Biochimica et Biophysica Acta, 1089( 1991) 345-351

345

© 1991 ElsevierScience PublishersB.V. 0167-4781/91/$03.50 ADONIS 0167478191001730 BBAEXP 92266

The use of genetic engineering to obtain efficient production of porcine pancreatic phospholipase A 2

by Saccharomyces cerevisiae A u g u s t C . A . P . A . B e k k e r s ~, P e e t A . F r a n k e n ~, C a r e l J. V a n d e n B e r g h 2, J o h n M . A . V e r b a k e i 2, H u b e r t u s M . V e r h e i j ~ a n d G e r a r d H . D e H a a s t Department of Enzymology and Protein Engineering, State Unirersity of Utrecht, CBLE, Unil'ersity Centre De Uithof, Utrecht (The Netherlands) and " Unilecer Research Laboratories, l/laardingen (The Netherlands)

(Received27 December 1990)

Key words: (Pro)phospholipaseA2; Secretion:KEX2 ptoteinase:Glycosylation;(Baker'syeast) We have developed an efficient production system for porcine pancreatic phospholipase A , in Saccharomyces cerevisiae (baker's yeast). The cDNA encoding the prophospholipase A z was expressed under the control of the gnlactose inducible GAL7 promotor, and secretion was directed by the secretion signals of yeast invertase. This construct yielded up to 6 mg prophospholipase A 2 activity per ! fermentation broth, secreted as a glycosylated invertase prophospholipase A 2 hybrid protein. Upon genetically deleting the glycosylation site, the level of secretion decreased to 3.6 mg prophospholipase A z per I. Changing the invertose secretion signals for an invertase/a-mating factor prepro sequence.fusion increased the secretion level up to 8 mg per I. The secreted aon-giycosylated prophospholipase A z species was correctly processed. Our results demonstrate the promises and Hmitotions fur rational design to obtain high level expression and secretion of hetorolngous proteins by S. cerev/s/ae.

Introduction Phospholipase A 2 (EC 3.1.1.4; PLA) catalyzes the hydrolysis of the fatty acid ester bonds at the sn-2 position of s n - 3 phospholipids. The enzyme, which is abundant in mammalian pancreatic tissue, snake and bee-venom, has a low molecular mass (14 kDa) and high disulphide content. In contrast to venom PLA, pancreatic PLA is purified as a proenzyme (proPLA). The zymogen is naturally converted into PLA by limited trypsinolysis. Mature PLA displays enzymatic activity toward monomeric and aggregated substrates, whereas proPLA catalyzes only the degradation of monomeric phospholipids. For a recent review on the structure and function of PLAs, see Waite [1].

Abbreviations: PLA, phospholipase A z; a MF, a-mating factor; YPD, yeast pepton dextrose; SDS-PAGE, sodium dodecyl sulfate polyacrylamide electrophoresis; endo H, endo-/3-N-acetylgiucoseaminidase.

Correspondence: H.M. Verheij, Department of Enzymology and Protein Engineering,State Universityof Utrecht, CBLE, University Centre De Uithof, Padualaan 8, 3584 CH Utrecht. The Netherlands.

In our effort to study PLA by protein-engineering using recombinant DNA techniques, the cDNA encoding porcine pancreatic prophospholipase A 2 has been cloned and expressed in Escherichia coil [2] and in S. cerecisiae [3]. in the former case proPLA-hybrid molecules precipitate inside the cell and active enzyme can only be obtained after in vitro reoxidation and chemical or enzymatical cleavage. The yeast-system has the advantage of secretion of active proPLA, yet has the disadvantage of a relatively low yield. Therefore, it was our intention to increase the level of production in yeast using genetic manipulation of the original encoding plasmid [3]. In the yeast expression system used so far, expression of proPLA was controlled by the constitutive a-mating factor ( a M F ) promotor, while secretion of proPLA was directed using the a M F - p r e p r o sequence [4]. The a M F proPLA fusion protein was completely processed in vivo by the KEX2 proteinase resulting in the secretion of up to 650 /tg enzymatically active proPLA species per i fermentation broth. In designing a new expression plasmid, which directs increased production levels, the a priori demand of secretion of the recombinant PLA was maintained.

346 Recent studies on the expression and secretion of heterologous proteins in S. ceret'isiae showed that the level of secretion can be improved by replacing a strong constitutive promotor by an inducible one, which is repressed during the early stages of growth [5,6]. Especially the promotors of the genes coding for enzymes involved in the catabolism of galactose are in use for this purpose [7,8]. These promotors, among others the promotor of the GAL7 gene coding for a-o-galactose-l-phosphate uridylyl transferase [9], are tightly regulated by the presence of galactose in absence of glucose and expression is enhanced 1000-fold Upon switching from growth on glucose to growth on galactose [10]. In a comparative study concerning the effects of different secretory signals upon the efficiency to direct recombinant calf pro-chymosin to the culture medium [12], the secretory signals of yeast invertase [11] were observed to be more effective than the aMF-prepro sequence. In this paper we report the secretion of porcine pancreatic proPLA by S. cerevisiae using the inducible GAL7 promotor and different secretory signals derived from yeast invertase and aMF.

Materials and Methods Strains and culture conditions E. coli K-12 strain PC2494 (A(lac-pro), supE, thi/F',tra D36, proA+ B +, lacl q, lacZAM15; Phabagen collection Utrecht) was used for plasmid constructions. S. cerevisiae strain SU10 (Mata, leu2, ura3, his4), obtained from Unilever Research (EP-A-0255-153), was used as a host for proPLA production. Media, growth conditions and yeast transformation have been used as described earlier by Van den Bergh et al. [3]. For induction of the GAL7 promotor, cells were first cultured in yeast nitrogen base selection medium (20 h), diluted in yeast pepton dextrose (YPD) medium (l:10th) and incubated until late logarithmic phase. Subsequently, proPLA expression was induced by inoculating the YPD culture (l:10th diluted) in YPGal medium ( = yeast pepton medium containing 3% galactose as a carbon source). The optical density of cell cultures was measured at 600 nm with a spectro. photometer (Shimadzu 210uv).

for restriction enzymes were incorporated to enable facile iigation and screening procedures. The doublestranded invertase fragment was divided into seven oligonucleotides (Fig. l) which were synthesized using phosphoroamidites [16]. 50 pmol of oligonucleotides 2-6 were mixed and phosphorylated using T4 polynucleotide kinase. After phenolic extraction and DNA precipitation, 50 pmol of Nos. 1 and 7 were added, and the mixture was annealed. Upon ligation, the DNA fragment corresponding to 141 base pairs was isolated from a 2% agarose gel by electro.elution. The isolated fragment containing the invertase-linker was ligated between the BamHl and HindIll restriction sites of pEMBL9 [17]. This insert was sequenced using smallscale prepared supercoiled plasmid DNA as template, according to Hattori and Sakaki [18]. The (correct) synthetic fragment (Sacl-BamHl digested) was ligated with the proPLA-encoding fragment, derived from pCB06 by B a m H l / H i n d l l l digestion [3], into SacI/HindlI1 digested plasmid pUR2150. This E. coliS. cerevisiae shuttle vector is derived from pUR528-04 [19], and contains, instead of the glyceraldebyde-3phosphate dehydrogenase promotor, a GAL7 promotot which was synthesized by Unilever Research [EPA-0255-153). The final construct was called pCB012 (Fig. 2A). Subsequently, the secretion signal was altered. First both the potential glycosylation site and KEX2-proteinase recognition site were removed. This was done by deleting the Kpnl/BamHl fragment, coding for both processing sites, from the invertase linker region. The deleted invertase linker was cloned in frame with proPLA into pUR2150 yielding pCB014 (details not shown) (Fig. 2B). Secondly, we constructed an invertase-aMF prepro sequence hybrid secretion signal consisting of the 22 amino-terminal amino acids of the invertase prepro-sequence fused to the a M F prepro. sequence-proPLA fusion, derived from pCB08 [3] (details not shown). This construct cloned was cloned into pUR2150, yielding plasmid pCB015. It thus contains the complete invertase signal sequence, followed by a spacer peptide of four amino acids and a truncated a M F prepro-sequence from which the nine amino. terminal amino acids are deleted (Fig. 2C).

Design and construction of the yeast expression plasmids

Purification and analysis of recombinant (pro)PLAsl~,ries

Standard DNA-techniques were used [13]. DNAmodifying enzymes were purchased from Pharmacia and used according to the manufacturer's instructions. The nucleotide sequence of the invertase-linker was deduced from the original cDNA sequence of the SUC2 gene [11]. This invertase-linker also encodes for a KEX2-proteinase recognition site [14]. In those cases where amino acids were substituted, yeast preferred codons [15] were introduced. Recognition sequences

The (pro)PLA-species were purified as described by Van den Bergh et al. [3]. For molecular weight analysis, yeast culture broths were concentrated by trichloroacetic acid (10%) precipitation, and separated by 15°~ sodium dodecyl sulfate-polyacrylamide gel electrcr phoresis (SDS-PAGE) [20]. Further analysis was car. ried out by Western Blotting [21]. Specific antibodie,~ against proPLA were obtained from a caprylic acid precipitated fraction of goat-serum [22] followed by

347 affinity chromatography on an immobilized proPLAsepharose 4B column (Pharmacia) [23]. Western blots were visualized with rabbit anti-goat antibodies coupled to peroxidase (Sigma). Whole cells were analyzed on SDS-PAGE by resuspending washed cells in loading buffer (100 mM Tris (pH 6.8), 3% SDS, 15% glycerol and 10% ~-mercaptoethanol) and lysing the cells by vortexing with glass beads (0.5 h at room temperature). Ph'ter boiling for 5 min, the glass beads were spun down and the supernatant was loaded. SDS gels were sometimes stained by the periodic acid-Schiff procedure in order to detect glycosylated proteins [24,25]. Occasionally, samples from the culture medium or whole cell lysates (in 100 mM Tris (pH 8)) were first treated with trypsin before SDS-PAGE analysis. Treatment of glycosylated proPLA species with endo-g/-Nacetylglucoseaminidase H (endo H), purchased from Boehringer-Mannheim Biochcmicals, was performed according to Trimple and Maley [26].

Results

In order to obtain high level expression and secretion of proPLA in yeast, the eDNA encoding proPLA was ligated downstream from the GAL7 promotor and fused to the invertase secretory signals. A synthetic DNA linker covering the secretory signals derived from yeast invertase was designed (Fig. I), synthesized and inserted between the GAL7 promotor sequence and the proPLA eDNA in pCB012. The resulting invertase-proPLA gene fusion and its expected translation are shown in Figs. IB and 2A. in this construct proPLA is preceded by the invertase signal sequence (from Met -4n to Ala -r3) and the invcrtase aminoterminal decapeptide with a potential glycosylation site at Asn-19. Thus, three potential processing sites are present: for signal peptidase between Ala -23 and Set - ~ , for the KEX2-protcinase after L y s - t 4 - A r g -13 and trypsin between Arg-i and Ala I. Yeast strain SUI0 was transformed with plasmid pCB012 and leucine prototrophs were selected. SUI0 harbouring pCB012 was cultured in YPD medium and expression of proPLA was induced by transfer into galactose containing fermentation broth. After induction, the amount of secreted enzyme was followed by testing the culture medium for proPLA activity. ProPLA activity could be measured after approx. 6 h of induction. After culturing for 96 h the secretion level

Phospholipase assays ProPLA activity was determined spectrophotometricall)' using rac-l,2-diheptanoyl dithiopropane-phosphocholine at pH 8 as a substrate [27], allowing the deterruination of about 0.1 /zg proPLA. After addition of bovine serum albumin to a final concentration of 0.1% and 3 vols ethanol, yeast culture media were conveniently concentrated by centrifugation.

s,~l

A S' 3'

tl)

-

--

GATCCGAGCT CATCACACAA2°ACAAACAAAACAAAATGATG"°CTTTTGC/~G C~CTTCCTTTT~O G C T C G AGTAGTGTGTT TfiTTTGTTTT GTTTTACTAC GAAAACGT'rC GG/UtGGAAAA ~4) ( 2 ) ....

iq,,,

($), (3)

-]

ccTTTTGGCT GGTTTTGCAG~CCAAAATATC TGCCTCCGGT~°°ACCAACGKKA CTTCTGAT~t ' ~ GGAAAACCGA CC.AJ~ACGTC GGTTTTATAG ACGGAGGCCA TGGTTGCTTT GKAG&CT&TT "" ~" - (6~ ~ TCCGGCA CTCTCTTCCT AGGCCGTTCd'°A GAGAGAAGGA

{7)- "'numm

B

, r e cG, ~

-

3'

5'

nah,dtXt

c , r cAc ,ca ~ c . ~

c** . c

~..TG

,T~ err ~rG e .

err ~c

ace . ~

H e t Leu Leu (}In a l a Phe Leu Phe

sis Leu Leu Aim Giy Phe Ala Ala Lys l i e

Ser Ala S e t Gly Thr ~ G l u

Thr S e t Asp Lye

AGA GAa GG~°TCCC~T c~e cAG GA~SGGCate age Tea Ac~°GCA A r g . G l u GIF S e t Gly a l a Gin Glu Gly l i e Set S e t A r g . a l s . . . . . . .

t

QX2'

-io

.~f t~psin'

*!

Cys 12t

F1Jk

Fig. I. (A) Nucleotidc sequence of the .~jnthctic GAL7-invertase-proPLA linker. The synthetic oligonucleotides, which cover the invertase-proPLA fusion, are indicated by the two-headed artows and numbered i to 7. The relevapt recognition sequences and cx)mpatibility of the overhanging 5' ends for restriction endonucleases are denoted. (B) Amino acid sequence of the invertase-proPLA fusion encoded by pCBOI2. Amino acids are numbered relatively to Ala t of mature po~ine PLA. l'he sequence Met-4t---Asp - t~ is derived from yeast invertase, in which Met -2t was replaced for Gly in order to gain a Kpnl restriction-site. The different arrows indicate the presumed proleolytic cleavage sites for signal peptidase, the KEX2-proteinase and trypsin, respectively. The potential glycosylation site is boxed. Further details are described in the text.

348 SP

KEX2

Ir

lvl

A

tl //

SP

tr

!

el

,NV

'-'.~~-~-~:.~.'>.::.':':':':~~":::~.~'.' ......................... ~. . ;. . ~ ' ~ ' ~~ : : _:.~ _ .

SP

C

!

SP

1i1

I INV

v

='uF p,o-wo

v

PLA;

KEX2

tr

1

I

v

~

pCB 014

pCB 015

Fig. 2. Scllcmatic representation of the pro-PLAs encoded by pCB012 (A). pCB014 (B) and I)(,'!3015 (C). The different processing-sites by the signalpeptidase (sp $ ), N-linked glycosylation ( ~ ), KEX2 proteinase (kex2 ,~) and trypsin (tr J, ) are indicated. All constucts are shown on scale; for this rea~an part of the PLAs in A and (," are represented by brackets.

reached a maximum value corresponding to 5.8 mg recombinant proPLA per I (Fig. 3) at an optical density of the cell culture of about 30. To further characterize the secreted enzyme, we investigated culture broth samples by Western blotting, after 96 h of induction (Fig. 4). Although the culture medium contained considerable proPLA activity, only a very faint and broad immunoreactive band could be identified. This band had a wide range in apparent molecular mass corresponding to 70-90 kDa (Fig. 4, lane a). Upon incubation of the same amount of culture broth with trypsin a very intensive and distinct band appeared (Fig. 4, lane b) with the same mobility as the native PLA (Fig. 4, lane e). In this case, the intensity of the PLA band was in good agreement with the measured level of proPLA activity. Clearly, a considerable amount of proPLA is secreted. The Western blot experiments suggest that

100

(i l ° °

this proPLA is glycosylated, hence correct KEX2 processing did not take place. The amount of cell-associated proPLA species was determined in lysed cells. An immunoreactive band migrated as a protein with an apparent molecular mass of about 25 kDa (Fig. 4, lane c), corresponding to a protein with 40-50 additional amino acids as compared to native PLA. Despite the fact that a clear band appeared upon trypsin incubation of the cell lysate (Fig. 4, lane d), with similar electrophoretic behaviour as native PLA, in these preparations no enzymatic

kOa

a

b

c

d

•

f ...,

97 67

43 30 20.1

?

|' I

0

t°I !

I

I

I

20

40

60

80

time(h)

1

I00

Fig, 3. Production of recombinant-proPLA by yeast after induction by 8alactose. Yeast cells (SUI0 car~ing !)(:!3012) were cultured in YPD medium and proPLA-expression was induced by diluting this culture at mid-logarithmic phase in YPGal medium. Details are described in Materials and Methods. After galact~-induction, the cell density was determined by the absorbance at 600 nm (/3) and the fermentatio," broth was assayed for proPLA-activity ( I ) using monomeric substrate,

14.4

Fig. 4. Localisation of yeast-ptoPLA species determined by Western blotting. Yeast strain SUI0 harhouring pCB012 was grown in YPGal medium (Fig. 3). After 96 h of induction a sample of the culture broth (corresponding to 0.2 /~g proPLA-activity) was analysed by Western blotting either directly (lane a) or after treatment with trypsin (lane b). Whole cells were lysed with glass beads and an aliquot (corresponding to ! ml culture) was loaded (lane c). Lysed cells treated with trypsin are shown in lane d. PLA (0.2 /tg) and proPLA (0.2 p.g) purified from porcine pancreas, were applied to lanes e and f, respectively. (Pro)PLA bands were visualized by immunoblot using goat anti-proPLA antibodies and horse radish peroxidase coupled to anti-goat IgG; see Materials and Methods and Ref. 3. Protein molecular mass markers are as indicated.

349 activity could be measured (data not shown). Based upon the intensities on the Western blot shown in Fig. 4 lanes b and c, it was estimated that the amounts of proPLA that were secreted or remained inside the yeast cell are similar. The purification of proPLA from 10 1 culture broth, containing 58 mg proPLA, was started by acidifying the broth to pH 3.5 and adsorption to SP-sephadex. Only 35.4 mg (61%) of the total secreted proPLA-activity could be bouno, even after repeatedly applying the acidified broth to SP-sephadex. Elution of adsorbed proPLA activiw was performed at pH 5.0 with a NaCigradient: the resulting elution pattern vs. proPLA activity is shown in Fig. 5A. ProPLA eluted in two fractions: 32.5 mg at low salt (peak A I) and 1.2 mg at higher salt (peak A 2) concentration. The latter peak corresponds to the expected eluting position for a proPLA. The protein fractions from the SP-sephadex fractionation were analyzed on SDS-PAGE. The bulk of the enzyme, residing at peak A m, shows weak highmolecular mass protein bands on SDS-PAGE (Fig.

.10.6 0.3

i '

"~ B

-":=.

i

/

K" ." "o\

0.6? 0.3 v

If

.J

a. ~

C

:

~

0.6

0.3

lO 2o 30 4o FRACl'ION N ~

so

Fig. 5. (A, B. C) Purificationof invertase-proPLAspeciesby SP-Sephadex chromatography. 10-1culturebroth of SUI0 hadxmringeither PCB012(A), pCB014(B) or pCB015(C) was acidifiedto pH 3.5 and loaded on SP-Sephadex. Elution was performed at pll 5.0 with a linear salt gradient reaching 0A M. Panel A shows the elution pattern of pCB012-encodedproPLA, panel B that of pCB014-encoded proPLA and panel C that of pCB015-e,vcodedproPLA. The proPLA-activity([3) and the absorbance at 280 pm( ) are depicted: a.u.. arbitraryunits.

kDa 94 - 67 I , ,

a

b

c

d

•

43 a m

,-"43

30 20

14.4

kl)a ----94 -,,,-67

,m30 I,~

I

ma,

*,,*,20

14.4

Fig. 6. Analysesof secreted invertase-proPLAprotem~directed by pCB012, after elutionfrom SP-Sephadexby SDS-PAGE.Aliquotsof the protein fractions from SP-Sephadex (corresponding to 2 ,ttg 9roPLA-activity)were loaded on SDS-PAGE,lane a shows proPLA species coming from the low salt fraction (At). A sample derived from peak A t treated withendo H is shownin lane b. A samplefrom the high salt fraction(A2) is shown in lane c. Native PLA (lane e) and its zymogen(lane d) are shown. A sample from peak A t was assayed for the presence of oligosaccharideswLh the periodicacidSchiff method [24,25): lane f. Relativemolecularmass markers(MS) are indicated: protein bands were visualised by Fast-Green. For details see Materialsand Methods.

6A), resembling the Western Blot analysis results (Fig. 4a). A similar broad range in apparent molecular mass was observed with secreted yeast invertase where this was shown to be the consequence of a varying degree of mannose outer chain addition [28]. The high molecular mass bands were strongly coloured by the Schiff reagent (Fig 6f), indicating the presence of oligosaccharides. Therefore, an aliquot of peak-A, fraction was treated with endo H, which preferentially hydrolyses N-linked oligosaccharides of the high-mannose type [26]. This resulted in a protein that migrated on SDSPAGE as a sharp band with an apparent molecular mass of approx. 22 kDa (Fig. 613). A protein of this size corresponds to a PLA species with about 20 additional amino acids as compared to native PLA (Fig. 6e), which is the size of the protein to b e expected after cleavage by the signal peptidase. The proPLA species from peak A 2 showed a slightly lower electrophoretic mobility as native proPLA, suggesting a correct cleavage by the KEX2-proteinase (Fig. 6(:). From these results it was concluded that the bulk of the secreted proPLA activity corresponded to an invertase-proPLA fusion protein which is (N-) glycosylated, probably a t Asn-,9 (see Fig. 2A). The short distance between this glycosylation site and the KEX2 processing site may be responsible for the low efficacy of processing at the latter site. in order to circumvent problems caused by glycosylation, we followed two strategies. First, we removed both the potential glycosylation as well as the KEX2

350 processing site, thus applying as sole secretion signal the invertase signal sequence. The resulting plasmid pCB014 is schematically represented in Fig. 2B. Secondly, we enlarged the distance between the potential glycosylation and the KEX2 processing sites. This construct, called pCB015, applies the invertase signal sequence and part of the a M F prepro-sequence as a secretion signal. It contains two signalpeptidase processing sites, one in the invertase linker and one in the a M F prepro sequence [3,4], three potential glycosylation sites and a KEX2 processing site. The distance between the KEX2 and the most proximate glycosylation site in this construct is 18 amino acids. A schematic representation of this construct is shown in Fig. 2C. Yeast strain SU10 was transformed wi~h plasmids pCB014 and pCB015 and leucine prototrophs were selected. SU10 harbouring pCB014 and pCB015 were cultured in YPD medium and expression of proPLA was induced by transferring cultures into galactooe containing fermentation broth. Growth of both cultures was similar compared to SU10 cells harbouring pCB012. After induction, the amount of secreted enzyme was followed in time and shown to be similar to pCB012 (see Fig. 3). However, a difference in the absolute amounts of secreted proPLA was observed. At similar optical densities of the cell cultures the final production level was about 3.6 rag/! for pCB014 and about 7.9 mg/l for pCB015. It was of interest to determine whether these recombinant proteins were efficiently processed. Gel electropholcsis of trichloroacetic acid precipitated culture samples showed sharp bands with a slightly lower electrophoretic mobility as native proPLA (data not shown), which is as expected. The electrophoretic mobility of these bands changed towards that of native PLA upon tryptic incubation of the culture medium, whereas the intensities of these bands did not change, suggesting that in both cases the bulk of the proPLA present in the culture medium is non-glycosylated. This result is as anticipated since pCB014 was designed in such a way that glycosylation of the protein was prevented and pCB015 in such a way that efficient processing would occur, hence all proPLA is non-glycosylated. In agreement with this is the fact that now nearly quantitative adsorption of proPLA activity to SP-sephadex was easy to accomplish, in the case of pCB014 coded proPLA expression, all activity was adsorbed by SP-sephadex. Only one peak of proPLA activity was found, in the high salt fractions, when the proPLA activity resulting from pCB014 was eluted (Fig. 5B). A small amount of proPLA activity directed by pCB015 (about 3%) was not adsorbed to SP-Sephadex. Elution of the proPLA activity shows the bulk of activity ( > 95%) in a high salt peak. Also a small low salt fraction, containing very little amount of proPLA activity (about 2%) could be found (Fig. 5C). Thus, qualitatively pCB012 and

pCB015 controlled proPLA secretion are equal in the sense that both constructs provide two types of proPLA, a glycosylated and a non-glycosylated species, but the relative amount of glycosylated vs. non-glycosylated proPLA differs significantly (compare Fig. 5A, C). The moot straightforward explanation for this phenomenon is that in the case of the pCB015 construct KEX2 processing is efficient, where it is not in the case of the pCB012 construct. Discussion

For the production of recombinant pancreatic phospholipases A 2 using S. cerevisiae as a hoot system, two strategies have been utilized. First, Van den Bergh et al. [3] applied the constitutive aMF-promotor and secretion signals for the production of pocine pancreatic proPLA. Secondly, Tanaka et al. [29] used the inducible PHOS-promotor in combination with the canine pancreatic phospholipase A 2 signal sequence for the production of (mature) bovine PLA. We have succeeded in developing a new expression system for porcine pancreatic proPLA with increased, up to 10fold higher, production levels as compared to the system described earlier [3]. Replacement of the (constitutive) promotor and secretion signals of the yeast a M F by the (inducible) galactose GAL7 promotor in combination with yeast invertase secretion signals resulted in a secretion up to a level of 5.8 mg proPLA per l. A similar increase of production has been observed for the expression/secretion of bovine pancreatic proPLA by yeast: the production level ranged from approx. 100 /zg recombinant bovine proPLA per I controlled by a M F sequences (Y. Ota, personal communication), to 2.8 mg/I under control of the inducible PHOS-promotor [29]. The GALT-invertase-proPLA fusions used in the current studies, directed about 50% of the total amount of produced proPLA to the culture broth. However, enzymatic activity was only recovered in culture medium, not inside the cell. This is in agreement with studies showing that heterologous enzymes produced in yeast are often intracellularly deposited in an inactive form [12,30]. In the case of the pCB012 directed proPLA secretion, the observed glycooylated invertase-proPLA fusion protein is the result of the absence of KEX2processing. In trying to explain why KEX2-cleavage did not occur several factors could contribute. One of these factors is the possible saturation of the secretion pathway. We think that this explanation is unlikely, because for other heteroiogous proteins (e.g., /i-endolphin and calcitonin [31] and insufin-like growth factor [32]) with comparable levels of secretion, accurate KEX2-processing has been reported. A second possible explanation could be a shielding effect by the

351 c a r b o h y d r a t e - c h a i n a t t a c h e d to A s n - ~o of the invertase p r o P L A fusion towards the KEX2-recognition site (at Lys- t4-Arg-13 ~, Fig. 2A). T h e latter explanation was tested by designing a novel p r o P L A - e n c o d i n g plasmid, t h a t contains a glycosylation site m o r e r e m o t e from the KEX2-site ( c o m p a r e pCB012 a n d pCB015). T h i s construct i n d e e d directs t h e secretion of correctly KEX2processed p r o P L A . A t the same time a higher secretiou level of a b o u t 7.9 m g / I was observed. T h e efficient m o d e o f processing o f p r e p r o P L A directed by t h e a M F p r e p r o s e q u e n c e is i n d e p e n d e n t of t h e use of promotor, since b o t h the a M F p r o m o t o r [3] a n d t h e G A L 7 p r o m o t o r yield qualitatively a n equally processed p r o P L A species. Removal o f the glycosylation-site a n d the KEX2processing site (pCB014) resulted in a d r o p of t h e secretion to 3.6 m g / l . A s s u m i n g no effects o n t h e t r a n s c r i p t i o n / t r a n s l a t i o n level, a more rapid d e g r a d a tion of the p r o P L A in the secretion pathway g e n e r a t e d by t h e removal o f t h e oligosaccharide chain could b e t h e cause of t h e lowered secretion level. However, it is clear t h a t glycosylation is n o t a prerequisite for secretion, which already could b e c o n c l u d e d from t h e results of T a n a k a et ai. [29]. T h e s e a u t h o r s used t h e signal s e q u e n c e of c a n i n e p a n c r e a t i c P L A without a glycosylation o r KEX2-processing site as a sole secretion signal for t h e efficient secretion o f r e c o m b i n a n t bovine PLA. A difference b e t w e e n o u r p r e s e n t work a n d the results o f T a n a k a e t al. is t h e observation t h a t we d e t e c t e d only secretion o f p r o P L A , w h e r e a s T a n a k a f o u n d a mixture o f p r o P L A a n d m a t u r e PLA. A possible explanation of t h e partial conversion o f p r o P L A to P L A could b e t h e p r e s e n c e o f a trypsin-like p r o t e i n a s e in t h e yeast-secretory pathway o f the strains used by t h e s e authors, which a p p a r e n t l y is a b s e n t in o u r strain. Such a difference might b e explained by the different genetic b a c k g r o u n d of the yeast strains used in the two expression systems. W e have succeeded in developing a n efficient production system for porcine pancreatic p r o P L A in S. cerevisiae. The d e v e l o p m e n t of such systems is a prerequisite for t h e availability of r e c o m b i n a n t p r o t e i n s used in a large diversity o f biochemical a n d biophysical experiments. T h e system described here has b e e n successfully used in the p r o d u c t i o n of several genetically e n g i n e e r e d P L A species [33]. Agkmm4ed~ments W e t h a n k C. Pals for t h e synthesis o f the oligonucleotides, N. V a n G a l e n for drawings, A. N o o r l a n d t for typing a n d N. O v e r b o c k e a n d C.T. Verrips (Unilever R e s e a r c h , V l a a r d i n g e n , T h e N e t h e r l a n d s ) for t h e i r contribution. N.W.O. ( D u t c h O r g a n i s a t i o n for t h e A d v a n c e m e n t of P u r e Science) is acknowledged for financial support.

References 1 Waite. M. (1987) in Handbook of Lipid Research, Vol. 5 (Hanahan. DJ., ed.), Plenum Press. New York. 2 De Geus, P., Van den Bergh, C.J.. Kuipers, O., Verheij, H.M., Hoekstra, W.P.M. and De Haas. G.H, 0987) Nucleic Acids Res. 15, 3743-3759. 3 Van den Bergh, CJ.. Bekkers. A.C.A.P.A.. De Geus. P., Verheij, H.M. and De Haas, G.H. {1987) Eur. J. Biochem. 170, 241-246. 4 Kurjan. J. and Herskowitz, I. (1982) Cell 30, 933-943. 5 Ernst, J.F. 0986) DNA 5, 483-491. 6 Price, V., Mochizuki, D., March, CJ., Deeley, M.C., Klinke, R., Clevenger, W., Gillis, S.. Baker, P. and Urdal, P. (1987) Gene 55, 287-293. 7 Schultz, LD,, Hofman. K.J., Mylin, L.M., Montgomery, D.L., Ellis, R.W. and Hopper, J.E. (1987) Gene 61,123-133. 8 Shaw, K.J., Frommer, B.R,, Anagnost, J.A., Narula, S. and Leibowitz, PJ. (1988) DNA 7, 117-126. 9 Nogi, Y. and Fukasawa. T. (1983) Nucleic Acids Res. 11, 85558568. 10 St. John. T.P. and Davis, R.W. (1981) J. MOl. Biol. 152, 285-315. I1 Taussig, R. and Carlson, M. (1983) Nucleic Acid Res. 11, 19431955. 12 Smith. R.A., Duncan, MJ. and Moir, D.T. 0985) Science 229, 1219-1224. 13 Maniatis. T, Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory, New York. 14 Fuller, R., Brake, A. and Thorner, J. (1986) Microbioiogy, 273278. 15 Sharp, P. (1986) Nucleic Acids Res, IL 5125-5143. 16 Sinha, N.D., Blernat. J. and K6ster, H. (1983) Tetrahedron Len. 24, 5843-5846. 17 Dente, L., Cesareni, G. and Cortese, R. (1986) Nucleic Acid Res. 11, 1645-1655. 18 Hattori, M. and Sakaki, Y. (1986) Anal. Biochem. 152. 232-238. 19 Edens, L, Born, l., Ledeboer, A.M, Maat, J., Toonen. M.Y., Visser. Chr. and Verrips. C.T. 0984) Cell 37, 629-633. 20 Lugtenberg, B.. Meyers, L., Peters. R., Van der Hoek, P. and Van Alphen. L. (1975) FEBS Lett. 58, 254-258. 21 Burnette, W.N. (1981) Anal. Biochem. 112, 195-203. 22 Steinbach, N. and Adriaan, R. 0969) Arch. Biochem. Biophys. 134, 279-284. 23 March. S.C., Parikh, L and Cuatrecasas, P. (1974) Anal. Biochem. 60, 149-152. 24 Zacharius, R.M., Zeli, T.E., Morrison, J.M. and Woodlock, JJ. (1969) P.naL Biochem. 30, 148-152. 25 Fairbanks, G.. Steck. T.L. and Wallach, D.F.H. (1971) Biochemistry 10, 2606-2617. 26 Trimble. R.B. and Maley. F. (1984) Anal. Biochem. 141,515-522. 27 Volwerk, JJ., Dedleu. A.G.R., Verheij, H.M, Dijkman, R. and De Haas. G.H. (1979) RecL Tray. Chim. Pays-Bas 98, 214-220. 28 Ziegler, F.D.. Maley, F. and Trimble, R.B. (1988) J. Biol. Chem. 263, 6986-6992. 29 Tanaka, T, Kimura, S. and Ota, Y. (1~8) Gene 64, 257-264. 30 Cousens, L.S~ Shuster, J.IL, Callegos, (2., Ku, L., Stempien, M.M. Urdea, M.S., Sanchcz-Pescndor, M., Taylor, A. and Tekaml~Olsen, P. (1987) Gene 61. 265-275. 31 Zsebo, K.M., Lu, H.S., Fieschko, J.C., Goldstein. L., Dadt, J., Duker, K., Suggs, S.V., LaL P.H. and Bitter, G.A. (lq~6) J. Biol. Chem. 261, 5858-5865. 32 Elaine, M.L, Applebaum, J., C'hicchi, G.G., H a i r , N.S. Green, B.G. and Cascieri, M.A. (1988) Gene 66, 235-244. 33 Weiss, J , Wright, G. Bekkers, A.C.A.P.A., Van den Berg,h, CJ. and Verheij, H.M. (1991) J. Bi~. Chem. 266, 4162-4167.