expression of SlTpx in S. litura To the best of our knowledge, this is the first study to determine the effects of N. rileyi infection on oxidative stress in S. litura. We assayed the generation of ROS in hemocytes after different treatments at 6 h PI. As shown in Fig. 5A and B, the fluorescence in H2O2A and conidial-suspension-challenged groups both showed high intensity, which was stronger than in the PBS-challenged and normal controls. One of the important aspects of damage caused by ROS is lipid oxidation. To determine whether N. rileyi infection caused this damage, we measured lipid peroxidation in hemolymph after different treatments. MDA generation was significantly increased following H2O2 and conidial suspension

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

83

Fig. 5. Stimulatory effect of N. rileyi on ROS levels in hemocytes of S. litura. S. litura pretreated with PBS, N. rileyi conidial suspensions and H2O2 for 6 h. (A) Analysis of hemocytes ROS generation. (B) The corresponding DCF-fluorescent intensity quantification was expressed as percentage of values found in normal hemocytes. (C) Analysis of MDA generation and lipid peroxidation in hemolymph of S. litura. Values shown are the mean (±SD) of three experiments. ⁄ and ⁄⁄ indicate statistical significance at p < 0.05 and p < 0.01, respectively.

treatment, but in PBS-challenged and normal controls, the MDA concentration remained relatively low (Fig. 5C).

3.6. Effects of dsRNA interference of SlTpx transcripts on resistance against N. rileyi To examine the function of SlTpx, dsRNA of SlTpx was synthesized in vitro and injected into the hemolymph of sixth instar larvae. RT-PCR and Western blotting indicated that the SlTpx dsRNA

efficiently reduced the levels of the SlTpx transcripts (Fig. 6A) and proteins (Fig. 6B) of the target SlTpx gene between days 1 and 3 PI. The role of SlTpx in resistance against fungal pathogens was investigated by measurement of survival rates after RNAi-mediated silencing of SlTpx in sixth instar S. litura larvae. Knock-down of SlTpx increased the mortality rate of infected larvae (Fig. 6C). The LT50 (time required to reach 50% mortality) of DEPC-infected, DsGFP-infected and fungus-infected S. litura was 4.6, 4.6 and

Fig. 6. Effects of SlTpx dsRNA interference on the levels of the transcripts and proteins of the SlTpx gene, and survival of S. litura. (A) A total of 5 lg dsRNA was injected into each larva after ecdysis into the sixth instar stage. Total RNA and proteins were extracted from the hemocytes of the 30 treated larvae for transcript analysis by RT-PCR and protein analysis by Western blotting, respectively. In the RT-PCR analysis, b-actin amplification from the same RNA samples as the target gene was used as an internal control. DPI: days post injection. (B) In Western blotting analysis, 30 lg protein was loaded per lane and probed with anti-SlTpx antibody. The control was samples injected with GFP dsRNA (A and B). (C) Bioassay of SlTpx interfered by dsRNA in S. litura. Following injection of SlTpx dsRNA, 20 larvae were inoculated with PBS containing 1  107 spores/mL N. rileyi conidia (DsSlTpx-infected). 20 larvae were treated with GFP dsRNA and PBS containing 1  107 spores/mL N. rileyi conidia (DsGFP-infected). 20 larvae were inoculated with PBS without N. rileyi conidial (PBS-injected). 20 larvae were treated with DEPC without dsRNA and PBS containing 1  107 spores/mL N. rileyi conidia (DEPC-infected). 20 larvae were inoculated with 1  107 spores/mL N. rileyi conidia only (infected). The number of dead larvae was counted daily. (D) LT50 in the bioassay. Values shown are the mean (±SD) of three experiments. A&B: significant difference, p < 0.01.

84

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85

4.8 days, which was significantly higher than in fungus-infected SlTpx-RNAi mutants (3.9 days, p < 0.01, Fig. 6D). These data suggest that SlTpx is required for resistance against infection by N. rileyi.

4. Discussion The strong pathogenicity of N. rileyi against S. litura has led to its use in insect pest management. However, the molecular mechanisms of the interactions between S. litura and N. rileyi remain unknown. In the present study, we described the stage specificity of mRNA expression, protein expression, localization, and function of SlTpx in the action of S. litura against N. rileyi. SlTpx cDNA encoded 195 amino acid residues with >70% identity to the 2-Cys Tpxs of other insect species. Moreover, the phylogenetic analysis suggested that SlTpx showed an obvious orthologous relationship with other lepidopteran 2-Cys Tpxs (BmTpx and HaTpx). Two highly conserved cysteines and multiple sequence alignments also demonstrated that SlTpx belongs to the 2-Cys subgroup of Tpxs. Most members of the 2-Cys subgroup possess peroxide reductase activity and are capable of using thioredoxin as an electron donor, and have therefore been named thioredoxin peroxidases (Radyuk et al., 2001; Lee et al., 2005). In animal cells, Tpxs prevent cellular damage resulting from oxidative insults by eliminating peroxides at low concentrations of substrate using thioredoxin as the electron donor (Ishii et al., 2011). The antioxidative function of Tpxs has also been demonstrated in insect species, especially D. melanogaster (Radyuk et al., 2001, 2003). Furthermore, insects have lost the genes encoding functional glutathione peroxidase (Gpx) compared with vertebrates; however, insect Tpxs compensate for the functions of Gpx (Kanzok et al., 2001). Furthermore, among the three classes of Tpxs, 2-Cys Tpx has the most abundant transcription and the highest degree of affinity for H2O2 (Chae et al., 1999). Thus, 2-Cys Tpx plays a particularly central role in insects in protection against toxicity of ROS. Here, an in vitro peroxidase activity assay demonstrated that rSlTpx cleared H2O2 efficiently in the presence of DTT. These results demonstrate that SlTpx displays the enzymatic characteristics common to 2-Cys Tpxs. In B. mori, Kim et al. (2007) have demonstrated that Tpx is significantly induced by E. coli, Beauveria bassiana or BmNPV. In Bombus ignitus, antioxidant enzymes, superoxide dismutase 1 (Choi et al., 2006a) and thioredoxin (Choi et al., 2006b), are unregulated by lipopolysaccharide, a major cell wall constituent of Gram-negative bacteria. In a different species, Fenneropenaeus chinensis Tpx in the hemocytes and hepatopancreas is highly upregulated after bacteria injection. In addition, viral (Mohankumar and Ramasamy, 2006) and bacterial (Mu et al., 2009; Zhang et al., 2007) infections have been shown to affect the activity of antioxidant enzymes in crustaceans. In the present study, expression of SlTpx at the transcriptional level revealed that SlTpx transcripts were present in all tissues examined. However, SlTpx transcripts were only detected in the epidermal system and hemocytes at the translational levels. This may be because the epidermal system is the first physical line of defense against ROS. Moreover, expression of SlTpx at the transcriptional and translational levels was significantly induced by N. rileyi and the highest expression levels were found in hemocytes. Upregulation of Tpx indicates its role in protection against microbial infection. Hemocytes have been demonstrated to play an important role in limiting infection in invertebrates (Plows et al., 2006; Hong et al., 2007; Chang et al., 2007). And hemocytes always selected as candidate tissue for investigating the fluctuation of immune-related genes. In the present study, hemocytes were used as our target tissue to examine the expression profiles of SlTpx after N. rileyi challenge. Through time-course analysis in hemocytes, the expression trend of SlTpx in S. litura

challenged by N. rileyi was similar to that in SlTpx challenged by H2O2. Our results suggest that the upregulation of SlTpx by N. rileyi infection indicates its involvement in protection against oxidative damage caused by microbial infection. Oxidative stress induced by H2O2 stimulation and microbial challenge activates endogenous antioxidant defense in which Tpxs play an important role in insects (Radyuk et al., 2001, 2003; Wang et al., 2008). Overexpression of Tpxs in Drosophila cells confers greater resistance to H2O2 treatment (Radyuk et al., 2001). In contrast, when Tpx levels are reduced in Drosophila cells via RNAi, the cells become susceptible to oxidative stress caused by exposure to H2O2 (Radyuk et al., 2003). Here, we found that H2O2 or N. rileyi pretreatment increased hemocyte ROS generation and elevated mRNA levels/protein levels of SlTpx. More importantly, H2O2 or N. rileyi increased lipid damage caused by ROS. All these observations indicate that N. rileyi infection caused generation of ROS and induced changes in expression of SlTpx. Furthermore, interference with expression of the SlTpx transcript in larvae that had just molted into the sixth instar stage resulted in increased sensitivity to N. rileyi and shortened LT50 values. This indicates that expression of SlTpx is required to defend against N. rileyi infection. Several molecular mechanisms are known to be involved in the response to foreign agents in insects. The data obtained in this study demonstrate that SlTpx plays an essential role in resistance to fungal pathogens and oxidative damage by pathogenic fungal infection. These observations represent the basis of a novel strategy for S. litura control based on rational design of chemicals and microbial pesticides, targeting SlTpx to improve the efficacy of microbial pesticides against S. litura.

Acknowledgments This work was funded and sponsored by the Foundation of National 863 High-Tech Plan of China (2011AA10A201) and the National Public Welfare Industry (Agriculture) Special Scientific Research Foundation (201103002).

References Aguirre, J., Rios-Momberg, M., Hewitt, D., Hansberg, W., 2005. Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 13 (3), 111–118. Ahmad, M., Iqbal Arif, M., Ahmad, M., 2007. Occurrence of insecticide resistance in field populations of Spodoptera litura (Lepidoptera: Noctuidae) in Pakistan. Crop Prot. 26 (6), 809–817. Aran, M., Ferrero, D.S., Pagano, E., Wolosiuk, R.A., 2009. Typical 2-Cys peroxiredoxins modulation by covalent trans-formations and noncovalent interactions. FEBS J 276, 2478–2493. Chae, H.Z., Kim, H.J., Kang, S.W., Rhee, S.G., 1999. Characterization of three isoforms of mammalian peroxiredoxin that reduce peroxides in the presence of thioredoxin. Diabetes Res. Clin. Pract. 45 (2–3), 101–112. Chang, C.C., Wu, Z.R., Kuo, C.M., Cheng, W., 2007. Dopamine depresses immunity in the tiger shrimp Penaeus monodon. Fish Shellfish Immunol. 23 (1), 24–33. Chen, H., Yin, Y., Li, Y., Mahmud, M.S., Wang, Z., 2012. Identification and analysis of genes differentially expressed in the Spodoptera litura fat body in response to the biocontrol fungus, Nomuraea rileyi. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 163 (2), 203–210. Choi, Y.S., Lee, K.S., Yoon, H.J., Kim, I., Sohn, H.D., Jin, B.R., 2006a. A bumblebee thioredoxin-like protein gene that is up-regulated by a temperature stimulus and lipopolysaccharide injection. Eur. J. Entomol. 103 (2), 291. Choi, Y.S., Lee, K.S., Yoon, H.J., Kim, I.K.S.O.O., Sohn, H.D., Jin, B.R., 2006b. Bombus ignitus Cu, Zn superoxide dismutase (SOD1): cDNA cloning, gene structure, and up-regulation in response to paraquat, temperature stress, or lipopolysaccharide stimulation. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 144 (3), 365–371. Corona, M., Robinson, G.E., 2006. Genes of the antioxidant system of the honey bee: annotation and phylogeny. Insect Mol. Biol. 15 (5), 687–701. Folmer, V., Pedroso, N., Matias, A.C., Lopes, S.C., Antunes, F., Cyrne, L., Marinho, H.S., 2008. H2O2 induces rapid biophysical and permeability changes in the plasma membrane of Saccharomyces cerevisiae. Biochim. Biophys. Acta 1778 (4), 1141– 1147.

H. Chen et al. / Developmental and Comparative Immunology 44 (2014) 76–85 Gertz, M., Fischer, F., Leipelt, M., Wolters, D., Steegborn, C., 2009. Identification of Peroxiredoxin 1 as a novel interaction partner for the lifespan regulator protein p66Shc. Aging (Albany, NY) 1 (2), 254–265. Guo, X.R., Zheng, S.C., Liu, L., Feng, Q.L., 2009. The sterol carrier protein 2/3-oxoacylCoA thiolase (SCPx) is involved in cholesterol uptake in the midgut of Spodoptera litura: gene cloning, expression, localization and functional analyses. BMC Mol. Biol. 10, 102. Hambarde, S., Yennamalli, R.M., Subbarao, N., Chandna, S., 2010. Predictive inference on cytoplasmic and mitochondrial thioredoxin peroxidases in the highly radioresistant lepidopteran insect Spodoptera frugiperda. Bioinformation 4, 399. Hambarde, S., Singh, V., Chandna, S., 2013. Evidence for involvement of cytosolic thioredoxin peroxidase in the excessive resistance of Sf9 lepidopteran insect cells against radiation-induced Apoptosis. PLoS One 8, e58261. He, W.Y., Rao, Z.C., Zhou, D.H., Zheng, S.C., Xu, W.H., Feng, Q.L., 2012. Analysis of expressed sequence tags and characterization of a novel gene, Slmg7, in the midgut of the common cutworm, Spodoptera litura. PLoS One 7, e33621. Hong, M., Chen, L., Sun, X., Gu, S., Zhang, L., Chen, Y., 2007. Metabolic and immune responses in Chinese mitten-handed crab (Eriocheir sinensis) juveniles exposed to elevated ambient ammonia. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 145 (3), 363–369. Hu, Z., Lee, K.S., Choo, Y.M., Yoon, H.J., Lee, S.M., Lee, J.H., et al., 2010. Molecular cloning and characterization of 1-Cys and 2-Cys peroxiredoxins from the bumblebee Bombus ignitus. Comp Biochem Physiol B 155, 272–280. Hu, Z., Lee, K.S., Choo, Y.M., Yoon, H.J., Lee, S.M., Lee, J.H., Kim, D.H., Sohn, H.D., Jin, B.R., 2010. Molecular cloning and characterization of 1-Cys and 2-Cys peroxiredoxins from the bumblebee Bombus ignitus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 155 (3), 272–280. Immenschuh, S., Baumgart-Vogt, E., 2005. Peroxiredoxins, oxidative stress, and cell proliferation. Antioxid. Redox Signal. 7 (5–6), 768–777. Ishii, Tetsuro., Warabi, Eiji., Yanagawa, Toru., 2011. Novel roles of peroxiredoxins in inflammation, cancer and innate immunity. J. Clin. Biochem. Nutr., 1202160141. Jain, S.K., 1985. In vivo externalization of phosphatidylserine and phosphatidylethanolamine in the membrane bilayer and hypercoagulability by the lipid peroxidation of erythrocytes in rats. J. Clin. Invest. 76 (1), 281–286. Kanzok, S.M., Fechner, A., Bauer, H., Ulschmid, J.K., Muller, H.M., Botella-Munoz, J., Schneuwly, S., Schirmer, R., Becker, K., 2001. Substitution of the thioredoxin system for glutathione reductase in Drosophila melanogaster. Science 291 (5504), 643–646. Kim, K., Kim, I.H., Lee, K.Y., Rhee, S.G., Stadtman, E.R., 1988. The isolation and purification of a specific ‘‘protector’’ protein which inhibits enzyme inactivation by a thiol/Fe(III)/O2 mixed-function oxidation system. J. Biol. Chem. 263 (10), 4704–4711. Kim, Y.J., Lee, K.S., Kim, B.Y., Choo, Y.M., Sohn, H.D., Jin, B.R., 2007. Thioredoxin from the silkworm, Bombyx mori: cDNA sequence, expression, and functional characterization. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 147 (3), 574– 581. Kranthi, K.R., Jadhav, D.R., Wanjari, R.R., Ali, S.S., Russell, D., 2001. Carbamate and organophosphate resistance in cotton pests in India, 1995 to 1999. Bull. Entomol. Res. 91 (1), 37–46. Kranthi, K.R., Jadhav, D.R., Kranthi, S., Wanjari, R.R., Ali, S.S., Russell, D.A., 2002. Insecticide resistance in five major insect pests of cotton in India. Crop Prot. 21 (6), 449–460. Lee, K.S., Kim, S.R., Park, N.S., Kim, I., Kang, P.D., Sohn, B.H., Choi, K.H., Kang, S.W., Je, Y.H., Lee, S.M., Sohn, H.D., Jin, B.R., 2005. Characterization of a silkworm thioredoxin peroxidase that is induced by external temperature stimulus and viral infection. Insect Biochem. Mol. Biol. 35 (1), 73–84.

85

Lim, Y., Cha, M., Kim, H., Uhm, T., Park, J., Kim, K., Kim, I.H., 1993. Removals of hydrogen peroxide and hydroxyl radical by thiol-specific antioxidant protein as a possible role in vivo. Biochem. Biophys. Res Commun. 192, 273–280. Meng, X., Hu, J., Xu, X., Wang, Z., Hu, Q., Jin, F.L., Ren, S.X., 2013. Toxic effect of destruxin A on abnormal wing disc-like (SLAWD) in Spodoptera litura fabricius (lepidoptera: noctuidae). PLoS One 8, e57213. Mohankumar, K., Ramasamy, P., 2006. White spot syndrome virus infection decreases the activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res. 115 (1), 69–75. Mu, C., Zhao, J., Wang, L., Song, L., Zhang, H., Li, C., Qiu, L., Gai, Y., 2009. Molecular cloning and characterization of peroxiredoxin 6 from Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 26 (6), 821–827. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT–PCR. Nucleic Acids Res. 29, e45. Plows, L.D., Cook, R.T., Davies, A.J., Walker, A.J., 2006. Phagocytosis by Lymnaea stagnalis haemocytes: a potential role for phosphatidylinositol 3-kinase but not protein kinase A. J. Invertebr. Pathol. 91 (1), 74–77. Radyuk, S.N., Klichko, V.I., Spinola, B., Sohal, R.S., Orr, W.C., 2001. The peroxiredoxin gene family in Drosophila melanogaster. Free Radic. Biol. Med. 31 (9), 1090– 1100. Radyuk, S.N., Sohal, R.S., Orr, W.C., 2003. Thioredoxin peroxidases can foster cytoprotection or cell death in response to different stressors: over- and underexpression of thioredoxin peroxidase in Drosophila cells. Biochem. J. 371 (Pt 3), 743–752. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425. Shi, G.Q., Yu, Q.Y., Shi, L., Zhang, Z., 2012. Molecular cloning and characterization of peroxiredoxin 4 involved in protection against oxidative stress in the silkworm Bombyx mori. Insect. Mol. Biol. 21 (6), 581–592. Vandesompele, J., De, P.K., Pattyn, F., Poppe, B., Van, R.N., De, P.A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. (3: research0034). Wang, Q., Chen, K., Yao, Q., Zhao, Y., Li, Y., Shen, H., Mu, R., 2008. Identification and characterization of a novel 1-Cys peroxiredoxin from silkworm, Bombyx mori. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 149 (1), 176–182. Wang, Z., Zhang, W., Chen, H., Yin, Y., 2012. Cloning and characterisation of the gallerimycin gene from immunised Spodoptera litura. Bull. Insectol. 65 (2), 233– 238. Wood, Z.A., Schroder, E., Robin Harris, J., Poole, L.B., 2003. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem. Sci. 28 (1), 32–40. Yang, C.S., Lee, D.S., Song, C.H., An, S.J., Li, S., Kim, J.M., Kim, C.S., Yoo, D.G., Jeon, B.H., Yang, H.Y., Lee, T.H., Lee, Z.W., El-Benna, J., Yu, D.Y., Jo, E.K., 2007. Roles of peroxiredoxin II in the regulation of proinflammatory responses to LPS and protection against endotoxin-induced lethal shock. J. Exp. Med. 204 (3), 583– 594. Yu, F., Kang, M., Meng, F., Guo, X., Xu, B., 2011. Molecular cloning and characterization of a thioredoxin peroxidase gene from Apis cerana cerana. Insect. Mol. Biol. 20 (3), 367–378. Zhang, Q., Li, F., Zhang, J., Wang, B., Gao, H., Huang, B., Jiang, H., Xiang, J., 2007. Molecular cloning, expression of a peroxiredoxin gene in Chinese shrimp Fenneropenaeus chinensis and the antioxidant activity of its recombinant protein. Mol. Immunol. 44 (14), 3501–3509. Zheng, X., Xia, Y., 2012. Beta-1,3-Glucan recognition protein (betaGRP) is essential for resistance against fungal pathogen and opportunistic pathogenic gut bacteria in Locusta migratoria manilensis. Dev. Comp. Immunol. 36, 602–609.