The Uteroglobin Promoter Contains a Noncanonical Estrogen Responsive Element
Emily P. Slater, Gerard Redeuihl, Karin Theis, Guntram Suske, and Miguel Beato Institut fur Molekularbiologie und Tumorforschung E. Mannkopffstrasse 2 D-3550 Marburg, West Germany Laboratoire des Hormones INSERM U33 Faculte de Medecine de Bicetre (G.R.) 94270 Bicetre, France
Uteroglobin is expressed in various tissues of the rabbit under complex hormonal control. In the endometrium the uteroglobin gene is transcribed only in epithelial cells after administration of ovarian hormones. In this paper we demonstrate that within the promoter region of the rabbit uteroglobin gene, there is a functional estrogen-responsive element (ERE) located between -265 and -252. Hybrid constructions containing sequences of the uteroglobin promoter up to -299, linked to the chloramphenicol acetyltransferase gene of E. coli respond to estrogens in gene transfer experiments, whereas a deletion that removes half of the ERE does not. A synthetic oligonucleotide corresponding to the putative ERE is able to confer estrogen inducibility to an otherwise unresponsive promoter. Binding experiments with purified estrogen receptor from calf uterus reveal a DNase-l footprint over the ERE. Within this protected region six guanine residues that have been shown to be contacted by the receptor in other EREs are protected against methylation by dimethylsulfate in the presence of the estrogen receptor. We compare this ERE with the vitellogenin A2 ERE from Xenopus and find that the relative affinity of the uteroglobin ERE is slightly lower than that of the vitellogenin ERE. Thus, this uteroglobin ERE could be involved in physiological regulation of uteroglobin expression in the genital tract. (Molecular Endocrinology 4: 604-610, 1990)
INTRODUCTION
sion has been used as a model for studying gene activation by steroid hormones (for a review, see Ref. 1). In the past, attention has been focussed on the progesterone induction in endometrium (2) and on glucocorticoid induction in lung (1). However, estrogens also induce UG mRNA synthesis in endometrium, although to a lower extent than progesterone (2), and in the oviduct synthesis of UG is exclusively induced by estrogen (3). Gene regulation by steroid hormones is mediated by an interaction of the hormone receptors with regulatory DNA sequences in the neighborhood of the regulated promoter (4). After cloning and sequencing of the UG gene and its flanking DNA sequences, binding sites for the progesterone and glucocorticoid receptors had been identified in the 5' flanking region, far up-stream from the transcript ion start point (5-7). An original report of a binding site for the progesterone receptor (PR) within the promoter region, based on nitrocellulose binding assays (8) was not confirmed in DNase-l footprint experiments, but additional binding sites were found within the first intron (7). Until now no binding sites for the estrogen receptor (ER) have been reported in the UG gene region, and therefore, the question arises of whether the observed effect of estrogen on UG gene transcription is direct or indirect. Inspection of the nucleotide sequences within the promoter region of the UG gene reveals a sequence between -265 and -252 sharing extensive homology to the reported structure of the estrogen-responsive elements (ERE) of vitellogenin genes (10). Here, we report a functional analysis of this sequence in gene transfer experiments as well as DNA binding studies with purified ER. The results demonstrate that this element binds specifically to the estrogen receptor and mediates estrogen induction of the UG promoter.
Uteroglobin (UG) is a small globular protein that is expressed in the rabbit uterus during the preimplantation phase of pregnancy. Relation of UG gene expres-
RESULTS
0888-8809/90/0604-0610$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
Close inspection of the UG promoter region (see Fig. 3) revealed the existence of an imperfect palindromic se-
Functional ERE in UG Promoter
604
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Estrogen Regulation of Uteroglobin Gene
quence between -265 and -253 that differs at a single position from the 13-mer consensus sequence of the ERE (9). We, therefore, tested the ability of promoter constructions containing or lacking this potential ERE to respond to estrogen stimulation after transient transection of Ishikawa cells, a human cell line derived from an endometrial adenocarcinoma (10). To enhance the estrogen response, we cotransfected, in some experiments, the human ER cDNA in an expression vector (11). It is clear that promoter constructions containing the potential ERE (A299) respond to estrogen treatment, whereas after deletion of all or half of this element (A258) the estrogen induction is abolished (Fig. 1). In an average of three experiments in the absence of cotransfected ER the induction was 2.6-fold (data not shown), whereas after cotransfection of the human ER cDNA estrogen induction was 10-fold (Table 1). The effect of estrogens on CAT activity was paralleled by an increase in the concentration of correct transcripts from the UG promoter, as demonstrated by RNase mapping of the RNA (Fig. 1B) (12). To investigate the hormone specificity of this effect we performed similar cotransfection experiments, but instead of the ER cDNA we cotransfected the rabbit PR or rat glucocorticoid receptor cDNA in expression vectors. Under these conditions neither a synthetic progestin (R5020) nor a synthetic glucocorticoid (dexamethasone) was able to induce CAT activity (Table 1). We interpret these data as proof that the UG promoter contains an ERE that is specifically responding to estrogens and is inactivated by a deletion mutant that removes sequences upstream from -258. It seems, therefore, plausible that the responsible sequences are those exhibiting similarity with the previously reported EREs (9). Purified Calf Uterus ER Yields a DNase-l Footprint with the Expected Guanine Contacts over the Potential ERE
605
A.
DES
A299 B.
A258
A299 A258 DES - +
147
12 The results summarized above suggest a direct interaction of the ER with the ERE sequences in the UG promoter. To directly demonstrate this interaction we performed DNA binding experiments with the purified ER from calf uterus (13). In DNase-l protection experiments a footprint between positions -269 and -243 is observed in the sense strand (Fig. 2); in the antisense strand the region protected by the ER extends from -271 to -240 (data not shown). In protection experiments with dimethylsulfate, the guanine residues at -264, -263, and -255 in the sense strand (Fig. 2) as well as the guanine residues at - 2 6 1 , -253, and -252 in the antisense strand (data not shown) are protected by ER binding. A summary of these data is shown in Fig. 3. Thus, it seems that the ER binds to the ERE of the UG promoter in a way similar to that described for the ERE of the Xenopus vitellogenin A2 gene (9). Hypothetical ERE Can Mediate Estrogen Induction of a Heterologous Promoter To prove that the potential ERE was responsible for the observed estrogen induction of the hybrid construe-
- + M
3 4
5
Fig. 1. Influence of Estrogen on Transcription of the UG Promoter A, CAT assays from Ishikawa cells transfected with deletion mutants A299 and A258 and treated without and with DES; B, RNA analysis of these two constructs without and with DES. The correct start site gives rise to a protected fragment of 171 nt. RNA from the internal control RSV CAT hybridizes with 147 nt of the RNA probe. The probe used was 211 nt in length. Lane 5, pBR322 restricted with Hpall and end-labeled (M).
tions, we synthesized an oligonucleotide containing the correponding nucleotide sequence and cloned it in front of the thymidine kinase (TK) promoter in the plasmid pTK-CAT (14). This plasmid contains the TX sequences from nucleotide position -105 to +51 relative to the start of transcription fused to the CAT gene and has been shown to be hormonally unresponsive in gene transfer studies (15). When the constructions containing the synthetic ERE were introduced into Ishikawa cells together with the ER cDNA expression vector,
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Vol 4 No. 4
MOL ENDO-1990 606
Table 1. Induction of Expression of the UG CAT Construct CAT Activity (pmol/min • mg)a
43.7 408.0 32.8 51.3 30.2 23.7
Control DES Control DEX Control R5020 8
-JJ0
A258
A299
30.7 ±2.0 22.3 ±4.2 35.5 50.3 24.3 ±3.6 20.0 ±1.6
± 12 ± 97
± 5.8 ± 10.6
GGATCCTGG«TGCTCC8TATCCTGTCAJCAGCCACTTGGGCCTCAGCTJTCTCCTGGGGTGAC CCTAGGACCCACGAGGATAGGACAGTGTCGGTGAACCCGGAGTCGAAGAGGACCCCACTG
SD is included for experiments where n > 2.
-320
-JIO
-JOOr^"
-290
-280
AGGAGACACACTTGCTTCTGTTGGTCTGGGCTGCCCAAATGCCCTGGTTCAAAGAGAAGA TCCTCTGTGTGAACGAAGACAACCAGACCCGACGGGTTTACGGGACCAAGTTTCTCTTCT I A258 I !2a -2V
W
-260 t^V
-2SC
I "?•«>
-5'0
~
CGCAGGTGGCCAGGTCACCATGCCCTCGGGGGCAGGCACCCCTTGCCACACCCCCGCACA GCGTCCACCGGTCCAGTGGTACGGGAGCCCCCGTCCGTGGGGAACGGTGTGGGGGCGTGT I A AcA I -210
'-'«>
-190
-ISO
-170
-160
AGACTCCGGGCTCTCCCTCCCCCCGAGGGACCCATTGTGTGAGTTCAGTTTCAATAGGGA TCTGAGGCCCGAGAGGGAGGGGGGCTCCCTGGGTAACACACTCAAGTCAAAGTTATCCCT -150
-no
-IJO
-120
-110
-100
TGGAAACTGGATTGAGAAAAGGGAATATTTACTTATCCCACCAAGTCAATGCCCAAGTAA ACCTTTGACCTAACTCTTTTCCCTTATAAATGAATAGGGTGGTTCAGTTACGGGTTCATT ATAATGCAGTCAAGTAAGTGGAGCCCAGGCCCTGCCCTCTTCTATCTGGGCACTGCCCGG TATTACGTCAGTTCATTCACCTCGGGTCCGGGACGGGAGAAGATAGACCCGTGACGGGCC
DNase 1 R/G G
3'
DMS
/A -243
+ - + 4M£JHyHfc
• &*»•if ^jtoL ^ ^
W$.
m — - - mm •1 ai
:
mm* *»••
G G G
/
G ISSS
• i
/
is-
C C
W «k» ZZ
fib
\
W
\\
• s
1 T!T « i SS*
m ss
;.,»m «•
A C
C
\
\
A C T G
\
G A
\
i~ . mmm
C G T
^ 1 1 \ ^^u, ^^ff
\ \
mm
I S f i ««• ^^ ( ^ ••••• - •
•»
. . . . . . ^
^
Fig. 3. Nucleotide Sequence of the UG Gene from Position -396 to+12 Included are the CAT activities in Ishikawa cells of various 5' deletion mutants expressed in picomoles per min/mg protein (arrows), the limits of the DNase-l protection on both strands (brackets), and the guanine residues protected (A) or hypermethylated (A) by dimethylsulfate in the presence of ER.
C T
"""I1**
SB
«P
C G
/ /
AGAATACAAAAAGGCACCTGACGGCCGTCCCCCTCAAGATCACCGGATCC TCTTATGTTTTTCCGTGGACTGCCGGCAGGGGGAGTTCTAGTGGCCTAGG
^
\
\ c \ c \G
\G -269
5' Fig. 2. DNase-l Footprint and Methylation Protection of the Sense Strand with the ER The first two lanes show purine-specific (A/G) and guaninespecific (G) sequence reactions. The labeled UG fragment was incubated without (-) or with (+) ER and submitted to digestion with DNase-l or treated with dimethylsulfate (DMS). A, Protected guanine residues. The sequence of the protected region from position -269 to -243 is indicated.
expression from the TK promoter was induced severalfold by the addition of estrogen (Table 2). For comparison, we also measured the response of a construction containing the perfect palindromic ERE of the Xenopus vitellogenin A2 (Vit A2) gene (9). The effects obtained
Table 2. Comparison of the ERE from UG with the ERE from Vitellogenin on a Heterologous Promoter CAT Activity (pmol/min • mg)
Control DES
Vit A2 tk CAT
UG tk CAT
19.7 123.3
12.0 82.9
with the UG ERE were comparable to those obtained with the perfect ERE (Table 2). We conclude from these experiments that the putative ERE is able to mediate efficient estrogen inducibility of the UG promoter and confer estrogen responsiveness to an otherwise unresponsive promoter. Because the effect of the synthetic estrogen at 10"8 M on the UG ERE construct was slightly less than the effect on the Vit A2 construct, we decided to extend the comparison of the two constructs. Determination of the concentration of hormone that yields half of the maximum level of induction yields a measure of the affinity of the receptor for the binding site. HeLa cells were transfected with the CAT constructs containing the two EREs and treated with increasing concentrations of the synthetic estrogen diethylstilbestrol (DES), from 10"14-10~6 M. The resulting CAT activities are represented in the dose-response curves found in Fig. 4. Although the results demonstrate that the two constructs approach a comparable maximum value, the Vit A2 construct yields the half-maximal value at a concentration of 2.5 x 10~11 M (180 pmol/min mg), whereas the UG half-maximal value is obtained at a concentration of 10~10 M (135 pmol/min • mg), a difference of 4fold. These in vivo results suggest that the Vit A2 ERE has a higher relative affinity for the ER than does the UG ERE.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Estrogen Regulation of Uteroglobin Gene
607
400 -i
GRE
VIT A2
UG
300-
*> < E
200-
ER
»
Emily P. Slater, Gerard Redeuihl, Karin Theis, Guntram Suske, and Miguel Beato Institut fur Molekularbiologie und Tumorforschung E. Mannkopffstrasse 2 D-3550 Marburg, West Germany Laboratoire des Hormones INSERM U33 Faculte de Medecine de Bicetre (G.R.) 94270 Bicetre, France
Uteroglobin is expressed in various tissues of the rabbit under complex hormonal control. In the endometrium the uteroglobin gene is transcribed only in epithelial cells after administration of ovarian hormones. In this paper we demonstrate that within the promoter region of the rabbit uteroglobin gene, there is a functional estrogen-responsive element (ERE) located between -265 and -252. Hybrid constructions containing sequences of the uteroglobin promoter up to -299, linked to the chloramphenicol acetyltransferase gene of E. coli respond to estrogens in gene transfer experiments, whereas a deletion that removes half of the ERE does not. A synthetic oligonucleotide corresponding to the putative ERE is able to confer estrogen inducibility to an otherwise unresponsive promoter. Binding experiments with purified estrogen receptor from calf uterus reveal a DNase-l footprint over the ERE. Within this protected region six guanine residues that have been shown to be contacted by the receptor in other EREs are protected against methylation by dimethylsulfate in the presence of the estrogen receptor. We compare this ERE with the vitellogenin A2 ERE from Xenopus and find that the relative affinity of the uteroglobin ERE is slightly lower than that of the vitellogenin ERE. Thus, this uteroglobin ERE could be involved in physiological regulation of uteroglobin expression in the genital tract. (Molecular Endocrinology 4: 604-610, 1990)
INTRODUCTION
sion has been used as a model for studying gene activation by steroid hormones (for a review, see Ref. 1). In the past, attention has been focussed on the progesterone induction in endometrium (2) and on glucocorticoid induction in lung (1). However, estrogens also induce UG mRNA synthesis in endometrium, although to a lower extent than progesterone (2), and in the oviduct synthesis of UG is exclusively induced by estrogen (3). Gene regulation by steroid hormones is mediated by an interaction of the hormone receptors with regulatory DNA sequences in the neighborhood of the regulated promoter (4). After cloning and sequencing of the UG gene and its flanking DNA sequences, binding sites for the progesterone and glucocorticoid receptors had been identified in the 5' flanking region, far up-stream from the transcript ion start point (5-7). An original report of a binding site for the progesterone receptor (PR) within the promoter region, based on nitrocellulose binding assays (8) was not confirmed in DNase-l footprint experiments, but additional binding sites were found within the first intron (7). Until now no binding sites for the estrogen receptor (ER) have been reported in the UG gene region, and therefore, the question arises of whether the observed effect of estrogen on UG gene transcription is direct or indirect. Inspection of the nucleotide sequences within the promoter region of the UG gene reveals a sequence between -265 and -252 sharing extensive homology to the reported structure of the estrogen-responsive elements (ERE) of vitellogenin genes (10). Here, we report a functional analysis of this sequence in gene transfer experiments as well as DNA binding studies with purified ER. The results demonstrate that this element binds specifically to the estrogen receptor and mediates estrogen induction of the UG promoter.
Uteroglobin (UG) is a small globular protein that is expressed in the rabbit uterus during the preimplantation phase of pregnancy. Relation of UG gene expres-
RESULTS
0888-8809/90/0604-0610$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
Close inspection of the UG promoter region (see Fig. 3) revealed the existence of an imperfect palindromic se-
Functional ERE in UG Promoter
604
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Estrogen Regulation of Uteroglobin Gene
quence between -265 and -253 that differs at a single position from the 13-mer consensus sequence of the ERE (9). We, therefore, tested the ability of promoter constructions containing or lacking this potential ERE to respond to estrogen stimulation after transient transection of Ishikawa cells, a human cell line derived from an endometrial adenocarcinoma (10). To enhance the estrogen response, we cotransfected, in some experiments, the human ER cDNA in an expression vector (11). It is clear that promoter constructions containing the potential ERE (A299) respond to estrogen treatment, whereas after deletion of all or half of this element (A258) the estrogen induction is abolished (Fig. 1). In an average of three experiments in the absence of cotransfected ER the induction was 2.6-fold (data not shown), whereas after cotransfection of the human ER cDNA estrogen induction was 10-fold (Table 1). The effect of estrogens on CAT activity was paralleled by an increase in the concentration of correct transcripts from the UG promoter, as demonstrated by RNase mapping of the RNA (Fig. 1B) (12). To investigate the hormone specificity of this effect we performed similar cotransfection experiments, but instead of the ER cDNA we cotransfected the rabbit PR or rat glucocorticoid receptor cDNA in expression vectors. Under these conditions neither a synthetic progestin (R5020) nor a synthetic glucocorticoid (dexamethasone) was able to induce CAT activity (Table 1). We interpret these data as proof that the UG promoter contains an ERE that is specifically responding to estrogens and is inactivated by a deletion mutant that removes sequences upstream from -258. It seems, therefore, plausible that the responsible sequences are those exhibiting similarity with the previously reported EREs (9). Purified Calf Uterus ER Yields a DNase-l Footprint with the Expected Guanine Contacts over the Potential ERE
605
A.
DES
A299 B.
A258
A299 A258 DES - +
147
12 The results summarized above suggest a direct interaction of the ER with the ERE sequences in the UG promoter. To directly demonstrate this interaction we performed DNA binding experiments with the purified ER from calf uterus (13). In DNase-l protection experiments a footprint between positions -269 and -243 is observed in the sense strand (Fig. 2); in the antisense strand the region protected by the ER extends from -271 to -240 (data not shown). In protection experiments with dimethylsulfate, the guanine residues at -264, -263, and -255 in the sense strand (Fig. 2) as well as the guanine residues at - 2 6 1 , -253, and -252 in the antisense strand (data not shown) are protected by ER binding. A summary of these data is shown in Fig. 3. Thus, it seems that the ER binds to the ERE of the UG promoter in a way similar to that described for the ERE of the Xenopus vitellogenin A2 gene (9). Hypothetical ERE Can Mediate Estrogen Induction of a Heterologous Promoter To prove that the potential ERE was responsible for the observed estrogen induction of the hybrid construe-
- + M
3 4
5
Fig. 1. Influence of Estrogen on Transcription of the UG Promoter A, CAT assays from Ishikawa cells transfected with deletion mutants A299 and A258 and treated without and with DES; B, RNA analysis of these two constructs without and with DES. The correct start site gives rise to a protected fragment of 171 nt. RNA from the internal control RSV CAT hybridizes with 147 nt of the RNA probe. The probe used was 211 nt in length. Lane 5, pBR322 restricted with Hpall and end-labeled (M).
tions, we synthesized an oligonucleotide containing the correponding nucleotide sequence and cloned it in front of the thymidine kinase (TK) promoter in the plasmid pTK-CAT (14). This plasmid contains the TX sequences from nucleotide position -105 to +51 relative to the start of transcription fused to the CAT gene and has been shown to be hormonally unresponsive in gene transfer studies (15). When the constructions containing the synthetic ERE were introduced into Ishikawa cells together with the ER cDNA expression vector,
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Vol 4 No. 4
MOL ENDO-1990 606
Table 1. Induction of Expression of the UG CAT Construct CAT Activity (pmol/min • mg)a
43.7 408.0 32.8 51.3 30.2 23.7
Control DES Control DEX Control R5020 8
-JJ0
A258
A299
30.7 ±2.0 22.3 ±4.2 35.5 50.3 24.3 ±3.6 20.0 ±1.6
± 12 ± 97
± 5.8 ± 10.6
GGATCCTGG«TGCTCC8TATCCTGTCAJCAGCCACTTGGGCCTCAGCTJTCTCCTGGGGTGAC CCTAGGACCCACGAGGATAGGACAGTGTCGGTGAACCCGGAGTCGAAGAGGACCCCACTG
SD is included for experiments where n > 2.
-320
-JIO
-JOOr^"
-290
-280
AGGAGACACACTTGCTTCTGTTGGTCTGGGCTGCCCAAATGCCCTGGTTCAAAGAGAAGA TCCTCTGTGTGAACGAAGACAACCAGACCCGACGGGTTTACGGGACCAAGTTTCTCTTCT I A258 I !2a -2V
W
-260 t^V
-2SC
I "?•«>
-5'0
~
CGCAGGTGGCCAGGTCACCATGCCCTCGGGGGCAGGCACCCCTTGCCACACCCCCGCACA GCGTCCACCGGTCCAGTGGTACGGGAGCCCCCGTCCGTGGGGAACGGTGTGGGGGCGTGT I A AcA I -210
'-'«>
-190
-ISO
-170
-160
AGACTCCGGGCTCTCCCTCCCCCCGAGGGACCCATTGTGTGAGTTCAGTTTCAATAGGGA TCTGAGGCCCGAGAGGGAGGGGGGCTCCCTGGGTAACACACTCAAGTCAAAGTTATCCCT -150
-no
-IJO
-120
-110
-100
TGGAAACTGGATTGAGAAAAGGGAATATTTACTTATCCCACCAAGTCAATGCCCAAGTAA ACCTTTGACCTAACTCTTTTCCCTTATAAATGAATAGGGTGGTTCAGTTACGGGTTCATT ATAATGCAGTCAAGTAAGTGGAGCCCAGGCCCTGCCCTCTTCTATCTGGGCACTGCCCGG TATTACGTCAGTTCATTCACCTCGGGTCCGGGACGGGAGAAGATAGACCCGTGACGGGCC
DNase 1 R/G G
3'
DMS
/A -243
+ - + 4M£JHyHfc
• &*»•if ^jtoL ^ ^
W$.
m — - - mm •1 ai
:
mm* *»••
G G G
/
G ISSS
• i
/
is-
C C
W «k» ZZ
fib
\
W
\\
• s
1 T!T « i SS*
m ss
;.,»m «•
A C
C
\
\
A C T G
\
G A
\
i~ . mmm
C G T
^ 1 1 \ ^^u, ^^ff
\ \
mm
I S f i ««• ^^ ( ^ ••••• - •
•»
. . . . . . ^
^
Fig. 3. Nucleotide Sequence of the UG Gene from Position -396 to+12 Included are the CAT activities in Ishikawa cells of various 5' deletion mutants expressed in picomoles per min/mg protein (arrows), the limits of the DNase-l protection on both strands (brackets), and the guanine residues protected (A) or hypermethylated (A) by dimethylsulfate in the presence of ER.
C T
"""I1**
SB
«P
C G
/ /
AGAATACAAAAAGGCACCTGACGGCCGTCCCCCTCAAGATCACCGGATCC TCTTATGTTTTTCCGTGGACTGCCGGCAGGGGGAGTTCTAGTGGCCTAGG
^
\
\ c \ c \G
\G -269
5' Fig. 2. DNase-l Footprint and Methylation Protection of the Sense Strand with the ER The first two lanes show purine-specific (A/G) and guaninespecific (G) sequence reactions. The labeled UG fragment was incubated without (-) or with (+) ER and submitted to digestion with DNase-l or treated with dimethylsulfate (DMS). A, Protected guanine residues. The sequence of the protected region from position -269 to -243 is indicated.
expression from the TK promoter was induced severalfold by the addition of estrogen (Table 2). For comparison, we also measured the response of a construction containing the perfect palindromic ERE of the Xenopus vitellogenin A2 (Vit A2) gene (9). The effects obtained
Table 2. Comparison of the ERE from UG with the ERE from Vitellogenin on a Heterologous Promoter CAT Activity (pmol/min • mg)
Control DES
Vit A2 tk CAT
UG tk CAT
19.7 123.3
12.0 82.9
with the UG ERE were comparable to those obtained with the perfect ERE (Table 2). We conclude from these experiments that the putative ERE is able to mediate efficient estrogen inducibility of the UG promoter and confer estrogen responsiveness to an otherwise unresponsive promoter. Because the effect of the synthetic estrogen at 10"8 M on the UG ERE construct was slightly less than the effect on the Vit A2 construct, we decided to extend the comparison of the two constructs. Determination of the concentration of hormone that yields half of the maximum level of induction yields a measure of the affinity of the receptor for the binding site. HeLa cells were transfected with the CAT constructs containing the two EREs and treated with increasing concentrations of the synthetic estrogen diethylstilbestrol (DES), from 10"14-10~6 M. The resulting CAT activities are represented in the dose-response curves found in Fig. 4. Although the results demonstrate that the two constructs approach a comparable maximum value, the Vit A2 construct yields the half-maximal value at a concentration of 2.5 x 10~11 M (180 pmol/min mg), whereas the UG half-maximal value is obtained at a concentration of 10~10 M (135 pmol/min • mg), a difference of 4fold. These in vivo results suggest that the Vit A2 ERE has a higher relative affinity for the ER than does the UG ERE.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 22:28 For personal use only. No other uses without permission. . All rights reserved.
Estrogen Regulation of Uteroglobin Gene
607
400 -i
GRE
VIT A2
UG
300-
*> < E
200-
ER
»
