Methods xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Methods journal homepage: www.elsevier.com/locate/ymeth

The use of TALENs for nonhomologous end joining mutagenesis in silkworm and fruitfly Yoko Takasu a, Toshiki Tamura a, Suresh Sajwan b, Isao Kobayashi a, Michal Zurovec b,⇑ a b

National Institute of Agrobiological Sciences, 1-2 Owashi, Tsukuba, Ibaraki 305-8634, Japan Biology Centre of the ASCR, Branisovska 31, 370 05 Ceske Budejovice, Czech Republic

a r t i c l e

i n f o

Article history: Available online xxxx Keywords: Bombyx mori Drosophila melanogaster pBlue-TAL Engineered nucleases Golden Gate assembly Genotyping

a b s t r a c t Transcription activator-like effector nucleases (TALENs) are custom-made enzymes designed to cut double-stranded DNA at desired locations. The DNA breaks are repaired either by error-prone non-homologous end-joining (NHEJ) pathway or via homologous recombination requiring homologous DNA as a template for the repair. TALENs are used for site-specific mutagenesis in an extended range of organisms including insects. We will describe here a simple TALEN-based mutagenesis protocol suitable for the generation of germline mutations in Bombyx mori and Drosophila melanogaster. The protocol includes assembly of specific TAL modules, in vitro synthesis of TALEN RNAs, egg microinjection and mutation detection using PCR analysis. Our procedure allows a high frequency induction of NHEJ mutations, which often allows the reception of homozygous mutants already in the G1. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction The ability to disrupt genes and to follow the resulting phenotypes is a major tool in functional gene analysis [1]. Recent breakthroughs in sequencing technologies have increased the need for targeting specific loci in the genomes of various model systems as well as economically important organisms. Three major approaches of efficient gene targeting were pioneered in insects. Besides the RNA interference technology and homologous recombination techniques described by Kent Golic, which both have a limited use in many species, another significant method includes the induction of stable mutations by artificial site-specific nucleases [2–4]. Engineered nucleases are custom made enzymes designed to cut double stranded DNA at desired locations. The double strand breaks induce the error-prone repair process of nonhomologous end joining (NHEJ), although under certain conditions this repair mechanism can be driven by exogenous donor DNA and lead to homologous recombination. NHEJ mutations usually involve small deletions or insertions causing frameshifts and truncations of ORFs. There are three major types of engineered nucleases: Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and nucleases from the adaptive

⇑ Corresponding author. Address: Biology Centre, Academy of Sciences, and the Faculty of Natural Sciences, University of South Bohemia, 370 05 Ceske Budejovice, Czech Republic. Fax: +420 385310354. E-mail address: [email protected] (M. Zurovec).

prokaryotic immune system based on Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). CRISPR-associated system (Cas) nucleases currently used in genetic engineering are guided by RNA [3,5–7]. While the nucleases from the CRISPR/Cas system are the easiest to prepare, they still have some problems with proper cutting specificity [8,9]. TALENs represent well studied and highly effective chimeric enzymes proven to induce mutations in a whole range of organisms, including zebrafish, mouse, rat, Xenopus, Caenorhabditis elegans and at least 5 insect species [10–16]. TALENs consist of a DNA binding domain derived from bacterial TAL-effector transcription factors and a non-specific cleavage domain from type II restriction endonuclease FokI. The TAL-effector sequences are found in Xanthomonas species and are highly conserved. TALENs function in pairs due to the dimerization of the FokI nuclease domain. The sequences of DNA targets therefore consist of two half sites separated by a 12– 30 nucleotide long spacer (the spacer length depends on the TALEN architecture used). The TAL constructs used in mutagenesis may have different origin but differ only slightly, which is not expected to significantly influence their activity. Several C- and the N-terminal truncations of the native TAL proteins were used for fusion with the FokI nuclease domain and shown to increase the TALEN activity [17,18]. The DNA binding of TAL-effectors is mediated by a central region formed by an array of conserved modular repeated units. Each unit usually consists of 33–34 amino acid residues and positions 12 and 13 in each repeat are less conserved and called the repeat variable di-residues (RVDs). Each RVD recognizes a single DNA base.

http://dx.doi.org/10.1016/j.ymeth.2014.02.014 1046-2023/Ó 2014 Elsevier Inc. All rights reserved.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

2

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

There are several naturally occurring RVDs in TAL-effectors and 4 of them have been used most frequently in the engineered constructs – NI, HD, NG and NN recognizing bases A, C, T and G, respectively. The NN modules seem to be less specific and also recognize the A base, they are slowly being replaced by NH modules, which were shown to be more specific for the G base [19,20]. The failure rate of custom-made TALENs is rather low (10%) and several methods allow reliable assembly of DNA-binding modules. We describe here a simple TALEN-based mutagenesis protocol suitable for the generation of germline mutations in Bombyx mori and Drosophila melanogaster. Our method has the following advantages: it is fast, efficient, inexpensive, does not require extensive manipulations with transgenes, and is applicable for other insect species. A schematic overview of the entire mutagenesis procedure is shown in Fig. 1. 2. Target site selection, TALEN design The flexibility of TALEN target selection makes it possible to find targetable sites in almost any region of a gene, including the translational start site, or find targets with binding half sites surrounding a restriction site to simplify mutation detection (i.e., scoring for a loss of a restriction enzyme recognition sequence at the TALEN cut site). Generally, we search for TALEN binding sites with restriction sites within the spacer, preferably in the open reading frame close to the 50 end of the gene. The restriction site should cut only once within the region of interest for easy scoring of PCR fragments. TALEN DNA targets can be selected manually or with the aid of simple web-based software [21,22]. The major requirement for TALEN targets is just a T base preceding the 50 end and the use of the target sequences within a suitable length range. We tested TALENs with target half-sites of 15–24 nucleotides (requiring TALENs with 15–24 RVD modules) most of them worked well regardless of their length. The spacer length of active TALEN pairs was in the range of 14–18 nucleotides [23]. Note 1: It is important to avoid polymorphic or repetitive regions when selecting the target sites. Since the silkworm contains a rather high level of polymorphism, it is necessary to determine

the sequence of the target in the particular strain. We usually select TALEN targets in exons longer than 200 bp for easy genotyping. Exons are less polymorphic and PCR fragments around 200–400 bp have suitable size for electrophoretic separation after digestion with restriction enzymes. Note 2: It depends from case to case in which part of the gene we search for TALEN targets. In most experiments we search for TALEN targets positioned in the ORF close to the initiation codon in order to get a null allele or try finding a TALEN target in the DNA sequence close to the predicted active site. If we need to confirm the phenotype of a known characterized mutant by generating independent mutation, we select a TALEN pair targeting the same site. 2.1. Manual procedure (1) Start by searching for the unique restriction site in the area of interest (using restriction mapper – http://www.restrictionmapper.org/ or alternative software). As an example we will search for a TALEN target in the 3rd exon of the B. mori BmBLOS2 gene (GenBank, accession number AK385404). A 93 bp part of this sequence is shown in Fig. 2. We find, a suitable BglII restriction site in position 42–47 (yellow), representing a good starting point for the selection of the TALEN target. (2) Search for a T nucleotide 19–30 nucleotides in the 50 -direction and at the same distance range of an A nucleotide in the 30 -direction. These bases will delineate the recognition half sites. There are 2 suitable T residues, 28 and 19 nucleotides upstream of BglII, respectively. There are also 5 A residues 23, 24, 26, 27 and 29 nucleotides downstream of BglII. This situation allows us to design a large number of alternative candidate target site variants. We prefer the sites with a spacer length around 15 bp and target half-sites of 15–21 nucleotides. Two of such candidate target sites are shown below (grey color). Each target is shown together with its corresponding RVD sequence. Notice that the first T (highlighted in blue) is specified by the N-terminus of the TALEN and does not require a specific RVD.

Fig. 1. Overview of TALEN mutagenesis in Bombyx mori. The procedure includes the selection of the TALEN target, design and assembly of the TALEN construct, in vitro synthesis of mRNA, embryo microinjection and isolation of mutants using DNA sequence analysis.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

3

Fig. 2. TALEN target selection. A single BglII restriction site (AGATCT, highlighted in yellow) in the 93 bp part of the third exon of Bombyx BmBLOS2 gene serves as a suitable starting point for the new TALEN target selection. A number of different variants of target half sites surrounding the restriction site can be designed. We are showing just two examples (A and B) with the 50 T base (in blue) delineating each of the half-site binding sequence (in gray). The RVDs recognizing the L and R half-sites are indicated below the DNA sequences.

(3) Check the B. mori genome sequence for possible off-target sites by submitting the binding motifs to a BLAST search (http://kaikoblast.dna.affrc.go.jp/cgi-bin/robo-blast/ blast2.cgi?program=KAIKObase). 2.2. Procedure by using sequence analysis server (1) Open the TAL Effector Nucleotide Targeter 2.0 software webpage (https://tale-nt.cac.cornell.edu/node/add/talen) or https://boglab.plp.iastate.edu/ [21] and paste the 93 bp sequence from the 3rd exon of the B. mori BmBLOS2 in FASTA format into the dialog box. Set the architecture option to ‘‘[17]’’ (spacer length 15–20 bp, target subsite 15–20 bp), and select NN for the G binding and filter option to show TALEN pairs targeting a specific site. Specify the cut site position using filter options to bases 42, 43, 44, 45, 46 and 47 (the BglII site) and press ‘‘search’’. For example, you will receive a list of 11 alternative TALEN pairs for the position 43 differing in spacer range and exact subsite locations. (2) Select one of the sites containing spacer length closest to 15 bp. (3) Check the genome sequence for possible off-target sites using BLAST search as described for the manual protocol above. 3. Expression vectors and TALEN assembly Several framework vectors are available for TALEN RNA synthesis differing by the extent of their TAL domain truncation and slight sequence modifications of the original Xanthomonas protein. They may also contain adjustments for species specific codon usage or different UTRs. We designed a framework vector called pBlueTAL, which is based on the construct of Miller and co-workers [17] and Hockemeyer and co-workers [24], which have been shown to have robust cutting activity on multiple targets in different organisms. This construct encodes a truncated TAL-effector DNA binding domain containing 136 N-terminal and 63 C-terminal amino acids and possesses a nuclear localization signal. The pBlue-TAL vector has adjusted codon usage for insects and is compatible with the Golden Gate TALEN and TAL Effector Kit (Addgene). Its sequence has been deposited to the GenBank (accession number KF724948) and can be obtained from Addgene. It contains two Esp3I restriction sites needed for in frame insertion of the assembled RVD motifs. It also has a T7 promoter for in vitro transcription. The 50 end of the TALEN construct contains 50 UTR from the B. mori actin 3 gene and a Kozak sequence; both elements conferred the highest translation efficiency in B. mori cell culture. The transcribed part of the vector sequence contains a 30 UTR with a SV40 terminator and a short poly(A) tract. Our results show that pBlue-TAL is suitable not only for B. mori but also for D. melanogaster and potentially other insects. The repetitive character of the TALE-DNA binding domain initially caused difficulties in TALEN construction. There are several

ways how to overcome these problems including the PCR-based protocols, which carry the risk of artifacts or by serial ligations of single or multiple modular units [25–27]. It is also possible to employ commercial TALEN synthesis, although it is still relatively expensive. We use the Golden Gate assembly protocol, which is based on sequential ligation of specific modules [27] using a kit from Addgene (Cambridge MA, USA). Major components of Addgene Golden Gate TALEN and TAL Effector Kit are shown in Fig. 3. The method uses Type IIS restriction endonucleases, which cleave outside their recognition sites to create unique 4 bp sticky ends (Fig. 4). Cloning is performed by digesting and ligating in the same reaction mixture because the Type IIS enzyme recognition site is eliminated during assembly. We use four RVD modules in our experiments (NI, HD, NN and NG), the assembly is done in two steps and takes 4–5 days (Fig. 5). In the first step the assembly reaction is split into two reactions. The first ten RVD modules are assembled into the pFusA vector, whereas the terminal RVD is added separately, leaving the remaining modules for subcloning into the appropriate pFusB vector. Therefore, for the TALEN construct containing 15 RVD, modules 11–14 will be subcloned into the plasmid pFusB4 (Fig. 5), for the TALEN containing 16 RVD, the modules 11–15 will be used together with plasmid pFusB5, etc. In the second step the array clones from the cloning step 1 will be released by Esp3I restriction enzyme together with the terminal RVD module and directly assembled into the expression vector pBlue-TAL (Fig. 5). The expression vector pBlue-TAL is supplied by Addgene or it can be obtained from the authors of this article. The example of TALEN amino acid sequence is shown in Fig. 6. Note: We recommend using TALENs with 15–21 RVD modules. Longer TALENs containing more than 21 repeats are constructed with a modified protocol using plasmids pFUS_A30A and pFUS_A30B, which are also components of the Golden Gate TALEN and TAL Effector Kit (Addgene). 3.1. Material Plasmids from Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene), pBlue-TAL vector, competent cells Escherichia coli, restriction enzymes BsaI (New England Biolab) and Esp3I (Thermo Scientific), T4 DNA Ligase (Promega), 10 ligation/restriction buffer, X-GAL, IPTG, plasmid-safe nuclease, ATP, PCR primers pCR8_F1: ttgatgcctggcagttccct, pCR8_R1: cgaaccgaacaggcttatgt, sTALseqF: gtgcatgcttggcgtaac, TAL_R2: ggcgacgaggtggtcgttgg, spectinomycin, ampicillin. 3.2. First cloning step procedure (2 days) (1) Set up restriction/ligation reactions inserts to construct the pFusA vector coding for the first 10 RVDs by mixing: 75 ng of each plasmid p1 to p10 (Fig. 3) carrying selected RVD module, 75 ng of purified pFusA vector,

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

4

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

Fig. 3. Major components of Addgene Golden Gate cloning kit. The kit includes the 40 most frequently used repeat modules, p1-10, four of each type (shown on the left side) carrying RVDs. Plasmids pFusA and pFusB1-10 are used for array cloning. The four pLR plasmid modules encode for the terminal half-repeat. Unique sticky ends generated by the Type IIS restriction endonucleases BsaI and Esp3I are shown as colored and striped boxes, respectively (see text for details).

Fig. 4. Type IIS restriction endonucleases cleave outside their recognition sites. We show here the use of BsaI for the generation of unique sticky ends for Step 1 of the Golden Gate assembly protocol. Enzymes BsaI and Esp3I cleave the DNA outside their recognition sites creating unique 4 bp sticky ends useful for ordered ligation (dashed arrows indicate the exact cutting sites). Note that the BsaI recognition sites are left out of the ligated construct. The unique sticky ends are highlighted in colors corresponding to those in Figs. 3 and 5. For the other labels see Fig. 3.

1 ll of 10 ligation/restriction buffer (the buffer quality is crucial, keep aliquots at 80 °C), 5 units of BsaI enzyme and 0.5 ll of T4 DNA ligase. Adjust the reaction volume to 10 ll. (2) Set up restriction/ligation reactions for the second array. If the TALENs are to contain n RVD modules, combine modules p1 to p(n11) (75 ng of each plasmid DNA) together with the

plasmid pFusB(n11) (75 ng). Add 1 ll of ligation/restriction buffer, 5 units of BsaI enzyme and 0.5 ll of T4 DNA ligase. Adjust the reaction volume to 10 ll. (3) Place the tubes in the thermal cycler and run the following cycle: 10  (37 °C/5 min, 16 °C/10 min), 1  (50 °C/5 min) and 1  (80 °C/5 min). (4) Digest all unligated linear DNAs by plasmid-safe nuclease.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

5

Fig. 5. Golden Gate assembly of BLTS-5A. Golden Gate assembly of the TALEN specific for the L half-site is shown in Fig. 2A (TALEN BLTS-5, see [23]). The assembly starts with the selection of plasmids encoding appropriate RVD repeat modules. Step 1 of the construct synthesis contains two separate reactions. In the first one the first 10 modules will be assembled into the pFusA plasmid, whereas the following 4 modules will be cloned into pFusB4. In the second step the two arrays and the terminal module will be released with the restriction enzyme Esp3I and subcloned into the backbone vector pBlue-TAL finally joining the N- and C-terminal parts of TALEN.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

6

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

Fig. 6. TALEN amino-acid sequence for BLTS-5A in pBlue-TAL vector. The sequence starts with a synthetic fragment containing a nuclear localization signal (as described by [17]) followed by the truncated TAL-effector N-terminus (136 amino acids in yellow). The central part consists of 15 repeat modules containing RVDs (highlighted in blue) and 63 amino acids from the TAL-effector C-terminus (in orange). The entire sequence ends with Fok I nuclease domain (grey shading). For more information on BLTS-5A TALEN construction see also Figs. 2A and 5.

(5) Transform competent E. coli cells with an aliquot of ligation mix and plate on spectinomycin dishes with X-gal and IPTG. Incubate overnight at 37 °C. (6) Pick 2–3 white bacterial colonies for each TALEN construct and test for the presence of inserts by colony PCR using primers pCR8_F1 and pCR8_R1 (the PCR product appears smeared in agarose gel electrophoresis) (Fig. 7). (7) Inoculate 1 ml of spectinomycin LB with the positive clones; incubate at 37 °C overnight. 3.3. Second cloning step procedure (2 days) (1) Prepare plasmid DNA of pFusA and pFusB carrying arrays from previous cloning step. (2) Mix restriction/ligation reaction as follows: Plasmid pFusA carrying arrays (75 ng) Plasmid pFusB carrying arrays (75 ng)

Plasmid pLR containing terminal half repeat (75 ng) pBlue-TAL vector (40 ng) 5 units of restriction enzyme Esp3I 0.5 ll of T4 DNA ligase 1 ll of ligation/restriction buffer water to 10 ll. (3) Place the tubes in the thermal cycler and run the following cycle: 6  (37 °C/5 min, 16 °C/10 min), 1  (50 °C/5 min) and 1  (80 °C/5 min). (4) Transform competent E. coli with an aliquot of ligation mix and plate on ampicillin plates with X-gal and IPTG. Incubate overnight at 37 °C. (5) Pick 2–3 white bacterial colonies for each TALEN construct and test for the presence of inserts by colony PCR using primers sTALseqF and TAL_R2 (the PCR product appears smeared in agarose gel electrophoresis). (6) Inoculate 1 ml of ampicillin LB with the positive clones, incubate at 37 °C overnight. (7) Extract plasmid DNA. (8) Use BspEI digestion (BspEI cuts HD modules only) to verify the restriction pattern of individual TALENs (see Fig. 8). (9) Verify the construct by sequencing (optional step).

4. In vitro mRNA synthesis

Fig. 7. Colony screening of TAL repeats assembly in pFusB plasmid using PCR. The insert contains 8 TAL repeats + 2  100 bp of flanking sequences and corresponds to the strongest PCR band (around 1.0 kb).

Capped and polyadenylated RNAs are synthesized using the mMESSAGE mMACHINE T7 Ultra kit (Ambion, Carlsbad, CA, USA), which includes poly(A) tailing and efficient 50 capping procedure, or with the cheaper mMESSAGE mMACHINE T7 kit, which does not include the poly(A) tailing reaction and highly efficient cap structure. Since the pBlue-TAL expression plasmid already contains a poly(A) tract, we routinely use the cheaper kit, without observing significant difference in the efficiency of mutagenesis. We use the manufacturer’s protocol with only slight modifications.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

7

Fig. 9. The silkworm eggs microinjection system with the microscope slide containing 48 embryos arranged for the injection. T – tungsten needle, G – glass capillary, E – embryos.

Fig. 8. Restriction cleavage pattern of individual TALEN constructs after BspEI digestion. TALENs BLTS-4A, BLTS-5A, BLTS-4B, BLTS-5B, RE-A and RE-B are shown (used in [23]). BspEI enzyme cuts only in the DNA sequence coding for the HD modules (except HD1).

4.1. Material HiSpeed plasmid midi kit (Qiagene, Dusseldorf, Germany), Proteinase K (Nakarai, Japan or Life Technologies), mMESSAGE mMACHINE T7 kit (Ambion). 4.2. Procedure (1) Purify each TALEN construct with a HiSpeed plasmid midi kit or equivalent. (2) Linearize 5 lg of each plasmid by digestion with Xba I in an appropriate restriction buffer at 37 °C. (3) Treat the reaction with proteinase K and 0.5% SDS for 30 min at 50 °C. (4) Extract the DNA with phenol/chloroform (equal volumes), precipitate with ethanol, wash with 70% ethanol 3 times, dry and resuspend in RNase-free water supplied with the kit. (5) Use 1 lg of plasmid DNA and add: 10 ll of 2 NTP/CAP, 2 ll 10 reaction buffer, water to 18 ll, 2 ll enzyme mix from the kit. (6) Incubate for 2 h at 37 °C. (7) Precipitate the RNA by adding 30 ll RNase-free water, 30 ll 7.5 M LiCl, chill for 30 min at 20 °C and centrifuge at 16,000g at 4 °C. (8) Wash 3 times with 70% ethanol and air-dry. Resuspend in appropriate RNase-free buffer and adjust its concentration to 1 lg/ll using a spectrophotometer. We usually obtain about 20 lg of RNA. 5. Silkworm mutagenesis 5.1. Silkworm egg microinjection In a typical mutagenesis experiment with insect models the custom-designed nuclease is microinjected as synthetic mRNA into the region of future germ cells formation in an early embryo. B.

mori eggs are relatively large and covered with a hard chorion. The injection system adapted for the silkworm eggs is shown in Fig. 9. The procedure by which the RNA solution is injected through the chorion was described previously [28]. When the eggs are incubated at 25 °C, the zygotic nucleus is formed 2 h after oviposition. Then the syncytium is formed and the nuclei move to the surface of preblastoderm embryo with repeated divisions every hour. The blastoderm forms 12 h after egg-laying. Therefore we usually microinject the RNAs into the eggs 2–6 h after oviposition. The egg has a shape of the letter D and we position the concave dorsal part to the right. We usually arrange 6 rows with 8 eggs per row on a slide using a binocular microscope. For microinjection, the embryo has to be firmly glued to the microscope slide. Our method of microinjection involves first creating a small hole in the egg in the middle of the dorsal region with a tungsten needle and then inserting a fine glass capillary with RNA solution into the opening (Fig. 10). After RNA injection the hole is sealed with cyanoacrylic glue. The observed survival rate of microinjected embryos is usually 20–70%. 5.1.1. Material and equipment Non-diapausing silkworm strain for microinjection, Binocular microscope, Microinjection apparatus (Quick Pro qP-2, Micro support or M152, Narishige), IM300 Microinjector (Narishige) or equivalent, tungsten needle, glass capillary, cyanoacrylic glue (Aron Alpha, Konishi Co, Osaka), 37% Formaldehyde. 5.1.2. Procedure (1) Combine the newly emerged male and female moths and let them mate for at least 4 h at room temperature. Transfer the moths to 5 °C for 1–2 days. Transfer the moths to 25 °C and separate them. Put the females on a paper covered with starch glue in a dark box to lay the eggs (1–2 h). (2) Immerse the egg-covered paper in sterile water for a while and then collect the detached eggs and arrange them on a glass slide with the dorsal side to the right (Fig. 9). After brief drying (10 min at room temperature), fix the embryos to the glass with a tiny drop of cyanoacrylic glue. Dry the glue for 15–30 min and surface sterilize the eggs with 37% formaldehyde vapors for 5 min. The eggs are ready for microinjection. (3) Prepare the capped and poly(A)-tailed mRNA mix for an individual TALEN pair at the concentration of 0.4–1.0 lg/ll in 0.5 mM phosphate buffer (pH 7.0) containing 5 mM KCl on ice.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

8

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

of microinjected embryos. In practice, it is helpful to perform such a pilot test together with the molecular analysis using PCR and examining the frequency of mutant alleles from pooled DNA samples of B. mori eggs to scale up future experiments since the assays in heterologous systems generally bring less relevant information (Fig. 11). To first set up the method in the laboratory, it may be useful to use some visible marker for easy scoring of the results of mutagenesis. We used the B. mori epidermal marker gene, BmBLOS2 [29], which allowed us to detect mosaic epidermis in G0 individuals. Since this gene is located on the Z chromosome, it also allowed us to detect the phenotype of translucent epidermis in G1 females due to the female hemizygosity [13]. 5.2.1. Material and equipment Fluorescent binocular microscope, genomic DNA extraction kit, thermocycler, PCR reagents, restriction enzyme. Fig. 10. Silkworm egg has the shape of the letter D. We positioned the convex dorsal part of the egg to the right. A small hole in the egg was created by a tungsten needle as is obvious from a tiny droplet coming out of the egg. A glass capillary with RNA solution is inserted into the hole.

(4) Punch a small hole into the embryo dorsal side using a tungsten needle. Insert the tip of a glass capillary into the hole and inject 1–5 nl of RNA solution into the embryo (Fig. 10). Seal the small hole with cyanoacrylic glue and sterilize with formaldehyde vapors for 5 min. (5) Incubate the embryos at 25 °C in a humidified chamber. 5.2. TALEN activity assay in silkworm somatic cells Despite the high probability that the new TALENs are functional, a simple test of TALEN activity is still very helpful. Moreover, it can also serve to verify RNA toxicity and/or the condition

5.2.2. Procedure (1) Microinject 40–50 eggs for each of the TALEN pairs, incubate the microinjected embryos for 3 days at 25 °C in a humidified atmosphere (it is possible to score for egg viability by observing the green autofluorescence of living embryos under the fluorescent stereomicroscope equipped with long pass GFP filter). (2) Take 25–50 living eggs for genomic DNA isolation using DNAzol (Life Technologies) or similar DNA extraction kit. (3) Amplify the targeted DNA region from pooled DNA samples by using PCR. Digest the PCR products with restriction enzymes in order to rapidly check TALEN efficiency. An example of results is shown in Fig. 12. (4) Alternatively, the mix of PCR fragments from the previous point can be subcloned into bacteria and clones from individual bacterial colonies analyzed by restriction enzymes

Fig. 11. Schematic diagram of the TALEN activity assays in silkworm embryos. More than 20 microinjected eggs are incubated for 3 days, pooled and used for DNA extraction and PCR amplification of the target area. The PCR product can be analyzed directly by restriction enzymes (PCR pilot test). Alternatively, amplified PCR fragments are inserted to a plasmid using TA cloning. About 50 individual white bacterial colonies are used for another PCR amplification of the target area and those PCR products are digested with restriction enzymes or sequenced to get quantitative data (somatic cell/embryo injection assay).

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

Fig. 12. Restriction analysis of PCR fragments received from TALEN-mutagenized G0 embryos. RE and S2-2 are TALEN targets in the Bm-re and Ser2 B. mori genes, respectively. Cleavage activity of S2-2 TALEN pair is weak. Double bands (marked by arrows) indicate heteroduplexes.

or sequencing in order to get quantitative data. It is usually sufficient to analyze 45–50 randomly picked bacterial clones to obtain several mutant clones. There is a very good correlation between the percentage of mutant clones received in this protocol and the percentage of mutagenized G1 animals [23]. 5.3. Detection of NHEJ mutations in Bombyx germline To get a sufficient number of mutations, it is usually enough to microinject approximately 200 eggs (4 microscopic slides, containing 48 eggs each). Theoretically, it is possible to get several mutations from just a few fertile moths. But the hatchability of the injected eggs varies by the injection and rearing silkworms in a small group decreases the survival rate, especially of 1st and 2nd larval instars. We therefore prefer to rear the silkworms in larger

9

numbers. The embryos are microinjected as described in Section 5. The G0 embryos and larvae are grown to adulthood and used in a cross with the tester wild-type (WT) strain or with their G0 siblings. The G1 progeny of individual parents are kept and analyzed separately. Our earlier results from the mutagenesis of BmBLOS2 and Bm-re Bombyx genes with pBlue-TAL- based constructs showed that 5 out of 6 TALEN pairs were highly efficient and produced 78–100% of yielders and 3–49.9% germ line mutants in G1 [23]. The mosaicism of somatic cells in G0 individuals and the occurrence of the G1 broods from G0 parents with 100% of mutant progeny show that biallelic knockouts are not rare [23]. Since the efficiencies of TALENs in germline cells and somatic cells are well correlated [23], we can predict the efficiency in germline NHEJ mutagenesis from a rapid somatic cell assay. In current experiments we estimated the efficiencies of 13 novel TALENs against 9 other Bombyx genes by embryo assays consisting of genomic PCR, TA cloning, colony PCR and restriction digestion (Fig. 11). We observed a high efficiency of 50–100% mutant clones for 10 TALENs, while one TALEN pair produced 22% mutant clones and 2 TALENs, which target the same exon of a gene, did not work at all. We use two variants of crossing schemes depending on the purpose. When the phenotype of the mutant is predictable and could be easily confirmed, we recommend the first variant, in which G0 siblings are inter-crossed and G1 individuals are subjected to phenotypic screening. Since we often observe 50% or more frequency of NHEJ mutants, it is possible to obtain homozygous mutants already in this generation. The genotype of each G1 individual is checked after screening. This scheme is useful to confirm the function of the gene responsible for pigmentation of eggs, eyes, or larval skins, or for other distinct phenotypes. The second variant consists of crossing the G0 moths with WT individuals, followed by a 2-generation cross in conjunction with genotyping the G1 and G2 individuals. This is recommended for the genes whose functions are unclear or complex and without established screening methods. It is possible to satisfy both needs by performing the second crosses of the male G0 moths with WT females (Fig. 13).

Fig. 13. Detection of mutations in silkworms by DNA analysis. Initially, 25–50 of the G0 eggs are used for a pilot PCR test. If a high frequency of mutations is observed, G0 siblings are used for crossing inter se (left side of the figure). Homozygous mutants can be usually detected in G1 progeny by phenotype or by genotyping. In most cases it is required to construct the homoallelic mutants and the G0 individuals are crossed to WT moths. The G1 eggs are sampled to detect the broods with the high frequency of mutations. The larvae from such broods are genotyped and the G1 individuals with the same genotype are crossed to obtain G2 eggs. The homozygous homoallelic mutants are obtained in G2.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

10

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

Fig. 14. An example of results from silkworm genotyping in two generations. (A) The genotyping in G1 detected double bands of PCR products in 3 individuals suggesting that they represent heterozygotes and therefore contain mutated alleles. Lanes 1–5 show the PCR amplification of DNA containing mutagenized TALEN target areas from individual moths from a single brood; lane C: wild type control; (B) Sequencing of the alleles confirmed the presence of mutations in target areas (C) Lanes 6–11 show the PCR products from the next (G2) generation and contain offsprings of the cross between the two heterozygotes – 3 and 5 shown above. H: heterozygote, M: mutant, W: wild type.

Note: A single injection can produce distinct mutations in clonally independent germ line lineages and each mutation may have different degree of impact on gene activity. Some frame shift mutation may totally disrupt gene activity, while others may produce dominant negative or neomorphic phenotypes. In frame deletion mutation may cause minimal impact (hypomorph). It is therefore recommended to sequence mutant alleles and compare the effects of different homoallelic combinations. 5.3.1. Material Phenol/chloroform, DNAzol (Life Technologies), thermocycler, restriction enzyme. 5.3.2. Procedure (1) Microinject approx. 200 eggs for each of the TALEN pairs. Let the G0 moths develop. Cross the adults individually with their G0 siblings and keep the broods separately. (2) To estimate G1 mutant allele frequency, use 25–50 eggs (3 days old) from each brood for analysis. Isolate genomic DNA from the eggs. Amplify the targeted DNA region by PCR and perform restriction digestion assay. This allows determining the proportion of mutants and finding broods with a high mutation rate. Select broods with high proportion of mutants. (3) Use the G1 individuals of such broods for phenotypic screening and genotyping. A single drop (25–40 ll) of hemolymph from an individual fifth instar larva or an exuvia can be used for genomic DNA extraction for noninvasive genotyping. A leg from a moth or a part of a larval body is also used to isolate DNA using phenol/chloroform extraction followed by ethanol precipitation or a genomic DNA isolation reagent such as DNAzol. Sequence the PCR fragments and analyze the correlation of phenotypes and genotypes (Fig. 13, left side). (If necessary, the heteroallelic mutant strain is obtained by G1 sibling cross.) (4) If the construction of the homoallelic strain is required, it is helpful to use another crossing scheme. Cross the G0 moths with wild type tester strain. Genotype the G1 individuals and

cross them with the G1 siblings carrying the same mutation. Genotype the progeny and obtain homozygous mutants in G2 (Fig. 13, right side and Fig. 14). 6. Mutagenesis in D. melanogaster 6.1. Microinjection of D. melanogaster eggs The microinjection of D. melanogaster eggs is easier than that of silkworm eggs because fly chorion is weaker and can be penetrated by a glass capillary. We use adaptation of the method described by Park and Kim [30]. 6.1.1. Material and equipment Drosophila white1118 strain for microinjection, D. melanogaster tester strains carrying balancer chromosomes, FemtoJet express microinjector (Eppendorf), Narishige capillary puller, DNAzol (Life Technologies). 6.1.2. Procedure (1) Remove freshly laid (30 min.) D. melanogaster eggs from fly food, rinse with distilled water and 70% ethanol. Arrange 50 embryos on a microscope glass with 2% agar in a way so that the posterior end of each egg points slightly out of the glass (about 10% of the egg length). (2) Dissolve the capped and poly(A)-tailed mRNAs encoding TALEN pairs in RNase free 1 PBS buffer (pH 7.0) to a final concentration of 0.5 lg/ll. (3) Microinject 200 eggs with 3–5 nl of RNA solution with thin glass needle through the chorion at the posterior end just deep enough to penetrate the vitelline membrane. Incubate the embryos at 25 °C in humidified atmosphere. (4) After 16 h of incubation, use 25–50 embryos for genomic DNA isolation using DNAzol (Life Technologies) or a similar DNA extraction kit and perform restriction digestion assay. This test will confirm whether TALEN mutagenesis worked. (5) If the result from the previous point was positive, allow the remaining G0 embryos to grow to adulthood.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

11

Fig. 15. TALEN mutagenesis of a Drosophila gene. The crossing scheme is exemplified for a gene on chromosome 2. Part (25–50) of the G0 microinjected Drosophila embryos is used for the PCR analysis to confirm the TALEN function by searching for the loss of a restriction site. The G1 images are crossed individually and genotyped after having offspring. Only those lines bearing mutations (M) are crossed further inter se. The question mark indicates possible mutation. We use Cy0 as balancer 1 and CyO-GFP as balancer 2.

Table 1 Comparison of mutagenesis method used for silkworm versus fruitfly. Step

Bombyx mori

Drosophila melanogaster

Egg microinjection Genotyping Crosses Generation time Lethal mutations

Hard chorion, tungsten needle plus glass capillary, sealing of the hole Noninvasive, droplet of hemolymph, exuvia, or one leg of the moth used No balancer chromosomes, Genotyping needed at each step 45–50 days Genotyping needed for keeping heterozygous mutants

Simple glass capilary microinjection Entire imago used, offsprings need to be kept Balancer chromosomes, genotyping needed at G1 2 weeks Balancer chromosome allows keeping constant heterozygous line

Table 2 Troubleshooting for NHEJ mutagenesis in the silkworm and fluitfly. Problems Problems with Golden Gate assembly

Problems with microinjection Problems with embryo survival No mutations appear Problems with genotyping: lack of DNA

Solution – – – – – – – – –

use fresh buffer, fresh plasmids and efficient enzymes (BsaI and T4 ligase) if there is too much white colonies with artifacts, check the plasmid-safe nuclease use high quality ligase (NEB 400 units/ll or equivalent) use a physiological solution with a food stain in pilot experiments to get a good survival rate and dose delivery, use BmBLOS2, GFP or other marker to establish the method check buffer sterility, compare with physiological solution check the TALEN performance in embryo test check the target site for polymorphism immediately dilute the Bombyx hemolymph specimens after drawing (20 or more) to prevent clotting

6.2. Crossing scheme and screening strategy for D. melanogaster D. melanogaster has an advantage of having balancer chromosomes that prevent crossing over and allow following the mutagenized chromosomes in crosses. Since it is very difficult to perform noninvasive genotyping, molecular analysis is therefore performed using parental flies after they produce enough progeny. The vials with offsprings from parents with PCR-verified mutation are used for further experiments. The overview of the entire procedure is shown in Fig. 15. The comparison of mutagenesis method used

for silkworm versus fruitfly is shown in Table 1 and the troubleshooting in Table 2. Note: We have mutagenized a small (308 bp) Drosophila gene encoding Adipokinetic hormone (AKH), localized on chromosome 3. We estimated the efficiency of the AKH-specific TALEN pair using embryo test and detected 65% of mutant clones. To get a germline mutant, we microinjected 100 eggs and received 84 adult flies, which were crossed to flies carrying two balancers for chromosome 3 (TM3/TM6B). One of the G1 flies carrying a 3 bp deletion was used to establish a mutant strain.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014

12

Y. Takasu et al. / Methods xxx (2014) xxx–xxx

6.3. Procedure (1) Cross 50–100 G0 flies from Section 6.1.2 with flies from appropriate Drosophila tester strain containing a balancer for the mutagenized chromosome. (2) Collect the G1 males or females containing the balancer and cross them individually in separate vials with the second tester strain flies containing a different balancer. (3) When the G2 progeny of such crosses appears, use the individual G1 flies carrying the mutagenized chomosomes for DNA isolation by the ‘‘Fly squishing’’ or the ‘‘Chelex 100’’ methods [31,32]. Perform PCR and restriction analysis to search for the flies carrying the mutation. (4) Select the vials containing the progeny of parents carrying the mutation over the balancer. Cross the siblings from these vials inter se. (5) Check for the viability of homozygous mutants by examining the presence of the flies without the balancer among the G3 progeny (see Fig. 15). (6) If the flies are viable, construct homozygous mutant lines. If the mutation is lethal, keep it in heterozygous form with the balancer.

Acknowledgements This research was supported by KAKENHI Grant Number 23580083 from Japan Society for the Promotion of Science and Grant P305/10/2406 from the Grant Agency of the Czech Republic. We would like to thank Mr. Kaoru Nakamura and Mr. Toshihiko Misawa for embryo microinjection and silkworm rearing, Dr. Hideki Sezutsu for discussion and technical advice, Dr. Qiang Zhang for technical assistance, Vaclav Broz for a photograph and Dr. Keiro Uchino for providing the photos of the microinjection of silkworm embryos. We also thank Dr. Istvan Kiss for critical reading of the manuscript. References [1] [2] [3] [4]

M.R. Capecchi, Nat. Rev. Genet. 6 (2005) 507–512. X. Belles, Annu. Rev. Entomol. 55 (2010) 111–128. M. Bibikova, M. Golic, K.G. Golic, D. Carroll, Genetics 161 (2002) 1169–1175. Y.S. Rong, K.G. Golic, Science 288 (2000) 2013–2018.

[5] A.J. Bogdanove, S. Schornack, T. Lahaye, Curr. Opin. Plant Biol. 13 (2010) 394– 401. [6] M.L. Christian, Z.L. Demorest, C.G. Starker, M.J. Osborn, M.D. Nyquist, Y. Zhang, D.F. Carlson, P. Bradley, A.J. Bogdanove, D.F. Voytas, PLoS One 7 (2012) e45383. [7] M. Jinek, K. Chylinski, I. Fonfara, M. Hauer, J.A. Doudna, E. Charpentier, Science 337 (2012) 816–821. [8] D. Carroll, Nat. Biotechnol. 31 (2013) 807–809. [9] S.W. Cho, S. Kim, Y. Kim, J. Kweon, H.S. Kim, S. Bae, J.S. Kim, Genome Res. 24 (2014) 132–141. [10] A. Aryan, M.A. Anderson, K.M. Myles, Z.N. Adelman, PLoS One 8 (2013) e60082. [11] T. Katsuyama, A. Akmammedov, M. Seimiya, S.C. Hess, C. Sievers, R. Paro, Nucleic Acids Res. 41 (2013) e163. [12] S. Ma, S. Zhang, F. Wang, Y. Liu, H. Xu, C. Liu, Y. Lin, P. Zhao, Q. Xia, PLoS One 7 (2012) e45035. [13] S. Sajwan, Y. Takasu, T. Tamura, K. Uchino, H. Sezutsu, M. Zurovec, Insect Biochem. Mol. Biol. 43 (2013) 17–23. [14] A.L. Smidler, O. Terenzi, J. Soichot, E.A. Levashina, E. Marois, PLoS One 8 (2013) e74511. [15] N. Sun, H. Zhao, Biotechnol. Bioeng. 110 (2013) 1811–1821. [16] T. Watanabe, H. Ochiai, T. Sakuma, H.W. Horch, N. Hamaguchi, T. Nakamura, T. Bando, H. Ohuchi, T. Yamamoto, S. Noji, T. Mito, Nat. Commun. 3 (2012) 1017. [17] J.C. Miller, S. Tan, G. Qiao, K.A. Barlow, J. Wang, D.F. Xia, X. Meng, D.E. Paschon, E. Leung, S.J. Hinkley, G.P. Dulay, K.L. Hua, I. Ankoudinova, G.J. Cost, F.D. Urnov, H.S. Zhang, M.C. Holmes, L. Zhang, P.D. Gregory, E.J. Rebar, Nat. Biotechnol. 29 (2011) 143–148. [18] C. Mussolino, R. Morbitzer, F. Lutge, N. Dannemann, T. Lahaye, T. Cathomen, Nucleic Acids Res. 39 (2011) 9283–9293. [19] L. Cong, R. Zhou, Y.C. Kuo, M. Cunniff, F. Zhang, Nat. Commun. 3 (2012) 968. [20] J. Streubel, C. Blucher, A. Landgraf, J. Boch, Nat. Biotechnol. 30 (2012) 593–595. [21] E.L. Doyle, N.J. Booher, D.S. Standage, D.F. Voytas, V.P. Brendel, J.K. Vandyk, A.J. Bogdanove, Nucleic Acids Res. 40 (2012) W117–W122. [22] F. Heigwer, G. Kerr, N. Walther, K. Glaeser, O. Pelz, M. Breinig, M. Boutros, Nucleic Acids Res. 41 (20) (2013) e190. [23] Y. Takasu, S. Sajwan, T. Daimon, M. Osanai-Futahashi, K. Uchino, H. Sezutsu, T. Tamura, M. Zurovec, PLoS One 8 (2013) e73458. [24] D. Hockemeyer, H. Wang, S. Kiani, C.S. Lai, Q. Gao, J.P. Cassady, G.J. Cost, L. Zhang, Y. Santiago, J.C. Miller, B. Zeitler, J.M. Cherone, X. Meng, S.J. Hinkley, E.J. Rebar, P.D. Gregory, F.D. Urnov, R. Jaenisch, Nat. Biotechnol. 29 (2011) 731– 734. [25] D. Reyon, S.Q. Tsai, C. Khayter, J.A. Foden, J.D. Sander, J.K. Joung, Nat. Biotechnol. 30 (2012) 460–465. [26] F. Zhang, L. Cong, S. Lodato, S. Kosuri, G.M. Church, P. Arlotta, Nat. Biotechnol. 29 (2011) 149–153. [27] T. Cermak, E.L. Doyle, M. Christian, L. Wang, Y. Zhang, C. Schmidt, J.A. Baller, N.V. Somia, A.J. Bogdanove, D.F. Voytas, Nucleic Acids Res. 39 (2011) e82. [28] T. Tamura, N. Kuwabara, K. Uchino, I. Kobayashi, T. Kanda, J. Insect Biotechnol. Sericol. 76 (2007) 155–159. [29] T. Fujii, T. Daimon, K. Uchino, Y. Banno, S. Katsuma, H. Sezutsu, T. Tamura, T. Shimada, Insect Mol. Biol. 19 (2010) 659–667. [30] S. Park, J.K. Kim, Dros. Inf. Serv. 76c (1995) 187–189. [31] G.B. Gloor, C.R. Preston, D.M. Johnson-Schlitz, N.A. Nassif, R.W. Phillis, W.K. Benz, H.M. Robertson, W.R. Engels, Genetics 135 (1993) 81–95. [32] P.S. Walsh, D.A. Metzger, R. Higuchi, Biotechniques 10 (1991) 506–513.

Please cite this article in press as: Y. Takasu et al., Methods (2014), http://dx.doi.org/10.1016/j.ymeth.2014.02.014