ORIGINAL

RESEARCH

The Vitamin D Receptor Is Required for Activation of cWnt and Hedgehog Signaling in Keratinocytes Thomas S. Lisse,* Vaibhav Saini,* Hengguang Zhao, Hilary F. Luderer, Francesca Gori, and Marie B. Demay Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114

Alopecia (hair loss) in vitamin D receptor (VDR)-null mice is due to absence of ligand-independent actions of the VDR that are required for initiation of postmorphogenic hair cycles. Investigations were undertaken to determine whether the VDR is required for the induction of signaling pathways that play an important role in this process. The induction of cWnt and hedgehog target genes that characterizes early anagen was found to be dramatically attenuated in VDR⫺/⫺ mice, relative to wild-type (WT) mice. To determine whether this reflects impaired responsiveness to cWnt ligands, in vitro studies were performed in primary keratinocytes. These studies demonstrated impaired induction of cWnt target genes in response to Wnt3a in VDR⫺/⫺ keratinocytes, relative to wild-type keratinocytes. Chromatin immunoprecipitation analyses revealed that the VDR was recruited to the regulatory regions of cWnt and hedgehog target genes in WT keratinocytes but not in VDR⫺/⫺ or Lef1⫺/⫺ keratinocytes. Lef1 was enriched on these same regulatory regions in WT keratinocytes but not in VDR⫺/⫺ keratinocytes. In vivo studies were performed to determine whether activation of the hedgehog pathway could bypass the defect in cWnt signaling observed in the absence of the unliganded VDR. In WT, but not VDR⫺/⫺, mice, hedgehog agonist treatment resulted in an induction of cWnt and hedgehog target genes and the generation of mature anagen hair follicles. Thus, these studies demonstrate that the unliganded VDR interacts with regulatory regions in the cWnt and hedgehog target genes and is required for the induction of these pathways during the postnatal hair cycle. (Molecular Endocrinology 28: 1698 –1706, 2014)

umans and mice with loss-of-function mutations in the vitamin D receptor (VDR) develop alopecia (hair loss) (1). Although VDR ablation does not impair hair morphogenesis, VDR⫺/⫺ mice exhibit absence of postmorphogenic hair cycles. This lack of postmorphogenic hair cycles in the VDR⫺/⫺ mice is due to impaired ligandindependent actions of the VDR in keratinocytes, the epithelial component of the hair follicle (2). There are three major phases of the hair cycle: anagen, during which the epidermal component of the hair follicle below the sebaceous gland is regenerated by cells originating from the bulge region stem cell compartment, leading to the formation of a hair shaft; catagen, during which the lower

H

part of the hair follicle undergoes apoptosis, resulting in approximation of the mesodermal dermal papilla and the bulge; and telogen, during which signals from the dermal papilla are thought to activate bulge stem cells to initiate a new hair cycle (3). Activation of the canonical Wnt (cWnt) and hedgehog signaling pathways is required for induction of the hair cycle (4 –7). Ligands of the cWnt signaling pathway and their inhibitors maintain the self-renewal and lineage progression of stem cells in an autocrine manner (8). In the absence of functional ␤-catenin, keratinocyte stem cells fail to differentiate into follicular keratinocytes and form epithelial cysts (9, 10). Similarly, interfering with the ac-

ISSN Print 0888-8809 ISSN Online 1944-9917 Printed in U.S.A. Copyright © 2014 by the Endocrine Society Received February 5, 2014. Accepted August 26, 2014. First Published Online September 2, 2014

* T.S.L. and V.S. contributed equally to this work. Abbreviations: BrdU, 5-bromo-2⬘-deoxyuridine; ChIP, chromatin immunoprecipitation; CM, conditioned medium; cWnt, canonical Wnt; HH, hedgehog; ISH, in situ hybridization; Lef1, lymphoid enhancer factor 1; Shh, sonic hedgehog; VDR, vitamin D receptor; VDRE, vitamin D-responsive element; WT, wild type.

1698

mend.endojournals.org

Mol Endocrinol, October 2014, 28(10):1698 –1706

doi: 10.1210/me.2014-1043

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

doi: 10.1210/me.2014-1043

tions of lymphoid enhancer factor 1 (Lef1), by keratinocyte-specific expression of a dominant negative Lef1 transgene, leads to alopecia and lipid-laden dermal cysts, a phenotype reminiscent of VDR⫺/⫺ mice (11). The hedgehog (HH) pathway also plays a role in the hair follicle. In addition to being a target of cWnt signaling during morphogenesis, sonic hedgehog (Shh) is induced by activation of cWnt signaling at the onset of anagen during postnatal hair cycles (12). Hair follicle development is disrupted in the absence of Shh (4, 13), whereas overexpression postnatally induces anagen (14 – 17). Blocking HH signaling prevents the consequences of cWnt signaling, providing further evidence that the HH pathway is a target of cWnt signaling (18). Glioblastoma 1, a downstream effector of Shh signaling, induces Wnts and interacts with them functionally, demonstrating a potential positive feedback loop, in addition to synergistic interactions between these two pathways (19). The cooperative transcriptional effects of ␤-catenin and Lef1 are attenuated in keratinocytes isolated from VDR⫺/⫺ mice (20) as is the expression of cWnt and hedgehog target genes (21), suggesting that absence of the unliganded VDR impairs cWnt signaling in these cells. Constitutive activation of ␤-catenin does not rescue the hair cycle defect observed in VDR⫺/⫺ mice (20). However, the unliganded VDR immunoprecipitates Lef1, not ␤-catenin, in primary keratinocytes (21), suggesting that VDR-Lef1 interactions may be the mechanism by which the unliganded VDR promotes cWnt signaling in these cells. Based on these observations, studies were undertaken to identify a role for the unliganded VDR in the activation of the cWnt and HH signaling pathways. In vitro analyses were performed in primary murine epidermal keratinocytes, which share a common lineage with keratinocyte stem cells. To determine the relevance of this in vitro model system on gene activation during the hair cycle, complementary in vivo analyses were performed.

Materials and Methods Animal maintenance Animal studies were approved by the institutional animal care committee. Mice were maintained in a virus- and parasitefree facility under a 12-hour light, 12-hour dark cycle. VDR-null mice (22) were fed a 2% calcium, 1.25% phosphorus, 20% lactose diet to prevent abnormalities in mineral ion homeostasis (Harlan Teklad; TD96348). The fur was depilated to induce anagen (23) or shaved to remove visible hair, allowing evaluation of the effect of ligand on hair growth in the absence of an anagen initiating stimulus. Smoothened agonist (150 ␮M; Calbiochem; 566660) or vehicle (5% dimethylsulfoxide, 95% acetone) was administered topically on a daily basis. Mice were injected ip with 5-bromo-2⬘-deoxyuridine (BrdU)/5-fluorode-

mend.endojournals.org

1699

oxyuridine (0.25 mg/0.03 mg/g; Sigma-Aldrich) 2 hours prior to the time that the animals were killed. Lef1 heterozygous mice (22) were crossed to yield homozygous offspring for keratinocyte preparations.

Cell culture Neonatal keratinocytes were isolated and cultured as previously described (2). LWnt3A and Swiss 3T3 cell lines were obtained from American Type Culture Collection and used to collect Wnt3A and control conditioned medium, respectively.

Chromatin immunoprecipitation (ChIP) Chromatin from primary keratinocytes was cross-linked with 1% formaldehyde and isolated using a ChIP assay kit (Millipore; 17295) according to the manufacturer’s protocol. Chromatin was sheared by sonication and immunoprecipitated with 10 ␮g ␣-VDR or ␣-Lef1 (Santa Cruz Biotechnology; VDR, sc1008X; Lef1, sc-8591X). Quantitative real-time PCR was performed (Applied Biosystems) to evaluate the enrichment of the VDR and Lef1 in regulatory regions of gli1 (21), cMyc (24) , Axin 2 (forward, GGTACTTACAAGGGGGTGAGG; reverse, ATGGTGGGTTGTAAGCTGGA) and osteocalcin (forward, CTTATGGAGGCATTTTCTC; reverse, TTCAGTGTCTGCCCCTGA). Primers amplifying a control coding region (25) were used to normalize for DNA content and to calculate the relative enrichment of the regulatory region to coding region sequences according to the formula of Livak and Schmittgen (26) using a method identical to that used to normalize the levels of RNA of interest to those of actin. Fold enrichment reflects the ratio of regulatory to coding region sequences in the immunoprecipitated vs input samples. To evaluate the effect of ligand, cells were pretreated with 10⫺8 M 1,25-dihydroxyvitamin D. For re-ChIP studies, chromatin from primary keratinocytes isolated from mice expressing a VDR transgene (27) was immunoprecipitated with ␣-VDR and the resultant chromatin reprecipitated with ␣-Lef1.

Immunohistochemistry and in situ hybridization Proliferating cells were identified using a BrdU staining kit (Invitrogen) according to the manufacturer’s instructions. SHH immunohistochemistry was performed using ␣-SHH (1:200; EMD Millipore; 06 –1106) and signal amplification (tyramide signal amplification; PerkinElmer). The Shh, Gli1, and Axin2 cDNAs were used as templates for transcription of [␣-35S]uridine 5-triphosphate untranslated-labeled RNA probes for in situ hybridization analysis as previously described (28). The percentage of hair follicles with proliferating cells below the bulge in SAG treated VDR⫺/⫺ mice was determined by counting hair follicles from three hematoxylin and eosin-stained slides spaced greater than 84 ␮m apart from three mice per condition.

Evaluation of gene expression Total RNA was extracted using the RNeasy Plus minikit (QIAGEN) according to the manufacturer’s protocol. RNA was reversed transcribed using Superscript II reverse transcriptase (Invitrogen). Quantitative real-time PCR was performed using primers designed to span introns. Target gene expression was normalized to actin mRNA in the same sample, and relative gene expression was calculated using the method of Livak and Schmittgen (26).

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

1700

Lisse et al

VDR Regulates HH and cWnt Signaling

Statistics and data analysis Statistical significance was determined using a Student’s t test.

Results VDR ablation impairs induction of cWnt and Hedgehog target genes during anagen initiation To address whether the failure of anagen initiation in VDR⫺/⫺ (VDR null) animals is associated with impaired cWnt and Shh target gene induction, anagen was induced by depilation in day 18 wild-type (WT) and VDR⫺/⫺ mice. Depilation results in the induction of genes associated with early anagen within 1–3 days (29). In WT animals, depilation led to a significant increase in the expression of the hedgehog target genes Shh, Gli1, and Ptc2 3 days after anagen initiation (Figure 1A). This was accompanied by an increase in the expression of the cWnt target gene Msx2, which has been shown to play a role in maintaining anagen [Figure 1B (30)]. Consistent with its cyclic expression during the hair cycle (30), Msx2 mRNA levels returned to baseline by day 5 in WT mice. Induction of cWnt antagonists and target genes, Dkk1 and Wif1, was also observed. These targets genes are inhibitors of the cWnt signaling pathway forming a classic feedback loop. Expression of Wif1, which has not been shown to regulate the hair cycle, remained elevated at day 5. However, that of Dkk1, which has been shown to block anagen and initiate premature catagen (22), was significantly decreased by day 5. None of these cWnt and Shh target genes were induced in the skin of VDR⫺/⫺ mice at any of the time points examined. In situ hybridization (ISH) performed to identify the cellular source of these transcripts revealed that the cells expressing Shh reside in the secondary germ region of the hair follicle, below the sebaceous gland and adjacent to the bulge, in WT mice (Figure 1C). Anagen induction also led to expression of Gli1 and the classic cWnt target gene, Axin2, in this region in WT mice. In VDR⫺/⫺ mice, ISH studies failed to detect Axin2, Gli1, or Shh expression in the hair follicle, although Axin2 was well expressed in the epidermis. To address whether this phenotype is due to impaired responsiveness of VDR⫺/⫺ keratinocytes to cWnt agonists, primary keratinocytes from WT and VDR⫺/⫺ mice were treated with Wnt3a conditioned medium (CM). In WT keratinocytes, Wnt3a CM induced Axin2 and Gli1 mRNA by 3 hours. This induction was attenuated in VDR⫺/⫺ keratinocytes at both 3 and 6 hours (Figure 1D).

Mol Endocrinol, October 2014, 28(10):1698 –1706

The VDR and Lef1 bind to regulatory regions of cWnt and hedgehog target genes in primary keratinocytes The VDR has been shown to physically interact with Lef1 (21). ChIP studies in VDR⫺/⫺ keratinocytes reveal recruitment of the transfected unliganded VDR to regulatory sequences in the hedgehog target genes, Shh and Gli1. To determine whether the endogenous VDR and Lef1 interact with regulatory sequences in cWnt and Shh target genes in primary keratinocytes, ChIP experiments were performed (Figure 2). In chromatin isolated from WT keratinocytes, the VDR was significantly enriched at regulatory regions of the Axin2 and Gli1 genes (Figure 2A). The VDR was also found to be enriched at the TCF/ Lef site of the classic cWnt target gene, cMYC (24) as well as on the osteocalcin vitamin D-responsive element (VDRE) (31). VDR occupancy on these sites was not significantly altered by ligand pretreatment (data not shown). In VDR⫺/⫺ cells there was no enrichment of the VDR at any site. To determine whether Lef1 is required for VDR occupancy at the Axin2 and Gli2 regulatory sites, ChIP assays were performed using chromatin isolated from Lef1⫺/⫺ keratinocytes. The absence of Lef1 abolished VDR enrichment on Axin2, Gli1, and cMYC regulatory sequences (Figure 2A). However, VDR occupancy at the osteocalcin VDRE was preserved, demonstrating that Lef1 is not required for VDR interactions at this classic VDRE. To determine whether Lef1 interacts with the same regulatory regions in the Gli1, Axin2, and cMYC genes as the VDR, ChIP experiments were performed with a Lef1 antibody (Figure 2B). Lef1 was significantly enriched on the same regions found to recruit the VDR in chromatin isolated from WT keratinocytes. However, Lef1 ChIP performed with chromatin isolated from VDR⫺/⫺ keratinocytes showed no enrichment at these regulatory sites. To confirm co-occupancy of the VDR and Lef1 on these regulatory regions, chromatin immunoprecipitated with ␣-VDR was reimmunoprecipitated with ␣-Lef1. These studies confirmed co-occupancy of Lef1 and the VDR on Axin2 and cMyc regulatory sequences. However, they suggested that VDR occupancy prevented Lef1 interactions with Gli1 regulatory regions or that these two transcription factors bind to nearby but nonoverlapping sites (Figure 2C). Impaired smoothened agonist induction of cWnt and hedgehog target genes in VDRⴚ/ⴚ mice in vivo Activation of the hedgehog pathway has been shown to promote hair growth in VDR⫺/⫺ mice (16), suggesting that activation of hedgehog signaling downstream of

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

doi: 10.1210/me.2014-1043

mend.endojournals.org

1701

Figure 1. VDR ablation impairs induction of cWnt and Hedgehog target genes during anagen initiation. Anagen was induced in the dorsal skin of day 18 mice by wax depilation. Quantitative RT-PCR analyses were performed on samples harvested 0, 1, 2, 3, and 5 days after depilation. A, Analyses of Shh target genes. B, Analyses of cWnt target genes. Data represent the mean ⫾ SEM of data obtained from three mice per genotype and time point. *, P ⬍ .005, **, P ⬍ .001 by Student t test. C, ISH performed on skin isolated 3 days after the anagen induction. Hematoxylin and eosin-stained section on the left demonstrates the location of the epidermis and the sebaceous glands of the hair follicles (black arrows). Dark-field image of the ISH demonstrates the expression of Shh, Gli1, and Axin2 in the region below the sebaceous gland in the WT but not the VDR⫺/⫺ sections. White arrowhead demonstrates Axin2 expression in the epidermis of VDR⫺/⫺ mice. Data are based on samples obtained from three mice for each genotype and time point. D, Impaired activation of cWnt signaling primary keratinocytes from in VDR⫺/⫺ mice. Primary keratinocytes were treated with Wnt3a or control CM for the times indicated. Quantitative RT-PCR analyses were performed to evaluate the RNA expression. Data represent mean ⫾ SEM of data obtained from three to four keratinocyte preparations per genotype. *, P ⬍ .05, **, P ⬍ .01 by Student t test. D, day.

cWnt signaling may bypass the defect in anagen initiation in VDR⫺/⫺ mice. To address whether this induction of hair growth is associated with the induction of cWnt and

Shh target genes characteristic of anagen, WT and VDR⫺/⫺ mice were treated topically with the Shh agonist, SAG, from day 16 to 22, a time at which the hair follicles

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

1702

Lisse et al

VDR Regulates HH and cWnt Signaling

Figure 2. The VDR and Lef1 bind to regulatory regions of cWnt and hedgehog target genes in primary keratinocytes. A, ChIP analyses were performed with ␣-VDR antibody using chromatin isolated from WT, VDR⫺/⫺, and Lef1⫺/⫺ primary keratinocytes. B, ChIP analyses were performed with ␣-Lef1 antibody using chromatin isolated from WT and VDR⫺/⫺ primary keratinocytes. C, ChIP/re-Chip experiments performed with ␣VDR followed by ␣-Lef1. Fold enrichment determined by quantitative PCR reflects the ratio of the regulatory to negative control region sequences in the immunoprecipitated vs the input samples. Data represent mean ⫾ SEM of data obtained from three to five independent chromatin preparations. *, P ⬍ .05, **, P ⬍ .01 by Student t test.

are in the first telogen phase and the cutaneous phenotype of the VDR⫺/⫺ and WT mice are histologically indistinguishable (Figure 3, A and C). Neither WT nor VDR⫺/⫺ mice demonstrated hair growth in response to SAG on gross examination. In WT mice, SAG increased the number of proliferating cells in the region of the hair follicle below the sebaceous gland but did not lead to mature anagen follicles (Figure 3, A and B). As previously reported, depilation of WT mice led to generation of mature anagen hair follicles within this time period (2) (data not shown). Neither SAG nor depilation increased the number of proliferating follicle keratinocytes below the bulge or formation of mature anagen hair follicles in VDR⫺/⫺ mice (Figure 3, C and D, data not shown). Evaluation of gene expression demonstrated induction of cWnt and hedgehog target genes by SAG in WT but not VDR⫺/⫺ mice (Figure 3E). Depilation resulted in a significant increase in the expression of cWnt and Shh target genes in WT mice compared with SAG treatment alone, whereas no gene induction was observed after depilation in VDR⫺/⫺ mice. Because the first postmorphogenic anagen begins between 3 and 4 weeks of age, the effects of prolonged SAG treatment could not be disassociated from the molecular and histological changes that accompany this normal

Mol Endocrinol, October 2014, 28(10):1698 –1706

anagen phase. Therefore, investigations were performed in 7-week-old mice, the age of onset of a prolonged resting (telogen) phase. Mice were treated for 9 days with SAG or vehicle, and tissues were harvested 3 days after treatment. Under these conditions, SAG treatment of shaved WT or VDR⫺/⫺ mice did not lead to a proliferative response of keratinocytes below the bulge of the hair follicle (data not shown). Evaluation of gene expression demonstrated induction of Dkk1 and Shh mRNA in the SAG-treated skin of WT mice (Figure 4A). SAG treatment failed to induce Wif1, Dkk1, Gli1, or Ptc2 mRNA expression in the skin of VDR⫺/⫺ mice, however, led to a marked induction of Shh mRNA expression. To identify the cells expressing SHH, immunohistochemical analyses were performed. In WT mice, SHH immunoreactivity was localized to the outer root sheath of hair follicles in SAG treated skin (Figure 4B) as well as in depilated skin (data not shown). In VDR⫺/⫺ mice, SHH was not detected in the hair follicles but was localized to the dermal cysts in SAG treated skin. SAG also led to proliferation of the cells lining these dermal cysts and an increase in the thickness of the cell layer lining the cyst walls. To determine whether the gene expression profile observed in the SAG treated WT skin reflected early anagen, the skin phenotype was analyzed 11 days after the SAG treatment (Figure 4, C–I). These studies revealed that SAG led to the generation of mature anagen follicles with hair shaft formation in WT mice (Figure 4D), accompanied by an increase in proliferating cells below the hair follicle bulge. A similar response was observed after depilation of WT mice (Figure 4E). Despite the hair growth observed in SAG-treated VDR⫺/⫺ mice (Figure 4G), SAG treatment led to only rare (5.5% ⫾ 0.9%) hair follicles with proliferating cells below the bulge region. No such follicles were observed in vehicle-treated or depilated VDR⫺/⫺ mice (Figure 4, F and H). Evaluation of gene expression demonstrated that SAG treatment led to an increase in Wif1, Gli1, and Shh mRNA levels in WT skin, comparable to that observed with depilation (Figure 4I). However, no significant induction of Shh or cWnt target gene expression was observed in the SAG treated skin of VDR⫺/⫺ mice.

Discussion Anagen initiation requires activation of cWnt signaling in keratinocyte stem cells leading to downstream activation of the hedgehog signaling pathway (32). VDR⫺/⫺ mice cannot initiate anagen after the period of hair follicle morphogenesis and exhibit impaired cutaneous expression of cWnt and Shh target genes (16, 21), suggesting that the

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

doi: 10.1210/me.2014-1043

mend.endojournals.org

1703

Figure 3. SAG induces cWnt and Shh target genes and proliferation of hair follicle keratinocytes in young WT but not VDR⫺/⫺ mice. Dorsal skin was shaved and treated daily with vehicle (A and C) or SAG (B and D) from day 16 to day 22. BrdU immunohistochemistry demonstrates proliferating keratinocytes below the sebaceous glands of hair follicles in SAG-treated WT mice (B vs A) but not in VDR⫺/⫺ mice (D vs C). Highermagnification images of the boxed areas are shown to the left (A and C) or right (B and D) of the relevant images. E, Fold induction of gene expression in SAG vs vehicle-treated shaved mice and in depilated vs shaved mice (both vehicle treated). Bars, white (VDR⫺/⫺ shaved SAG vs shaved vehicle), gray (VDR⫺/⫺ depilated vehicle vs shaved vehicle), black (WT shaved SAG vs shaved vehicle), hatched (WT depilated vehicle vs shaved vehicle). Data represent mean ⫾ SEM of data obtained from three to five mice per genotype and time point. *, P ⱕ .05, **, P ⱕ .01, ***, P ⱕ .001 by Student t test.

VDR may directly regulate these pathways. In support of this hypothesis, the VDR is recruited to regulatory regions of cWnt and hedgehog target genes when transfected into VDR⫺/⫺ keratinocytes (21). To demonstrate a functional in vivo role for the VDR in activation of the cWnt and hedgehog pathways in the

skin, anagen initiation was used as a model. The lack of induction of the classic cWnt target gene, Axin2, in the hair follicles of VDR⫺/⫺ mice subjected to an anageninitiating stimulus suggests that the VDR acts at the level of, or upstream to, the cWnt signaling pathway in keratinocyte stem cells. However, constitutive activation of

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

1704

Lisse et al

VDR Regulates HH and cWnt Signaling

Mol Endocrinol, October 2014, 28(10):1698 –1706

Figure 4. SAG induces cWnt and Shh target genes and anagen in mature WT but not VDR⫺/⫺ mice. A, Fold induction of gene expression in SAG vs vehicle-treated shaved mice and in depilated vs shaved mice (both vehicle treated) treated for 9 days and killed 3 days later. B, Shh immunoreactivity in the outer root sheath (arrow) in shaved WT mice treated with SAG and in proliferating dermal cysts in VDR⫺/⫺ mice treated with SAG. Evaluation of hair growth and keratinocyte proliferation (BrdU immunohistochemistry) in mice treated for 9 days and killed 11 days later. Vehicle-treated shaved WT (C) and VDR⫺/⫺ mice (F); SAG-treated shaved WT (D) and VDR⫺/⫺ mice (G); dashed lines represent areas treated with SAG. Vehicle-treated depilated WT (E) and VDR⫺/⫺ mice (H). I, Fold induction of gene expression 11-day post-SAG vs vehicle-treated shaved mice and in depilated vs shaved mice (both vehicle treated). Bars, white (VDR⫺/⫺ shaved SAG vs shaved vehicle), gray (VDR⫺/⫺ depilated vehicle vs shaved vehicle), black (WT shaved SAG vs shaved vehicle), hatched (WT depilated vehicle vs shaved vehicle). Data represent mean ⫾ SEM of data obtained from three to five mice per genotype and time point. *, P ⱕ .05, **, P ⱕ .01, ***, P ⱕ .001 by Student t test.

␤-catenin cannot induce anagen in VDR⫺/⫺ mice (20), suggesting that the VDR acts with, or downstream from, ␤-catenin or, alternatively, interacts with a different effector of this pathway. The observation that the unliganded VDR does not immunoprecipitate ␤-catenin, but does immunoprecipitate Lef1 in primary keratinocyte cell lysates, suggests that VDR/Lef1 interactions are important for cWnt signaling in these cells (21). Although VDR mutations that impair Lef1 interactions fail to induce the expression of cWNT and HH target genes in VDR⫺/⫺ keratinocytes, these mutations also impair DNA binding

by the VDR (21); thus, it is not clear whether this functional impairment is due to lack of VDR/Lef1 interactions or inability of the mutant VDR to bind DNA. To determine whether the VDR can directly interact with regulatory regions in cWnt and HH target genes, ChIP experiments were performed. These studies demonstrated that the VDR and Lef1 are recruited to the same regulatory regions in the Gli1, Axin2, and cMyc genes in chromatin isolated from WT keratinocytes . Notably, absence of the VDR abolished Lef1 recruitment to these regions. Similarly, the absence of Lef1 abolished recruit-

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

doi: 10.1210/me.2014-1043

ment of the VDR to the regulatory regions of these cWnt and hedgehog target genes but not to the classic Osteocalcin VDRE. Although ChIP/re-ChIP studies suggest that the VDR and Lef1 interact with the same regions on the Axin2 and cMyc regulatory sequences, they suggest that VDR binding precludes Lef1 interactions with these sequences or that these two factors bind to nearby regions. Thus, these studies implicate a functional role for VDR and Lef1 in the regulation of cWnt and hedgehog target genes in keratinoctyes. Investigations in mice lacking the VDR and in VDR⫺/⫺ keratinocytes have demonstrated that the effects of calcium and 1,25-dihydroxyvitamin D on epidermal keratinocyte proliferation and differentiation are redundant: in the setting of normocalcemia or normal culture medium calcium concentrations, the epidermal keratinocytes of VDR⫺/⫺ mice differentiate normally (23, 33). However, normocalcemia cannot rescue the alopecia in VDR⫺/⫺ mice (34), suggesting that normal calcium levels cannot compensate for the absence of VDR signaling in keratinocyte stem cells. In an analogous fashion, different keratinocyte populations may differ in their need for the VDR to respond to activators of HH signaling. SAG treatment resulted in hair growth in the VDR⫺/⫺ mice. However, the paucity of mature anagen follicles in the shaved SAG treated VDR⫺/⫺ skin and the lack of induction of the gene expression profile that characterizes anagen suggests that the hair growth observed is primarily due to elongation of the existing shaved hair shafts rather than initiation of a new hair cycle. This hypothesis is supported by the observation that upon removal of the preexisting hair shafts by depilation, SAG is unable to promote hair growth. Thus, these studies suggest that selected keratinocyte populations, including those that synthesize proteins required for hair elongation, retain their ability to respond to SAG in the absence of the VDR. Similarly, SAG is able to induce Shh protein and mRNA expression in the dermal cysts but not in the hair follicles of VDR⫺/⫺ mice. These cysts contain markers of differentiated interfollicular epidermis (33); thus, their ability to respond to SAG in the absence of the VDR may reflect a distinct differentiation state or lineage derivation of these cells when compared with the population of keratinocytes responsible for cyclic regeneration of the hair follicle. This is consistent with the reported lineage progression defect in the keratinocyte stem cells of the VDR⫺/⫺ mice, thought to be responsible for the skin phenotype, including the increase in sebaceous glands observed with aging (20, 25). Thus, an alternative interpretation of these results is that, after the morphogenic period, the cells required for cyclic regeneration of the

mend.endojournals.org

1705

hair follicle are no longer competent to respond to cWnt or hedgehog signaling in VDR⫺/⫺ mice. These studies in VDR⫺/⫺ mice and keratinocytes reveal novel actions of the unliganded VDR. Although the liganded VDR has been shown to interact with ␤-catenin to inhibit cWnt signaling in colon cancer models (35) and to induce hair follicle differentiation (25), the current studies, using the mammalian hair cycle as a model, demonstrate that the unliganded VDR is required for the induction of both the cWnt and HH signaling pathways during anagen. Based on the abnormal lineage progression of the keratinocyte stem cells in the VDR⫺/⫺ mice, it is possible that they no longer retain the ability to respond to agonists of these pathways. However, the CD34 immunoreactivity of the VDR⫺/⫺ bulge cells is indistinguishable from that of the WT mice at day 18, as is the number of keratinocyte stem cells (20). Thus, we propose that the VDR is directly involved in the regulation of the cWnt and hedgehog pathways during the hair cycle. The physical interaction between the VDR and Lef1, combined with the observation that these transcription factors are recruited to the same regions in the regulatory sequences of cWnt and hedgehog target genes suggest that the cooperative transcriptional effects of VDR and Lef1 may be required for induction of these pathways during postmorphogenic hair cycles.

Acknowledgments We acknowledge Bruce Morgan, PhD, for helpful discussions and advice as well as Eric D. Zhu and Byongsoo Timothy Chae for technical assistance. Address all correspondence and requests for reprints to: Marie B. Demay, MD, Endocrine Unit, Thier 1101, Massachusetts General Hospital, 50 Blossom Street, Boston, MA 02114. E-mail: [email protected] This work was supported by This work was funded by grants from the NIH to MBD (R01 DK46974) and HFL (F32AR056933) and a research fellowship from the Department of Dermatology, the First Affiliated Hospital of Chongqing Medical University to HGZ.. Current addresses for H.Z.: Department of Dermatology, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China. Current addresses for F.G.: Harvard School of Dental Medicine, Boston, Massachusetts 02115. Current addresses for T.S.L.: Mount Desert Island Biological Laboratory, Bar Harbor, Maine. Disclosure Summary: All authors state they have no conflicts of interest.

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

1706

Lisse et al

VDR Regulates HH and cWnt Signaling

References 1. Hughes MR, Malloy PJ, Kieback DG, et al. Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science. 1988;242(4886):1702–1705. 2. Sakai Y, Kishimoto J, Demay MB. Metabolic and cellular analysis of alopecia in vitamin D receptor knockout mice. J Clin Invest. 2001;107(8):961–966. 3. Blanpain C, Fuchs E. Epidermal homeostasis: a balancing act of stem cells in the skin. Nat Rev Mol Cell Biol. 2009;10(3):207–217. 4. Chiang C, Swan RZ, Grachtchouk M, et al. Essential role for Sonic hedgehog during hair follicle morphogenesis. Dev Biol. 1999; 205(1):1–9. 5. DasGupta R, Fuchs E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development. 1999;126(20):4557– 4568. 6. Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are required for the initiation of hair follicle development. Dev Cell. 2002;2(5):643– 653. 7. Kishimoto J, Burgeson RE, Morgan BA. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 2000; 14(10):1181–1185. 8. Lim X, Tan SH, Koh WL, et al. Interfollicular epidermal stem cells self-renew via autocrine Wnt signaling. Science. 2013;342(6163): 1226 –1230. 9. Huelsken J, Vogel R, Erdmann B, Cotsarelis G, Birchmeier W. ␤-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell. 2001;105(4):533–545. 10. Lowry WE, Blanpain C, Nowak JA, Guasch G, Lewis L, Fuchs E. Defining the impact of ␤-catenin/Tcf transactivation on epithelial stem cells. Genes Dev. 2005;19(13):1596 –1611. 11. Niemann C, Owens DM, Hulsken J, Birchmeier W, Watt FM. Expression of ␦NLef1 in mouse epidermis results in differentiation of hair follicles into squamous epidermal cysts and formation of skin tumours. Development. 2002;129(1):95–109. 12. Reddy S, Andl T, Bagasra A, et al. Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech Dev. 2001;107(1–2):69 – 82. 13. St Jacques B, Dassule HR, Karavanova I, et al. Sonic hedgehog signaling is essential for hair development. Current Biol. 1998; 8(19):1058 –1068. 14. Sato N, Leopold PL, Crystal RG. Induction of the hair growth phase in postnatal mice by localized transient expression of Sonic hedgehog. J Clin Invest. 1999;104(7):855– 864. 15. Paladini RD, Saleh J, Qian C, Xu GX, Rubin LL. Modulation of hair growth with small molecule agonists of the hedgehog signaling pathway. J Invest Dermatol. 2005;125(4):638 – 646. 16. Teichert A, Elalieh H, Bikle D. Disruption of the hedgehog signaling pathway contributes to the hair follicle cycling deficiency in Vdr knockout mice. J Cell Physiol. 2010;225(2):482– 489. 17. Xiong Y, Li W, Shang C, et al. Brg1 governs a positive feedback circuit in the hair follicle for tissue regeneration and repair. Dev Cell. 2013;25(2):169 –181.

Mol Endocrinol, October 2014, 28(10):1698 –1706

18. Varnat F, Zacchetti G, Ruiz i Altaba A. Hedgehog pathway activity is required for the lethality and intestinal phenotypes of mice with hyperactive Wnt signaling. Mech Dev. 2010;127(1–2):73– 81. 19. Mullor JL, Dahmane N, Sun T, Ruiz i Altaba A. Wnt signals are targets and mediators of Gli function. Curr Biol. 2001;11(10):769 –773. 20. Cianferotti L, Cox M, Skorija K, Demay MB. Vitamin D receptor is essential for normal keratinocyte stem cell function. Proc Natl Acad Sci USA. 2007;104(22):9428 –9433. 21. Luderer HF, Gori F, Demay MB. Lymphoid enhancer-binding factor-1 (LEF1) interacts with the DNA-binding domain of the vitamin D receptor. J Biol Chem. 2011;286(21):18444 –18451. 22. Kwack MH, Kim MK, Kim JC, Sung YK. Dickkopf 1 promotes regression of hair follicles. J Invest Dermatol. 2012;132(6):1554 –1560. 23. Sakai Y, Demay MB. Evaluation of keratinocyte proliferation and differentiation in vitamin D receptor knockout mice. Endocrinology. 2000;141(6):2043–2049. 24. Sierra J, Yoshida T, Joazeiro CA, Jones KA. The APC tumor suppressor counteracts ␤-catenin activation and H3K4 methylation at Wnt target genes. Genes Dev. 2006;20(5):586 – 600. 25. Palmer HG, Anjos-Afonso F, Carmeliet G, Takeda H, Watt FM. The vitamin D receptor is a Wnt effector that controls hair follicle differentiation and specifies tumor type in adult epidermis. PLoS One. 2008;3(1):e1483. 26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-␦␦ C(T)] method. Methods. 2001;25(4):402– 408. 27. Chen CH, Sakai Y, Demay MB. Targeting expression of the human vitamin D receptor to the keratinocytes of vitamin D receptor null mice prevents alopecia. Endocrinology. 2001;142(12):5386 –5389. 28. Gori F, Zhu ED, Demay MB. Perichondrial expression of Wdr5 regulates chondrocyte proliferation and differentiation. Dev Biol. 2009;329(1):36 – 43. 29. Ishimatsu-Tsuji Y, Moro O, Kishimoto J. Expression profiling and cellular localization of genes associated with the hair cycle induced by wax depilation. J Invest Dermatol. 2005;125(3):410 – 420. 30. Ma L, Liu J, Wu T, et al. ‘Cyclic alopecia’ in Msx2 mutants: defects in hair cycling and hair shaft differentiation. Development. 2003; 130(2):379 –389. 31. Demay MB, Gerardi JM, DeLuca HF, Kronenberg HM. DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA. 1990;87(1):369 –373. 32. Alonso L, Fuchs E. Stem cells in the skin: waste not, Wnt not. Genes Dev. 2003;17(10):1189 –1200. 33. Xie Z, Komuves L, Yu QC, et al. Lack of the vitamin D receptor is associated with reduced epidermal differentiation and hair follicle growth. J Invest Dermatol. 2002;118(1):11–16. 34. Li YC, Amling M, Pirro AE, et al. Normalization of mineral ion homeostasis by dietary means prevents hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D receptor-ablated mice. Endocrinology. 1998;139(10):4391–1396. 35. Palmer HG, Gonzalez-Sancho JM, Espada J, et al. Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of ␤-catenin signaling. J Cell Biol. 2001;154(2):369 –387.

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 25 December 2014. at 13:59 For personal use only. No other uses without permission. . All rights reserved.

The vitamin D receptor is required for activation of cWnt and hedgehog signaling in keratinocytes.

Alopecia (hair loss) in vitamin D receptor (VDR)-null mice is due to absence of ligand-independent actions of the VDR that are required for initiation...
2MB Sizes 3 Downloads 9 Views