© 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd doi:10.1111/tra.12136

The Vps35 D620N Mutation Linked to Parkinson’s Disease Disrupts the Cargo Sorting Function of Retromer Jordan Follett1 , Suzanne J. Norwood1 , Nicholas A. Hamilton1 , Megha Mohan2 , Oleksiy Kovtun1 , Stephanie Tay1 , Yang Zhe1 , Stephen A. Wood2 , George D. Mellick2 , Peter A. Silburn2,3 , Brett M. Collins1 , Andrea Bugarcic1,∗ and Rohan D. Teasdale1 1

Institute for Molecular Bioscience, The University of Queensland, St Lucia, Queensland, Australia Eskitis Institute for Drug Discovery, Griffith University, Nathan, Queensland, Australia 3 The University of Queensland Centre for Clinical Research, Herston, Queensland, Australia 2

∗

Corresponding author: Andrea Bugarcic, [email protected]

Abstract The retromer is a trimeric cargo-recognition protein complex composed

affinity as wild-type Vps35. While PD-linked point mutant Vps35 D620N

of Vps26, Vps29 and Vps35 associated with protein trafficking within

interacts with the cation-independent mannose-6-phosphate receptor

endosomes. Recently, a pathogenic point mutation within the Vps35

(CI-M6PR), a known retromer cargo, we find that its expression disrupts

subunit (D620N) was linked to the manifestation of Parkinson’s disease

the trafficking of cathepsin D, a CI-M6PR ligand and protease responsible

(PD). Here, we investigated details underlying the molecular mechanism

for degradation of α-synuclein, a causative agent of PD. In summary, we

by which the D620N mutation in Vps35 modulates retromer function,

find that the expression of Vps35 D620N leads to endosomal alterations

including examination of retromer’s subcellular localization and its

and trafficking defects that may partly explain its action in PD.

capacity to sort cargo. We show that expression of the PD-linked Vps35

Keywords Retromer, Vps35 D620N, Parkinson’s disease, endosome,

D620N mutant redistributes retromer-positive endosomes to a perinu-

cathepsin D

clear subcellular localization and that these endosomes are enlarged in

Received 15 July 2013, revised and accepted for publication 21 October

both model cell lines and fibroblasts isolated from a PD patient. Vps35

2013, uncorrected manuscript published online 23 October 2013,

D620N is correctly folded and binds Vps29 and Vps26A with the same

published online 14 November 2013

Parkinson’s disease (PD) is a neurodegenerative disorder characterized by the formation of large, insoluble, intracellular protein aggregates termed Lewy bodies. Anatomically, the most critical abnormality in PD is the loss of neurons in the substantia nigra and the depletion of dopamine from basal ganglia circuits, resulting in disruption in the brain communication. Even though the mechanism behind Lewy body formation is controversial, immunoreactivity has identified proteins such as ubiquitin, molecular chaperone proteins αB-crystallin, Hsp70, Hsp40 and presynaptic protein α-synuclein as key components of Lewy body structures (1,2). α-synuclein is a 14 kDa natively unfolded protein with no known function, but the central region of this protein (amino acids 61–95) contains residues prone

to self-aggregation (3,4). This self-aggregation tendency may be a primary driving factor in the formation of higher molecular weight species observed in Lewy bodies, commonly witnessed in the brains of PD patients. In sporadic PD cases induction of changes in α-synuclein protein structure and subsequent generation of aggregates has been hypothesized to occur via several different pathways. These include the dysregulation of mitochondrial function, specifically leading to increased free radical production (5) and free cytosolic calcium levels, as well as the inhibition of protein-degradation pathways (reviewed in (6) and (7)). Interestingly, recent studies implicated lysosomes and lysosomal enzymes as fundamental regulators of α-synuclein turn over – (i) Cuervo et al. reported binding

230 www.traffic.dk

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

of α-synuclein to lysosomal membranes leading to inhibition of lysosome function (8), (ii) cathepsin D, a lysosomal protease and cation-independent mannose-6-phosphate receptor (CI-M6PR) ligand, is able to degrade α-synuclein in vivo and in vitro (9,10) and (iii) the cathepsin D knockout mouse model shows marked increase in aggregated but unchanged monomeric levels of α-synuclein (11). Mammalian retromer is a protein complex composed of three proteins Vps26, Vps29 and Vps35, with an important role in the sorting and trafficking of transmembrane receptors within the endosome. The retromer forms a stable trimer, which associates with a range of other proteins, including sorting nexins (SNXs), which modulate its function (reviewed in 12). Sorting of cargo from endosomes to the TGN is a tightly organized process, and retromer is a key player in mediating trafficking of several receptors on this route, including CI-M6PR (13). Interaction between retromer and CI-M6PR is mediated through a tripeptide sequence within the C-terminal cytoplasmic domain of CIM6PR (13) and amino acids 500–693 of the Vps35 subunit (14). Disruption of the retromer–cargo interaction, either by downregulation of retromer levels (14) or modification of cargo cytoplasmic domains (13), leads to accumulation of receptors in early endosomes and ultimately to their degradation (15,16). Within the TGN CI-M6PR binds enzymes, such as newly synthesized cathepsin D, and delivers them to the late endosome network where they undergo processing to yield enzymatically active forms responsible for protein degradation within the lysosome (17). Upon dissociation of CI-M6PR from its ligand, CI-M6PR is trafficked back to the TGN by interacting with the retromer complex within the endosomal membrane (14,18). Any failure within this CI-M6PR cycling has been shown to result in increased turnover of the receptor as well as improper intracellular processing and secretion of the cathepsin D into the surrounding medium (14,16,19). Successful delivery of cathepsin D to the endosomal network results in processing of the ‘pro’ form into a mature, active form of this enzyme (20). As such, the availability of CI-M6PR at the TGN, via its association with retromer, is crucial for sorting of cathepsin D from TGN to endosomes. A number of recent reports determined a link between several point mutations of Vps35, a retromer subunit, and manifestation of late-onset PD. Reports implicating Vps35 Traffic 2014; 15: 230–244

in PD demonstrate that a single point mutation of highly conserved amino acid 620 in Swiss, Austrian and German families leads to an autosomal dominant, high penetrance mode of PD inheritance (21–24). Using direct sequencing of samples from PD patients, two individual groups further confirmed the presence and same inheritance mode of the D620N variant in French and Japanese ethnic groups (21,22). A recent large multicenter study used more than 15 000 subjects worldwide to screen for all known PD variants and confirmed the presence of D620N in five familial cases and two seemingly sporadic cases, emphasizing the importance of this particular point mutation in PD patient cohorts worldwide (25). Collectively, genetic evidence suggests that the pathogenic D620N Vps35 variant is a rare cause of familial as well as idiopathic forms of PD, and points to endosomal trafficking as a critical process in the disease. To understand the underlying molecular mechanism of the PD causing Vps35 D620N mutation we examined if an established retromer function, namely regulation of CI-M6PR trafficking, was disrupted by the expression of this variant. Any disruption of CI-M6PR trafficking, and therefore cathepsin D processing, has the potential to directly lead to downstream modulation of the levels of α-synuclein monomeric and/or aggregated forms. While Vps35 D620N is correctly folded and assembled into trimeric retromer complexes, its overexpression leads to formation of dilated and misplaced endosomes in model cell lines with same phenotype also observed in skin fibroblasts isolated from a PD patient with Vps35 D620N mutation. Retromer containing the mutant Vps35 D620N incorrectly traffics its cargo, CI-M6PR, resulting in improper processing of cathepsin D, a CI-M6PR ligand, and leads to increased secretion of pro-cathepsin D. Our results therefore show that the dominant expression of Vps35 D620N mutation results in endosomal trafficking alterations that may underpin its role in PD.

Results Vps35 D620N binds Vps29 and Vps26A with same affinity as Vps35 WT To assess the stability and functionality of the Vps35 D620N mutant in vitro, recombinant proteins were expressed and purified by affinity chromatography and 231

Follett et al.

gel filtration. Vps35 mutant D620N displayed similar elution profiles by gel filtration to the wild-type (WT) protein, and additionally circular dichroism (CD) spectra exhibited similar α-helical contents consistent with the Vps35 α-solenoid structure (26) (Figure 1B). We conclude therefore that the Vps35 D620N mutation does not lead to major misfolding of Vps35. We next tested the impact of the D620N mutation on the ability of Vps35 to form high affinity complexes with Vps26A and Vps29 in vitro (Figure 1C) (16,26). Structural data for Vps35 only exists for the C-terminal segment from residues 476–780, bound to the small retromer subunit Vps29 (26). The Asn 620 residue is present in an exposed loop between α-helices of the repeating pairs of HEATlike α-helical repeats, and does not contribute to the Vps35 interface with Vps29 (Figure 1A). As shown by isothermal titration calorimetry (ITC), we find that the D620N mutant binds to Vps26A and Vps29 with affinities and thermodynamic parameters indistinguishable from the Vps35 WT molecule (Figure 1C). Vps26A binds Vps35 WT and D620N with affinities (K d s) of 1.1 and 0.5 nM, respectively, while Vps29 binds WT and D620N with affinities of 170 and 180 nM, respectively. Furthermore, in vivo co-immunoprecipitation experiments detected no differences in levels of endogenous Vps26A and Vps29 subunits associated with Vps35 WT-GFP or the Vps35 D620N-GFP mutant (Figure 1D). Overall, we conclude that the presence of the D620N mutation in Vps35 does not directly affect global VPS35 folding and does not prevent the formation of a stable trimeric retromer protein complex. Expression of Vps35 D620N mutant causes redistribution of endosomes To determine if the presence of the D620N mutation in Vps35 altered the subcellular localization of retromer, we first performed live cell imaging of A431 cells transiently transfected with either Vps35 WT-GFP or Vps35 D620N-GFP pulsed with a fluid phase marker, Dextran647. The Vps35 WT-GFP dextran positive endosomes were found throughout the cell cytoplasm and displayed mobility typical of early endosomes including fusion between Vps35-GFP positive endosomes (Movie S1). In contrast, the Vps35 D620N-GFP positive endosomes were enlarged and redistributed to a tight, perinuclear localization (Figure 2A). Time-lapse microscopy demonstrated these enlarged endosomes contained dextran within their 232

lumens supporting their capacity to receive endocytosed materials. Enlarged Vps35 D620N-GFP positive endosomes were observed to arise from smaller, dispersed endosomes, likely to be early endosome structures undergoing fusion during endosome maturation (27) (Movie S2). To determine if the retromer complex was also present on these enlarged redistributed endosomes induced in the presence of the Vps35 D620N mutant, we used indirect immunofluorescence on A431 cells transiently transfected with Vps35 WT-GFP or Vps35 D620NGFP and immuno-labeled against endogenous Vps26A. Imaging of fixed cells overexpressing Vps35 WT-GFP show Vps35 WT-GFP/Vps26A positive endosomes with morphologies indistinguishable from Vps26A positive endosomes in neighboring untransfected cells. However, in cells overexpressing Vps35 D620N-GFP we observed endosomes positive for endogenous Vps26A redistributed to a perinuclear localization, dramatically different to surrounding untransfected cells showing Vps26A positive endosomes (Figure 2B). This analysis allowed us to confirm the presence of the retromer subunit, Vps26A, on the redistributed Vps35 D620N positive endosomes. Quantification of the endosome redistribution in cells overexpressing Vps35 WT-GFP or Vps35 D620N-GFP was performed by measuring the distance of each Vps35positive endosome from the middle of the nucleus. By designing a distance-based algorithm which measured fluorescent units by distinguishing perinuclear from nonperinuclear structures, we show that perinuclear fluorescence, representing endosomes, is increased in cells over-expressing Vps35 D620N-GFP when compared with Vps35 WT-GFP positive cells (Figure 2C). To determine if the localization of the modified endosomes induced by Vps35 D620N expression was microtubuledependent and associated with the microtubule organization center, we treated cells with a microtubule depolymerization agent, nocadazole. As shown in Figure 2D, cells overexpressing Vps35 D620N-GFP treated with nocadazole displayed a dissociation of the tightly localized endosomes to a dispersed cytoplasmic localization. Therefore, the localization of the induced endosomes is not a product of aggregation. Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

A

B

C

D

Figure 1: Vps35 mutant D620N binds to Vps29 and Vps26A in vitro and in vivo . A) Structure of the Vps35 (483–780) complex with Vps29 (26). Vps35 is shown in grey ribbons with transparent surface and Vps29 is shown in green/yellow ribbons. The D620N mutation is indicated in red. B) CD spectra of Vps35 WT and Vps35 D620N proteins. C) Isothermal titration calorimetry of purified recombinant Vps35 WT and Vps35 D620N protein to retromer subunits, Vps26A (right panel) and Vps29 (left panel) based on 16 × 2.5 mL injections of 100 μM Vps29 into 10 μM Vps35, or 50 μM Vps26A into 5 μM Vps35 D620N. Data shown represents integrated values of titration binding curves. D) Subconfluent HEK293 cells were transiently transfected with GFP, Vps35 WT-GFP or Vps35 D620N-GFP for 16 h, washed with ice-cold PBS and lysed on ice. Protein complexes were isolated using GFP-Nano Trap beads, resolved by SDS-PAGE and transferred to PVDF membranes. Membranes were incubated with primary antibodies against GFP, Vps26A or Vps29 followed by IRDye 680/800 secondary antibodies and imaged using the Odyssey infrared imaging system. Traffic 2014; 15: 230–244

233

Follett et al.

A

B

C

D

Identification of the redistributed endosome population To further investigate the properties of the enlarged redistributed endosomes induced in the presence of the Vps35 D620N mutant we performed a series of colocalization experiments with endosome and TGN marker proteins. A431 cells were transiently transfected 234

Figure 2: Ectopic expression of Vps35 D620N alters endosome morphology and distribution. A) Live cell time lapse confocal microscopy was performed on A431 cells expressing Vps35 WT-GFP or Vps35 D620N-GFP pulsed with 200 μg/mL Dextran-647 for 90 min using a Ziess LSM 710 FCS scanning confocal microscope. Image represents single frame of 30 min movie captured. Scale bar 10 μm. B) A431 cells expressing Vps35 WT-GFP or Vps35 D620N-GFP were fixed and indirect immunofluorescence was performed using antibodies against Vps26A. C) Quantification of the intracellular endosomal distribution based on perinuclear intensity ratio of A431 cells over-expressing Vps35 WT-GFP or VPS35 D620N-GFP. Graph represents the mean of two independent experiments with 15 images each (n = 2;**p < 0.01, Error bars ±SEM). D) A431 cells transfected with construct expressing Vps35 D620NGFP were treated with 2 μM nocadazole for 60 min at 37◦ C, fixed and indirect immunofluorescence was performed using antibodies against anti-β-tubulin. with Vps35 WT-GFP or Vps35 D620N-GFP for 24 h and indirect immunofluorescence was performed to compare the subcellular localization of endogenous EEA1, LAMP1 and p230 (Figure 3A). In cells overexpressing Vps35 WT-GFP, the distribution of EEA1 positive endosomes was indistinguishable from that observed in neighboring untransfected cells. In contrast, Vps35 D620N expression Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

caused a shift in EEA1-positive endosomes to the perinuclear region that was obvious when compared with neighboring untransfected cells (Figure 3A). Confocal analysis revealed a low, but consistent colocalization between Vps35 WT-GFP and EEA1 [colocalization coefficient (R) = 0.137] while Vps35 D620N-GFP showed an increase in colocalization with EEA1 (R = 0.207) (Figure 3B). While Vps35 WT-GFP showed low colocalization with LAMP1 (R = 0.101), a late endosome marker, and identical subcellular localization of LAMP1-positive compartments compared with neighbouring untransfected cells, Vps35 D620N-positive endosomes showed an increase in colocalization with this marker (R = 0.158) on the large, redistributed endosomes (Figure 3A and B). We next investigated the possibility of an association between the Vps35 D620N-GFP and the TGN using colocalization with the p230 marker. However, we observed no evidence of association between Vps35 D620N-GFP and p230 positive membranes (Figure 3A and B) and no distinct morphological differences in p230-positive Golgi structures between Vps35 WT-GFP and Vps35 D620N expressing cells was observed (Figure 3A). These data suggest increased association of Vps35 D620N-positive endosomes with both early and late endosome markers in an induced tight perinuclear subcellular location. Vps35 D620N mutant causes a defect in cathepsin D trafficking Retromer directly binds the CI-M6PR cytoplasmic domain via a region of Vps35 that overlaps with the position of the D620N mutation (14). To examine the CI-M6PR interaction with Vps35, we cotransfected the CD8-CIM6PR fusion construct with either Vps35 WT-GFP or Vps35 D620N-GFP and performed GFP-NanoTrap coimmunoprecipitations (16). As seen in Figure 4A, Vps35 D620N-GFP can coprecipitate CD8-CI-M6PR at levels comparable with Vps35 WT-GFP. We conclude that the D620N mutation in Vps35 does not disrupt retromer’s capacity to interact with this cargo. Next, we examined if the Vps35 D620N mutant is able to alter the subcellular localization of CI-M6PR by disrupting its normal trafficking itinerary. We transiently transfected A431 cells with Vps35 WT-GFP or Vps35 D620N-GFP and Traffic 2014; 15: 230–244

A

B

Figure 3: Ectopically expressed Vps35 D620N positive endosomes contain both early and late endosome markers. A) A431 cells transfected with constructs expressing Vps35 WT-GFP or Vps35 D620N-GFP were fixed and indirect immunofluorescence performed using monoclonal antibodies against EEA1, p230 or LAMP1 and counterstained with DAPI. All images represent a 1 AU single slice captured using a Ziess LSM 710 Upright Scanning Laser confocal microscope at 63× magnification. Scale bar 5 μm. B) Quantification of colocalization between Vps35 WT-GFP or Vps35 D620N-GFP and EEA1, p230 or LAMP1. Graph represents the mean of three independent experiments with 10 images each (n = 3;**p < 0.01, Error bars represent ±SEM). 235

Follett et al.

A

B

C

Figure 4: Ectopically expressed Vps35 D620N interacts with CI-M6PR but alters the receptors’ capacity to transport cathepsin D. A) HEK293 cells co-transfected with Vps35 WT-GFP/CD8-CI-M6PR or Vps35 D620N-GFP/CD8-CI-M6PR were lysed and co-immunoprecipitation was performed using GFP-NanoTrap beads. Total cell lysates (input; 50 μg per lane) and isolated interacting proteins were analysed by western immunoblotting using antibodies to CD8. B) Subconfluent A431 cells grown on coverslips were transiently transfected with Vps35 WT-GFP or Vps35 D620N-GFP for 16 h, fixed and indirect immunofluorescence performed using a mouse monoclonal against endogenous CI-M6PR. Images represent a 1 AU single slice captured using a Ziess LSM 710 Upright Scanning Laser confocal microscope at 63× magnification. Scale bar 5 μm. C) Subconfluent A431 cells transiently expressing Vps35-GFP or Vps35D620N-GFP for 24 h were pulsed with 100 μg/mL of cycloheximide in serum-free medium. Medium and corresponding cell lysates were collected at 0, 3 and 7 h post treatment. Media samples (500 μL), precipitated on ice using 10% TCA, and total cell lysates (50 μg per lane) were analysed for levels of cathepsin D and β-tubulin by western immunoblotting. determined the subcellular distribution of endogenous CIM6PR. Consistent with previous reports (14), a proportion of endogenous CI-M6PR was localized to Vps35 WT-GFPpositive endosomes. Interestingly, the proportion of CIM6PR/retromer-positive endosomal structures appeared to increase in cells overexpressing Vps35 D620N-GFP mutant (Figure 4B), with endogenous CI-M6PR also 236

showing redistribution into tight, punctuate perinuclear localization. To determine if the redistribution of the receptor impacted on delivery of CI-M6PR cargo, we investigated processing of cathepsin D in the presence of Vps35 D620N. Firstly, we characterized the processing of cathepsin D from pro- into Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

a mature form within the cells and secondly, we assessed the levels of pro-cathepsin D secreted into the media of the transfected cells. HEK293 cells were transiently transfected with either Vps35 WT-GFP or Vps35 D620NGFP for 24 h, incubated with cyclohexamide for up to 7 h and cell lysate and medium samples collected at 0, 3 and 7 h post chase (16). We observed that cells expressing the Vps35 D620N-GFP protein secreted the 50 kDa procathepsin D into the media at 7 h post chase (Figure 4C). This result is consistent with impaired trafficking of CIM6PR resulting in a deficiency of receptors at the TGN to interact with the pro-cathepsin D (14). Additionally, cells overexpressing the Vps35 D620N-GFP mutant, when compared to Vps35 WT-GFP protein, showed decreased levels of mature 20 kDa cathepsin D in cell lysates, further demonstrating impaired delivery of pro-cathepsin D to the late-endosome/lysosome for processing into the mature 20 kDa form. Taken together, these results show that even though the Vps35 D620N mutant retains its ability to bind CI-M6PR, cathepsin D, the soluble ligand of this receptor, is not processed efficiently resulting in secretion of the immature pro-cathepsin D from the cells. Vps35 D620N is associated with redistributed endosomes in PD patient fibroblasts Human dermal fibroblasts from a PD patient genotyped for the Vps35 D620N heterozygote point mutation were isolated and the subcellular localization of Vps35-positive endosomes and morphology of endocytic compartments was examined. By using indirect immunofluorescence to detect endogenous retromer subunits we detected a strong colocalization of Vps35 with Vps26A in both control and patient fibroblasts (Figure 5B). In PD patient fibroblasts we also observed a shift of Vps35positive endosomes to a perinuclear localization, in contrast to control fibroblasts where Vps35-positive endosomes showed a broader distribution throughout the cytoplasm (Figure 5A). Quantification of this phenotype using the distance-based methodology described above again showed a significant increase in the perinuclear intensity ratio in patient fibroblasts compared with control fibroblasts (Figure 5C). Subcellular localization of the Vps35-positive endosomes in fibroblasts was performed using endogenous markers as described above. Colocalization studies with EEA1, an Traffic 2014; 15: 230–244

A

B

C

Figure 5: Legend on the next page. 237

Follett et al.

early endosome marker, show an increased proportion of Vps35-positive punctate structures positive for the EEA1 in patient fibroblasts (R = 0.304) compared with the control (R = 0.209; Figure 5B). Further colocalization of Vps35 with LAMP1, a late endosome marker, showed a higher colocalization coefficient between Vps35 and LAMP1 in patient fibroblasts (R=0.274), compared with control (R = 0.197; Figure 5B). Interestingly, using both EEA1 and LAMP1 markers we also observed consistent evidence of enlarged redistributed endosomes, with LAMP1-positive endosomes showing consistent enlargement of the endosomal lumen (Figure 5A, LAMP1 panels). Investigation of p230, a TGN marker, in control and patient fibroblasts showed no change in colocalization between Vps35 and p230 positive structures (Figure 5B) and no morphological difference in p230 positive structures (Figure 5A, p230 panels). Taken together, these results confirm increased localization of Vps35 D620N mutant to both early and late endosomes and corroborate the ectopic studies above.

for 7 h we observed that the level of mature 20 kDa cathepsin D in patient fibroblasts decreased when compared with the fibroblasts from a control sample (Figure 6C). This is consistent with a reduction in the efficiency to transport newly synthesized pro-cathepsin D to the lysosome. However, we were unable to observe secretion of the pro-cathepsin D into the media presumably due to the lower level of cathepsin D expressed by these cells (data not shown). Using In-cell Western Assay (16), we observed no difference in the steady state levels of CI-M6PR between the normal and patient fibroblasts (data not shown). These results demonstrate a defect in trafficking of CI-M6PR in patient cells, resulting in processing disruption of cathepsin D into a mature form of this enzyme. These observations are consistent with those observed in the ectopic expression experiments performed above.

To determine if the presence of the Vps35 D620N mutation in patient fibroblasts impacted on the retromer mediated trafficking of CI-M6PR, we initially performed colocalization studies between endogenous Vps35 and CI-M6PR in control and patient fibroblasts. Within PD patient fibroblasts expressing Vps35 D620N, we observed an increase in the colocalization of CI-M6PR with Vps35 (R = 0.257) compared with that found in control cells (R = 0.203; Figure 6B), as well as a clear shift in CI-M6PR-positive endosomes into a more perinuclear subcellular localization (Figure 6A). We further examined the processing of CI-M6PR ligand, cathepsin D, using the cyclohexamide assay described previously. The fibroblasts from the patient displayed higher levels of mature cathepsin D at steady state when compared with the normal patient fibroblasts. After the inhibition of protein synthesis

Here we identified that the PD-linked Vps35 D620N mutation does not interfere with Vps35’s capacity to form high affinity interactions with Vps26A and Vps29, as evidenced by in vitro and cell-based assays. Ectopic expression of the Vps35 D620N protein in mammalian cells, as well as examination of fibroblasts isolated from a PD patient containing the D620N mutation in Vps35, demonstrated retromer association with enlarged endosomes that were concentrated to a perinuclear subcellular localization that also displayed evidence of retention of early and late endosome markers. Additionally, we demonstrate that even though Vps35 D620N-retromer interacts with its receptor cargo, CIM6PR, its expression caused the receptors subcellular distribution and function to be modified. In both the overexpression model and PD patient fibroblasts, the

Discussion

Figure 5: Parkinson’s disease Vps35 D620N patient fibroblasts have redistributed endosomes. A) The colocalization of endogenous Vps35 in subconfluent control and PD patient fibroblasts using antibodies against Vps26A, EEA1, p230 or LAMP1 was determined using indirect immunofluorescence. Cell monolayers were counterstained with DAPI. All images represent a 1 AU single slice captured using a Ziess LSM 710 Upright Scanning Laser confocal microscope at 63× magnification. Scale bar 5 μm. B) Quantification of colocalization analysis performed in (A). Graph represents the mean of two independent experiments with 10 images each (n = 2;*p < 0.05, Errors bars represent ±SEM). C) The intracellular distribution of Vps35 positive endosomes quantified using perinuclear intensity ratio in control and PD patient fibroblasts. Graph represents the mean of two independent experiments with 10 images each (n = 2;*p < 0.05, Error bars represent ±SEM). 238

Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

processing of cathepsin D, a CI-M6PR ligand, into the mature 20 kDa active form was markedly decreased in the presence of Vps35 D620N protein with resulting pro-cathepsin D secreted from the cells. Therefore, the expression of retromer incorporating the mutant Vps35 D620N protein induces a disruption of the normal trafficking itinerary of CI-M6PR.

of dextran via endocytosis supports their capacity to still interact with other endosomal compartments. The redistributed Vps35 D620N positive endosomes in both overexpression and fibroblast models had increased colocalization with EEA1 and LAMP1 relative to Vps35 WT. The retention of these markers is consistent with a defect in the endosomal maturation process (29), where the conversion between early and late endosome compartments may be underpinned by a failure of Vps35 D620N endosomes to mature at a constant rate, leading to the dilated endosome phenotype. The dysregulation of retromer itself and also a number of proteins that associate with retromer are known to cause a similar change in endosomes. For example, recruitment of retromer to the endosomal membranes has been reported to require the two RabGTPases, Rab5 and Rab7, acting in concert (19,30). The failure of Rab5 to dissociate from the membrane (29), overexpression of dominant-negative Rab5 and Rab7 (31) or depletion of the retromer cargo recognition complex have all been reported to result in increased endosome size (14), like the phenotype we observed when Vps35 D620N protein is expressed. In addition, recent studies demonstrate the importance of the WASH complex in maintaining endosome integrity and lumen size while linking vesicles and F-actin networks (32,33). The role of the WASH complex is largely focused on early or pre-endocytic compartments, however, it has also been described to associate with late endocytic structures (34,35). As retromer has been shown to interact directly with the WASH complex via the FAM21 subunit (33, 36–38), it is plausible that the dilated endosomes are a result of an inability of the Vps35 D620N to activate the WASH complex with high affinity resulting in a disruption of F-actin dependent cellular mechanisms including the formation of endosome derived tubular-vesicular transport vesicles. However, we find that Vps35 D620N retains a high level of colocalization (>85%) with endogenous FAM21, a WASH complex subunit, and co-immunoprecipitation indicates they can still interact (data not shown).

The redistributed, altered endosome structures positive for Vps35 D620N-GFP, represent a common phenotype observed with endosome dysfunction and neurodegeneration (28). Live cell imaging of these enlarged and redistributed endosomes demonstrated they are motile entities rather than static aggregates, and the delivery

The D620N mutation is within the region of Vps35 identified to bind CI-M6PR (14,26); however, our study shows that Vps35 D620N-containing retromer still has the capacity to directly interact with CI-M6PR. Therefore, the detection of the immature form of pro-cathepsin D in the medium of cells overexpressing Vps35 D620N

A

B

C

Figure 6: Cathepsin D processing is impaired in PD Vps35 D620N patient fibroblasts. A) Indirect immunofluorescence on subconfluent control and PD patient fibroblasts was performed using antibodies against Vps35, CI-M6PR and counterstained with DAPI. Images represent a 1 AU single slice captured using a Ziess LSM 710 Upright Scanning Laser confocal microscope. Scale bar 5 μm. B) Quantification of colocalization analysis performed in (A). Graph represents the mean of two independent experiments with 10 images each (n = 2;*p < 0.05, Error bars represent ±SEM). C) Monolayers of control and PD patient fibroblasts were pulsed with 100 μg/mL of cyclohexamide for 0, 3 and 7 h, when cells were lysed and analyzed by western immunoblotting using α-cathepsin D antibody.

Traffic 2014; 15: 230–244

239

Follett et al.

mutant and decreased amount of mature cathepsin D in the over-expression and human fibroblast models is not due to an inability of the Vps35 D620N protein to bind CI-M6PR. CI-M6PR was present in the altered retromer positive endosomes of cells expressing the Vps35 D620N mutation, suggesting the inability of the receptor to be efficiently transported from endosomes to the TGN. Therefore, the expression of the Vps35 D620N mutant may result in a reduced ability of this mutant to create transport vesicles from the endosome, leading to retention of retromer and cargo on the altered endosomes, not from an inability of Vps35 D620N retromer to engage its cargo. Interestingly, the defect in CI-M6PR trafficking that manifests in missorting of cathepsin D in the presence of Vps35 D620N mutation may have a direct correlation to the development and progression of PD as α-synuclein, a protein implicated in PD pathogenesis, has been identified as a cathepsin D target protein within the lysosomes (9–11). For example, overexpression of cathepsin D in dopaminergic cell cultures increases proteolysis of endogenous α-synuclein, while cathepsin D knockout mice show improper processing of α-synuclein in dopaminergic neurons that ultimately leads to α-synuclein cellular toxicity (39). Additionally, enzymatic inactivation of cathepsin D leads to signs of early onset, progressively fatal neurodegenerative disease in humans (40–42). This further supports the notion that the regulation of lysosomal proteolysis of α-synuclein is an important contributing factor in PD pathogenesis. Therefore, it is plausible that the molecular mechanisms that underpin the Vps35 D620N disease manifestation include altered trafficking of CIM6PR and its cargo, cathepsin D, ultimately leading to impaired degradation of proteins delivered to the lysosome, including α-synuclein and resulting in formation of Lewy bodies, a hallmark of PD. Overall, we have shown that PD-linked Vps35 D620N mutant causes a deficit in retromer-dependent trafficking of CI-M6PR, and its ligand cathepsin D, likely arising from the generation and redistribution of enlarged endosome compartments that retain retromer. The ability for this mutation to contribute to the pathogenesis of PD is likely secondary to these reported trafficking defects by reducing the breakdown of disease-associated proteins such as αsynuclein, in the late endosomal network. 240

Methods and Materials DNA constructs Full-length human Vps35 WT was amplified using a 5 primer CCCCTCGAGATGCCTACAACACAGCAG and 3 primer CCCGGATCCAGAA GGATGAGACCTTCATA and subcloned into pEGFP-N1 using BamH1 and XhoI. The D620N point mutation was generated using a Quikchange mutagenesis kit (Stratagene) using the following PCR mutagenic primer pair: 5 -GAAGATGAAATCAGTAATTCTAAAGCACAGCTG and 3 -CAGCTGTGCTTTCGAATTACTGATTTCATCTTC. Constructs for expression in Escherichia coli of mouse Vps35, Vps29 and Vps26A were described previously (43). The D620N point mutation within Vps35 inserted into pGEX4T-2 (GE Healthcare) was generated as described above for the human construct. The pCMU-CD8/CI-M6PR construct was described previously (16).

Antibodies Monoclonal mouse antibodies against human p230 and human EEA1 were purchased from BD Transduction Laboratories. Mouse monoclonal anti-CIM6PR, anti-LAMP1, goat polyclonal anti-Vps35 and rabbit polyclonal anti-Vps26A were purchased from Abcam. Mouse monoclonal anti-β-tubulin was purchased from Sigma Aldrich. Rabbit polyclonal antiFAM21C antibody was purchased from Millipore. Rabbit polyclonal anti-GFP was purchased from Life Technologies. Anti-cathepsin D antibody was purchased from Cell Signaling Technology. Anti-CD8 antibody was described previously (16). Phalloidin-fluorescent conjugates were purchased from Molecular Probes (Life technologies). Secondary donkey anti-rabbit IgG Alexa Fluor488, goat anti-mouse IgG Alexa Fluor568 and goat anti-mouse IgG Alexa Fluor647 were purchased from Life Technologies. Horse-radish peroxidase-conjugated swine anti-rabbit antibody was purchased from Dako. Dextran (MW 10 000 Da) conjugated to Alexa-647 was purchased from Life Technologies.

Protein purification and isothermal titration calorimetry (ITC) and circular dichroism (CD) spectroscopy Recombinant proteins used for the ITC experiments were prepared as previously described (43). All proteins were further purified by gel filtration chromatography using 20 mM Tris (pH 8.0), 200 mM NaCl, 1 mM dithiothreitol (ITC buffer). Isothermal titration calorimetry was carried out at 283 K using a MicroCal iTC200 (GE Healthcare), with 16 × 2.5 μL injections of 100 μM Vps29 into 10 μM Vps35, or 50 μM Vps26A into 5 μM Vps35. Integration of the titration curves was performed using the ORIGIN software (OriginLab) to extract thermodynamic parameters, stoichiometry N, equilibrium association constant K a (=1/K d ) and the binding enthalpy H. The Gibbs free energy of binding G was calculated from the relation G = −RTln(K a ) and the binding entropy S was deduced from the equation (G = H − TS). CD spectra were recorded on Jasco-810 spectropolarimeter (Jasco GmbH) at 0.01/cm optical path, 0.5 nm interval, 1 nm bandwidth and 50 nm/min scanning speed. Protein samples were set at 3 mg/mL in ITC buffer

Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

and their polarization spectra were recorded three times followed by averaging and background subtraction. The HT voltage was below 500 V

on ice until tissue dissociation. Samples were kept on ice for no longer than 24 h. Cell culture medium was aspirated and biopsy samples were

over the entire range of recording (200–250 nm).

washed a total of three times with 10 mL of room temperature PBS. Tissue were transferred into 6 cm sterile culture dishes containing pre-warmed culture medium and divided into pinhead-sized explants using a scalpel

Cell culture and transfection A431 and HEK293 cells were grown in a humidified 37◦ C incubator with 5% CO2 and maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine (Life Technologies). Fibroblast cells were grown in DMEM (Life Technologies) supplemented with 10% FBS and 2 mM L-glutamine. Cultures were maintained in T25 culture flasks and split at 1:4 throughout experimentation. Mammalian constructs were transfected into cells using LipofectAMINE 2000 (Life Technologies) according to manufacturer’s instructions.

Immunoprecipitations Cell monolayers were washed in ice-cold phosphate buffered saline (PBS) and lysed in TK lysis buffer (50 mM HEPES, 150 mM NaCl, 1% Triton X100, 10 mM Na4 P2 O7, 30 mM NaF, 2 mM Na3 VO4 , 10 mM EDTA, 0.5 mM AEBSF and Complete Mini protease inhibitor cocktail) for 10 min on ice. Cell lysates were centrifuged at 17 000 x g and supernatant incubated ◦

with GFP-NanoTrap beads (44) for 2 h at 4 C under constant rotation. Complexes were removed from the GFP-NanoTrap beads by boiling after three consecutive washes with TK lysis buffer.

Western blotting Protein lysates were resolved on SDS-PAGE and transferred onto a PVDF membrane (Immobilon-P and Immobilon-FL; Millipore) according to the manufacturer’s instructions. Western blotting using ECL and Odyssey infrared imaging system (LI-COR Biosciences) were performed as described previously (16).

blade. Using a 1 mL tuberculin syringe with a 23-G needle attached, one pinhead sized explant was placed into a 25 cm flask. Culture flasks were then placed in a 37◦ C, 5% CO2 humidified circulating incubator for 5–10 min allowing sufficient time for the explants to attach to the flask before adding pre-warmed culture medium. 5 mL of culture medium was added to the adhered cultures and returned to the 37◦ C, 5% CO2 incubator. Cultures were left to grow for a minimum of 72 h before being handled. On day 4, cultures were checked and those who displayed evidence of radial outgrowth from initial explants were supplemented with fresh medium and left for another 14–21 days with periodic medium changes before subculturing.

Microscopy of live cells A431 cells were plated in 35 mm glass bottom dishes (MatTek Corporation) 48 h prior to use and transfected with indicated GFP fusion Vps35 constructs. Dextran loading was performed as previously described (45). Briefly, dextran conjugated to Alexa-647 (MW 10 000 Da) (Life Technologies) at a final concentration of 100 μg/mL was loaded into the A431 cells by incubation at 37◦ C for 1 h in complete media. Cells were then washed to remove excess dextran and imaged in CO2 independent media supplemented with 10% FBS (Life Technologies). Time-lapse microscopy was performed by capturing 1 Airy Unit (1 AU) z-slices using 63× objective on Zeiss LSM 710 FCS Inverted Scanning Laser confocal microscope. Movies were edited using Image J 1.47f and still capture frames from the movies were edited using Adobe Photoshop.

Indirect immunoflourescence In-cell western assay for detection of endogenous CI-M6PR

A431 cells grown on coverslips were transiently transfected with mammalian constructs, fixed and stained with indicated antibodies as

Steady state of endogenous CI-M6PR was assessed using protocol described previously (16).

described previously (16). Coverslips were mounted using Fluorescent Mounting Medium (Dako) and imaging was performed using 63× objective on a Ziess LSM 710 Upright Scanning Laser confocal fluorescent

Patient data

microscope. Images represent a 1 AU z-plane single slice. All images were analyzed using Zeiss LSM 5.0 and Adobe Photoshop software.

An isolated skin biopsy was taken from a 73 year old European male PD patient previously genotyped for the Vps35 variant, D620N. The patient had a diagnosis of PD according to the UK Brian Bank clinical criteria and a self-reported age of symptom onset of 46 years. The single heterozygote point mutation in Exon 15 of the Vps35 gene leading to the D620N amino

Nocadazole treatment Cell monolayers were treated with 2 μM Nocadazole (Sigma-Aldrich) for 60 min in a humidified 37◦ C incubator with 5% CO2. Medium

acid change was confirmed by Sanger sequencing of DNA isolated from the cell line. Control human fibroblasts were isolated from a healthy, neurologically normal 44 year old male subject on no medication and

was aspirated and cells were washed three times in PBS prior to Paraformaldehyde fixation.

with no family history of PD.

Secretion assay

Establishment of skin biopsy cultures Isolated biopsy samples were placed in 50 mL conical flasks filled with cell

HEK293 cells were plated in 6-well dishes 48 h prior to use and transfected with GFP fusion constructs for 24 h. Cyclohexamide (final concentration 100 μg/mL, Sigma Aldrich) was diluted in serum-free

culture medium (DMEM: F12 supplemented with 10% FBS and stored

DMEM supplemented with 2 mM L-Glutamine (Life Technologies) and

Traffic 2014; 15: 230–244

241

Follett et al.

used throughout experimentation. Medium samples were collected at indicated times and analyzed using western blotting.

Quantification of the intracellular distribution of endosomes To quantify perinuclear/cytoplasmic localization, a macro was created in ImageJ* (version 1.47i). Two channels were utilized from each image: a DAPI channel to define the nuclear regions; and the protein of interest (POI) channel. A typical image contains 5 or 6 nuclei in the field of view.

Program Grant from Judith Jane Mason & Harold Stannett Williams Memorial Foundation (to AB) and Parkinson’s Queensland (to MM). RDT is supported by NHMRC Senior Research Fellowship (APP1041929) and BMC is supported by Australian Research Council Future Fellowship (FT100100027). Microscopy was carried out at the Australian Cancer Research Foundation (ACRF)/ Institute for Molecular Bioscience (IMB) Dynamic Imaging Facility for Cancer Biology. The authors thank Seetha Karunaratne, IMB, UQ, for generation of the full-length human Vps35 WT used throughout this project.

First, the nuclear image was converted to a binary mask to define the nuclear regions using an auto-threshold algorithm. Nuclei touching the

Supporting Information

edge of the image were excluded from further analysis. A perinuclear region around the nuclei was then defined as follows. The nuclear mask regions selected were expanded by a distance of 40 pixels (corresponding

Additional Supporting Information may be found in the online version of this article:

to a distance of 1.5 μm). Removing the nuclear region from this expanded region selection then gave an annular region around, but not including, each nucleus. The average intensity in the POI channel of the union of all the perinuclear annuli regions was then recorded. To select a region more distant from the nuclei, a similar process was used: the nuclear mask regions were expanded by 80 pixels (corresponding to 3.0 μm) and a region obtained by expanding the nuclear regions by 40 pixels subtracted from it. The effect was to generate an annulus adjacent to the perinuclear annuli but more distant from the nuclei, i.e., a cytoplasmic region. In the POI channel, the average intensity across the union of these ‘cytoplasmic’ regions was then recorded for the image. Finally, for comparison between images and experiments, the ratio of the so calculated average perinuclear intensity to the average cytoplasmic region intensity was recorded. The script was fully automated with the only user interaction required being the selection of the directory containing the images to be quantified. The macro is available in Figure S1.

Figure S1: Quantification of peri-nuclear and cytoplasmic protein. To quantify perinuclear/cytoplasmic localization, a macro was created in ImageJ* (version 1.47i). The macro is fully automated with the only user interaction required being the selection of the directory containing the images to be quantified. Two channels are utilized by the script from each image: a DAPI channel to define the nuclear regions (blue channel); and the protein of interest (POI) channel (green channel). For each image, the ratio of total protein found in the perinuclear to cytoplasmic regions (as defined by distance from the nuclei in the images) is then calculated and recorded in an Excel file. See Materials and Methods for details of the quantification process. Movie S1: Vps35 WT-GFP positive endosomes are mobile and found throughout the cytoplasm. Details in Figure legend 2A. Movie S2: Vps35 D620N-GFP positive endosomes are enlarged and redistributed to a perinuclear localization but retain ability to receive endocytosed material. Details in Figure legend 2A.

Colocalization analysis Immunoflourescence images (1 AU slices) were captured using a Ziess LSM 710 Upright Scanning Laser confocal fluorescent microscope under 63× magnification using identical laser power, light pathways and band passes. Captured images were analyzed using Image J Version J 1.47 f. Multi-channel images were split into corresponding grey-scale format and threshold settings were applied to each individual channel. Under these conditions colocalization was quantified using the Image J plug-in, Colocalization finder (U.S. National Institutes of Health; http://rsb.info.nih.gov/ij/plugins/colocalization-finder.html, 46). Raw data representing colocalization coefficient was analyzed using GraphPad Prism 5 software version 5.03. Graphs represent a global average of data collected.

Acknowledgments This work was supported by funding from the National Health and Medical Research Council (NHMRC) of Australia (APP511072, APP631584, APP1025538, APP1042082, APP1010225), Australian Research Council (DP120103930), ANZ Trustees National Medical

242

References 1. Pountney DL, Treweek TM, Chataway T, Huang Y, Chegini F, Blumbergs PC, Raftery MJ, Gai WP. αB-Crystallin is a major component of glial cytoplasmic inclusions in multiple system atrophy. Neurotox Res 2005;7:77–85. 2. Auluck PK, Chan HYE, Trojanowski JQ, Lee VM-Y, Bonini NM. Chaperone suppression of α-synuclein toxicity in a Drosophila model for Parkinson’s disease. Science 2002;295:865–868. ´ K, Fukushima H, Masliah E, Xia Y, Iwai A, Yoshimoto M, Otero 3. Ueda DA, Kondo J, Ihara Y, Saitoh T. Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease. Proc Natl Acad Sci 1993;90:11282–11286. 4. Han H, Weinreb PH, Lansbury PT Jr. The core Alzheimer’s peptide NAC forms amyloid fibrils which seed and are seeded by β-amyloid: is NAC a common trigger or target in neurodegenerative disease? Chem Biol 1995;2:163–169. 5. Langston J, Ballard P, Tetrud J, Irwin I. Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science 1983;219:979–980.

Traffic 2014; 15: 230–244

Parkinson’s Disease Causing Mutation Alters Retromer’s Function

6. Dawson TM, Ko HS, Dawson VL. Genetic animal models of Parkinson’s disease. Neuron 2010;66:646–661. 7. Exner N, Lutz AK, Haass C, Winklhofer KF. Mitochondrial dysfunction in Parkinson’s disease: molecular mechanisms and pathophysiological consequences. EMBO J 2012;31:3038–3062. 8. Cuervo AM, Stefanis L, Fredenburg R, Lansbury PT, Sulzer D. Impaired degradation of mutant α-Synuclein by chaperone-mediated autophagy. Science 2004;305:1292–1295. 9. Hossain S, Alim A, Takeda K, Kaji H, Shinoda T, Ueda K. Limited proteolysis of NACP/alpha-synuclein. J Alzheimers Dis 2001;3:577–584. 10. Sevlever D, Jiang P, Yen SH. Cathepsin D is the main lysosomal enzyme involved in the degradation of alpha-synuclein and generation of its carboxy-terminally truncated species. Biochemistry 2008;47:9678–9687. 11. Qiao L, Hamamichi S, Caldwell K, Caldwell G, Yacoubian T, Wilson S, Xie Z-L, Speake L, Parks R, Crabtree D, Liang Q, Crimmins S, Schneider L, Uchiyama Y, Iwatsubo T, et al. Lysosomal enzyme cathepsin D protects against alpha-synuclein aggregation and toxicity. Mol Brain 2008;1:17. 12. Seaman MN. The retromer complex – endosomal protein recycling and beyond. J Cell Sci 2012;125:4693–4702. 13. Seaman MN. Identification of a novel conserved sorting motif required for retromer-mediated endosome-to-TGN retrieval. J Cell Sci 2007;120:2378–2389. 14. Arighi CN, Hartnell LM, Aguilar RC, Haft CR, Bonifacino JS. Role of the mammalian retromer in sorting of the cation-independent mannose 6-phosphate receptor. J Cell Biol 2004;165:123–133. 15. Choy RW-Y, Cheng Z, Schekman R. Amyloid precursor protein (APP) traffics from the cell surface via endosomes for amyloid β (Aβ) production in the trans-Golgi network. Proc Natl Acad Sci 2012;109:E2077–E2082. 16. Bugarcic A, Zhe Y, Kerr MC, Griffin J, Collins BM, Teasdale RD. Vps26A and Vps26B subunits define distinct retromer complexes. Traffic 2011;12:1759–1773. 17. Gieselmann V, Hasilik A, von Figura K. Processing of human cathepsin D in lysosomes in vitro. J Biol Chem 1985;260:3215–3220. 18. Seaman MNJ. Cargo-selective endosomal sorting for retrieval to the Golgi requires retromer. J Cell Biol 2004;165:111–122. 19. Rojas R, van Vlijmen T, Mardones GA, Prabhu Y, Rojas AL, Mohammed S, Heck AJR, Raposo G, van der Sluijs P, Bonifacino JS. Regulation of retromer recruitment to endosomes by sequential action of Rab5 and Rab7. J Cell Biol 2008;183:513–526. ´ 20. Laurent-Matha V, Derocq D, Prebois C, Katunuma N, Liaudet-Coopman E. Processing of human cathepsin D is independent of its catalytic function and auto-activation: involvement of cathepsins L and B. J Biochem 2006;139:363–371. 21. Lesage S, Condroyer C, Klebe S, Honore A, Tison F, Brefel-Courbon C, Durr A, Brice A. Identification of VPS35 mutations replicated in French families with Parkinson disease. Neurology 2012;78:1449–1450. 22. Ando M, Funayama M, Li Y, Kashihara K, Murakami Y, Ishizu N, Toyoda C, Noguchi K, Hashimoto T, Nakano N, Sasaki R, Kokubo Y, Kuzuhara S, Ogaki K, Yamashita C, et al. VPS35 mutation in Japanese

Traffic 2014; 15: 230–244

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33. 34.

35.

patients with typical Parkinson’s disease. Mov Disord 2012;27:1413–1417. Zimprich A, Benet-Pagès A, Struhal W, Graf E, Eck Sebastian H, Offman Marc N, Haubenberger D, Spielberger S, Schulte Eva C, Lichtner P, Rossle Shaila C, Klopp N, Wolf E, Seppi K, Pirker W, et al. A mutation in VPS35, encoding a subunit of the retromer complex, causes late-onset Parkinson disease. Am J Hum Genet 2011;89:168–175. Zhang Y, Chen S, Xiao Q, Cao L, Liu J, Rong T-Y, Ma J-F, Wang G, Wang Y, Chen S-D. Vacuolar protein sorting 35 Asp620Asn mutation is rare in the ethnic Chinese population with Parkinson’s disease. Parkinsonism Relat Disord 2012;18:638–640. Sharma M, Ioannidis JPA, Aasly JO, Annesi G, Brice A, Bertram L, Bozi M, Barcikowska M, Crosiers D, Clarke CE, Facheris MF, Farrer M, Garraux G, Gispert S, Auburger G, et al. A multi-centre clinico-genetic analysis of the VPS35 gene in Parkinson disease indicates reduced penetrance for disease-associated variants. J Med Genet 2012;49:721–726. Hierro A, Rojas AL, Rojas R, Murthy N, Effantin G, Kajava AV, Steven AC, Bonifacino JS, Hurley JH. Functional architecture of the retromer cargo-recognition complex. Nature 2007;449:1063–1067. Roberts RL, Barbieri MA, Pryse KM, Chua M, Morisaki JH, Stahl PD. Endosome fusion in living cells overexpressing GFP-rab5. J Cell Sci 1999;112:3667–3675. Cataldo AM, Peterhoff CM, Troncoso JC, Gomez-Isla T, Hyman BT, Nixon RA. Endocytic pathway abnormalities precede amyloid beta deposition in sporadic Alzheimer’s disease and Down syndrome: differential effects of APOE genotype and presenilin mutations. Am J Pathol 2000;157:277–286. Rink J, Ghigo E, Kalaidzidis Y, Zerial M. Rab conversion as a mechanism of progression from early to late endosomes. Cell 2005;122:735–749. Seaman MN, Harbour ME, Tattersall D, Read E, Bright N. Membrane recruitment of the cargo-selective retromer subcomplex is catalysed by the small GTPase Rab7 and inhibited by the Rab-GAP TBC1D5. J Cell Sci 2009;122:2371–2382. Jager S, Bucci C, Tanida I, Ueno T, Kominami E, Saftig P, Eskelinen EL. Role for Rab7 in maturation of late autophagic vacuoles. J Cell Sci 2004;117:4837–4848. Gomez TS, Gorman JA, de Narvajas AA, Koenig AO, Billadeau DD. Trafficking defects in WASH-knockout fibroblasts originate from collapsed endosomal and lysosomal networks. Mol Biol Cell 2012;23:3215–3228. Gomez TS, Billadeau DD. A FAM21-containing WASH complex regulates retromer-dependent sorting. Dev Cell 2009;17:699–711. Derivery E, Sousa C, Gautier JJ, Lombard B, Loew D, Gautreau A. The Arp2/3 activator WASH controls the fission of endosomes through a large multiprotein complex. Dev Cell 2009;17:712–723. Zech T, Calaminus SD, Caswell P, Spence HJ, Carnell M, Insall RH, Norman J, Machesky LM. The Arp2/3 activator WASH regulates alpha5beta1-integrin-mediated invasive migration. J Cell Sci 2011;124:3753–3759.

243

Follett et al.

36. Harbour ME, Breusegem SY, Seaman MNJ. Recruitment of the endosomal WASH complex is mediated by the extended ‘tail’ of Fam21 binding to the retromer protein Vps35. Biochem J 2012;442:209–220. 37. Jia D, Gomez TS, Metlagel Z, Umetani J, Otwinowski Z, Rosen MK, Billadeau DD. WASH and WAVE actin regulators of the Wiskott–Aldrich syndrome protein (WASP) family are controlled by analogous structurally related complexes. Proc Natl Acad Sci 2010;107:10442–10447. 38. Steinberg F, Gallon M, Winfield M, Thomas EC, Bell AJ, Heesom KJ, Tavare JM, Cullen PJ. A global analysis of SNX27-retromer assembly and cargo specificity reveals a function in glucose and metal ion transport. Nat Cell Biol 2013;15:461–471. 39. Cullen V, Lindfors M, Ng J, Paetau A, Swinton E, Kolodziej P, Boston H, Saftig P, Woulfe J, Feany MB, Myllykangas L, Schlossmacher MG, Tyynela J. Cathepsin D expression level affects alpha-synuclein processing, aggregation, and toxicity in vivo. Mol Brain 2009;2:1756–6606. 40. Siintola E, Partanen S, Stromme P, Haapanen A, Haltia M, Maehlen J, Lehesjoki AE, Tyynela J. Cathepsin D deficiency underlies congenital human neuronal ceroid-lipofuscinosis. Brain 2006;129:1438–1445.

244

41. Tyynela J, Sohar I, Sleat DE, Gin RM, Donnelly RJ, Baumann M, Haltia M, Lobel P. A mutation in the ovine cathepsin D gene causes a congenital lysosomal storage disease with profound neurodegeneration. EMBO J 2000;19:2786–2792. 42. Koike M, Nakanishi H, Saftig P, Ezaki J, Isahara K, Ohsawa Y, Schulz-Schaeffer W, Watanabe T, Waguri S, Kametaka S, Shibata M, Yamamoto K, Kominami E, Peters C, von Figura K, et al. Cathepsin D deficiency induces lysosomal storage with ceroid lipofuscin in mouse CNS neurons. J Neurosci 2000;20:6898–6906. 43. Norwood SJ, Shaw DJ, Cowieson NP, Owen DJ, Teasdale RD, Collins BM. Assembly and solution structure of the core retromer protein complex. Traffic 2011;12:56–71. 44. Kubala MH, Kovtun O, Alexandrov K, Collins BM. Structural and thermodynamic analysis of the GFP:GFP-nanobody complex. Protein Sci 2010;19:2389–2401. 45. Kerr MC, Wang JTH, Castro NA, Hamilton NA, Town L, Brown DL, Meunier FA, Brown NF, Stow JL, Teasdale RD. Inhibition of the PtdIns(5) kinase PIKfyve disrupts intracellular replication of Salmonella. EMBO J 2010;29:1331–1347. 46. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 2012;9:671–675.

Traffic 2014; 15: 230–244