YEAST
VOL.
7: 693-698 (199 1)
The Ureidoglycollate Hydrolase (DAL3)Gene in Saccharomyces cerevisiae HYANG SOOK YOO* AND TERRANCE G. COOPER? Department of Microbiology and Immunology. University of Tennessee, Memphis, Tennessee 38163, U . S . A .
Received 29 March 1991; accepted 3 April 1991
The DAL3 gene has been sequenced and found to encode a 195 amino acid protein with a molecular weight of 21 727. The four carboxy-terminal amino acids of DAL3 product (Cys-Ile-Ile-Ile)are homologous to those (CAAX) previously shown to be the primary structural signal for post-translational farnesylation of yeast RAS protein and mating factor. This modification is reported to be responsible for membrane localization of proteins containing it. The upstream region of DAL3 contains six copies of a sequence that is homologous to the positively acting D A L UAS,,, reported to be required for transcriptional activation of the DALS and DAL7 genes. Missing from the DAL3 upstream region werc any sequences related to those shown to be required for a DAL7 response to inducer, the UZS element. This correlates with the previous report that DAL3 expression is independent of the allantoin pathway inducer. KEY WORDS - Succharomyces
INTRODUCTION
cerevisiae; protein sorting; post-translational modification; allantoin pathway.
responses to inducer are differing compositions of cis-acting elements in their 5' flanking regions. Genes associated with the allantoin catabolic Only a single element, UAS,,, has been found pathway have been used for some time to study the upstream of DALS and its function in heterologous mechanisms of regulated gene expression and expression vectors has been shown to be inducer metabolic integration in yeast. The nine structural independent (Rai et al., 1989). DAL7, on the other genes share in common a high sensitivity to nitrogen hand, has been reported to possess three different catabolite repression, which has been shown to cis-acting elements (Yo0 and Cooper, 1989). In occur at the level of transcription (Cooper, 1982; addition to UAS,,,, a negatively acting element Yo0 et a/., 1985; Rai et al., 1987; Genbauffe and (URS) and one required for response to inducer Cooper, 1986). Correlated with this sensitivity has (UIS) have been reported to occur upstream of been the finding that expression of the two best- DAL7. Response to inducer and operation of the studied genes, DALS and DAL7, depends upon the UIS element in heterologous expression vector same upstream activation sequence, UAS,,, which systems has been shown to require the DAL8I and possesses the sequence GATAA at its core (Rai et DAL82 gene products (Turoscy and Cooper, 1982; a/., 1989; Yo0 and Cooper, 1989). Cooper et a/. Turoscy et al., 1984; Bricmont and Cooper, 1989; (1 989) have shown that UAS,, is necessary and Oliveet al., 1991; Bricmont et al., 1991).The DAL81 sufficient for transcriptional sensitivity to nitrogen product is likely to be a general transcription factor catabolite repression and requires a functional since it is also required for expression of other GLN3 product for its operation (Cooper et al., inducible genes associated with nitrogen catabolism 1990). The DALS and DAL7 genes differ in their in yeast (Bricmont et al., 1991; Coornaert et al., response to the allantoin pathway inducer. DALS 1991). DAL82, on the other hand, appears to be transcription is independent of inducer, while allantoin pathway specific and a good candidate for inducer is required for DAL7 expression (Rai et al., the gene product that interacts with the UZSelement 1987; Yo0 et al., 1985). Correlated with the upstream of the inducible D A L genes (Olive et al., 1991). *Present address: Genetic Engineering Research Institute, Korea The purpose of this work is to test further Institute of Science and Technology, Daeduk Science Town, the suggestion that expression characteristics of Daejeon, Korea. tcorresponding author. allantoin system genes are correlated with the 0749%503X/91/07069346 $05.00 0 199 I by John Wiley & Sons Ltd
1
694
H. S. YO0 AND T. G. COOPER
AvaI
Hindlll
3
Aval
%
z ' 1
Hindlll
I
1
Hinfl
pTC7 pTC12
1-1
PVT6
Figure 1. Restriction map of the DAL gene cluster on the right arm of chromosome IX along with the inserts of recombinant plasmids previously shown to contain this region (Yo0 et al., 1985). Also shown is the Maxam-Gilbert sequence strategy by which the sequence of the DALS gene and its flanking sequences were determined. Filled circles and closed squares indicate radioactive labeling at the 5' and 3' termini, respectively.
presence of cis-acting elements situated in their upstream region (Rai et al., 1989; Yo0 and Cooper, 1989). The DAL3 gene encoding ureidoglycollate hydrolase, the third enzymatic step in allantoin degradation, has been cloned as part of the D A L gene cluster on the right arm of chromosome IX (Yo0 et al., 1985). Ureidoglycollate hydrolase production has been previously measured and found to be independent of inducer, but sensitive to nitrogen catabolite repression (Cooper, 1982; Yo0 et al., 1985). If the above correlations are physiologically significant, the upstream region of DAL3 would be expected to contain multiple copies of the UAS,,, element in a manner similar to that observed for DALS. The UZS element required for response to inducer, on the other hand, would not be expected to be present. To test this idea, we sequenced the DAL3 gene and its flanking sequences. The results of those sequence studies support the correlation we have reported earlier.
METHODS The plasmids and cloning methods used in this work have been described by Yo0 et al. (1985). Yeast strains and medium used in this work have been described by Chisholm and Cooper (1 982). Maxam and Gilbert (1977) sequencing procedures and S1 nuclease mapping methods have been described by Genbauffe and Cooper (1986). The G C G DNA sequence analysis programs have been used for sequence analysis. RESULTS AND DISCUSSION Nucleotide sequence of the DAL3 gene The 1.8 kb HindIII-Sac1 fragment from the right end of plasmid pTC7 (Figure 1) contains the entire DAL3 gene and was used to generate a high resolution restriction map. Using this information and the Maxam-Gilbert strategy depicted in Figure 1, we determined the nucleotide sequence of DAL3
UREIDOGLYCOLLATE HYDROLASE GENE IN YEAST
and its flanking regions. Both strands of DNA were completely sequenced and every restriction site used for primary or secondary digestion and/or for labelling purposes was crossed. The nucleotide and deduced amino acid sequences of the DAL3 gene are presented in Figure 2. An open reading frame of 585 bp ending with a single stop codon was observed. The amino acid sequence deduced from the open reading frame predicts that it encodes a 195 amino acid protein with a calculated molecular weight of 21 727 and ap , of 5 2 . The four carboxy-terminal amino acids of DAL3 product are Cys-Ile-Ile-Ile (Figure 2, boldly underlined). The motif CAAX, where A indicates an aliphatic residue and X any residue, has been shown to be the primary structural signal for posttranslational farnesylation or other prenylation of proteins containing it (Glomset et al., 1990; Lowry and Willumsen, 1989). The first reported yeast protein with this modification was mating factor from Rhodosporidium toruloides (Kamiya et al., 1978). Protein-linked farnesyl groups were subsequently reported for S. cerevisiae mating factor and RAS protein. Mutations affecting this post-translational modification were demonstrated to result in loss of mating factor and RAS function (Treston and Mulshine, 1989; Schafer et al., 1989;Anderegg et al., 1988; Power et al., 1986). The long chain, thiolinked prenyl group, most often farnesol, is suggested to mediate attachment of the protein containing it to the cell membrane. The finding of this structural motif in ureidoglycollate hydrolase raises the possibility that this enzyme is membrane found. The DAL7 product, which is highly homologous to malate synthase, contains the carboxyterminal sequence Ser-Lys-Leu (Yo0 and Cooper, 1989). This tripeptide has been reported to be the structural signal targeting proteins to the peroxysome (Gould et al., 1987, 1988, 1989). These observations raise the strong possibility that at least some of the allantoin catabolic enzymes are membrane bound or sequestered in the peroxysome. Termini of DAL3 transcripts
To identify the 5' terminus of DAL3 transcripts, we radioactively labeled a 2 10 bp HinfI-DdeI DNA fragment. The separated strands were hybridized to 15 micrograms of poly At RNA isolated from wild-type strain M970 grown in minimal glucose allantoin medium. A similar experiment was performed using 8 micrograms of poly A' RNA derived from da180 mutant strain M1081 grown in
695 minimal glucose proline medium. After hybridization, the reaction mixture was treated with 1200 units of SI nuclease at 15,23 and 37"C, respectively, and the protected fragments resolved on a 10% polyacrylamide-urea sequencing gel. At 15 and 23"C, four protected fragments terminating at positions -9 to - 12 were observed (lanes E to G, Figure 3 left panel). However, at 37°C the species terminating at position - 12 predominated. When RNA derived from the da180 mutant, in which DAL3 mRNA levels are much higher, was used, only two species terminating at positions - 12 and - 13 were observed (data not shown). No protected species were observed when the other strand of DNA was used for hybridization, or RNA was omitted from the reaction mixture (data not shown). Sequences homologous to DAL gene regulatory elements upstream of DAL3 DAL3 gene expression has been shown to be independent of the allantoin pathway inducer, but sensitive to nitrogen catabolite repression. Therefore, we expected to find sequences homologous to the UAS,, upstream of DAL3. UAS,,, which possesses the core sequence GATAA, has been found upstream of every DAL gene studied thus far and has been shown to be necessary and sufficient for sensitivity to nitrogen catabolite repression (Cooper et al., 1989; Rai et al., 1989; Yo0 and Cooper, 1989). Six sequences homologous to UAS,, were observed upstream of the TATAA box at positions - 75 to - 69 (underlined, Figure 2). Also located upstream of DAL3 was a nearly perfect consensus sequence for the upstream repression sequence ( U R S l )(bracketed in the 5' region, Figure 2), which has been shown to negatively regulate CAR1 expression (Sumrada and Cooper, 1987; Luche et al., 1990). The observation that DAL3 expression was independent of the allantoin pathway inducer led to the expectation that the DAL UIS element, previously shown to be required for response to inducer, would not be present upstream of DAL3. This was found to be the case. Substrates for the first three enzymatic steps of allantoin degradation, allantoinase, allantoicase and ureidoglycollate hydrolase are structurally similar. Therefore, we searched for regions of structural similarities in the primary sequences of the enzymes catalysing these reactions. Extensive amino acid similarity was observed between residues 1 to 150 of the DAL3 peptide and residues 150 to 300 of the DAL2 gene product.
-420* -400*
-380'
-360*
GATCTAGTCTTAACGACCCCAAGAACG -340'
ACTGTTGATCAAGCGCCGCTGTCCTTTT~GGCTTTCGGCGGCGTATTTTCTGGTTTAGA~CACCCATTT~ -320* -300* -280* -260* TGTTGAGTTTTTTGTCATGATCCACGATAT~GAAATACGACATTTCTAGGGTAACATCAGAATGCCCTTGC~T -240* -220* -200' -180' A T T G T T A G G G T T A T T T T C T A G A A T T T T G G A A A T A A T G -160" -140* -120* -loo*
+
C C A G A T A A G A T A A G A T G G A T T G G C A A A T A A A T G G G G A A A G
-8O* -60* -40* -20* TTCATGTGCATTCGCATATATAAGTCAGTAACTGTCATCCAA~GCTCTTGATGCTTATCTTGTA~TCTT
J.
20' 40' TGAAGCAAAGATATG GTG ACC GTG GTG GCG GAG ACA TTG ACG AAA GAG TCC TTC GAG GAG TAT M e t V a l T h r V a l V a l Ala G l u Thr Leu Thr L y s G l u Ser Pha G l u G l u Tyr
60* 80' loo* GGG ACG ATA ATT TCG CCA GAT GAA GAG ATT TCA AGG ATG CAA AAC CTT GAA AAA GGT GCA G l y Thr I l e I l e Ser P r o Aap G l u G l u 11s Ser A r g Mot G l n A s n Leu G l u Lys G l y Ala
120' 140* 160* AAC CAG GGA ACA GCG ATC AAA TTG CTT CAA GTA AGC CAG GTA GAG AAT AAA TCT ACC AGT A s n G l n G l y T h r Ala I l e L y s Leu L e u G l n V a l Ser G l n V a l G l u Aan L y s S e r T h r Sor 180* 200* 220* AAA GTT CCC AAT TGG AAC CTA TTC CGT TGC TTT CCA CAG CCG CAC CTG AAT AGA GTA TTC L y s V a l P r o A s n T r p Aan L e u Phe Arg C y s Phe P r o G l n P r o His Leu A s n A r g V a l Phe 240* 260* 280* ACT CAA GGC TCC AAT CAG GCG ATT TCT CAT TCT ATC AAA GTC CTC GAA AAG CAT CCG TGT T h r G l n G l y Ser Aan G l n A l a I l e Ser His Ser I l e L y s V a l L e u G l u L y s His P r o C y s 300* 320f 340* AGT ACG CAG ACG TTT GTG CCT ATG GGG AGA ACG TCA GCG GAA GTA GCA TAC TTG GTA GTA Ser Thr G l n T h r Phe V a l P r o M e t G l y Arg T h r S e r Ala G l u V a l Ala Tyr Leu V a l V a l 360* 380* 400* GTC GCT AAA GAA ATT GGA AAT AAG CCA GAC TTG TCT ACG TTG AGG GCT T T T ACA TGT TTG V a l Ala L y s G l u I l e G l y Aan Lys P r o A s p Leu Ser Thr Leu A r g Ala Phe T h r C y s L e u 420* 440* 460* GGT AAT CAG GCC GTT ACC TAT GGC TTA GGT ACC TGG CAT GCG CCC ATG ATA GTA CTT GGC G l y Asn G l n A l a V a l Thr T y r G l y L e u G l y T h r T r p His Ala P r o M e t 110 V a l Leu G l y 480* 500* 520* AAG GAA GAA CAT TTG GAT TTT TCA GTC TTA ATC TAC GAA AGT CTG GAC CCT GAC AGG CCC L y s G l u G l u His Leu Aap Phe Ser V a l Leu I l e T y r G l u Ser Leu Asp P r o A s p Arg P r o 540* 560' 580* GAG AAG GAC TGT GTG GAA GAA CAC TAC AGC GAT GGC GAC GTT TGT ATT ATC ATC TAATTCT G l u L y s A s p C y s V a l G l u G l u His Tyr S e r A s p G l y Asp V a l C y s I l e I l e I l e ***
600' 620* 640* 660* GCGACTGTGGGCGAAGTAAATATGTAAATGTTCATGTATTAGTAATTTCATAGG~TACGATT~GACAT~TCTC 680* 700* 720* 740* C G C T G A A A G T T G C G G T G C G A T A G A A T A C C G C ~ T T T T G G T T T 800* 760' 780*
+ DAL7
CATAAGTTTTGGCTTA~TTGGATAAGGTACATCGTGAAAGTATCACAAAGATTGGA~TTTCGTC
Figure 2. Nucleotide sequence of the D A W gene and its flanking sequences. The TATA sequence is boldly underlined. Sequences with homology to the D A L UAS,,, are underlined with a single line, and those homologous to the DAL UISaredoubly underlined. The vertical arrows indicate the termini of the principal 5' Sl protection fragments described in the text. The sequence that is homologous of the CARI WRSI is bracketed. The prenylation signal sequence is boldly underlined in the amino acid sequence. Accession NO. M64778.
697
UREIDOGLYCOLLATE HYDROLASE GENE IN YEAST
chromosome IX. Correlated with this finding was the observation of a URSI site in the DAL3 upstream region. Genetic analysis will be required to determine the validity of this correlation. ACKNOWLEDGEMENTS We thank members of the University of Tennessee yeast group who read the manuscript and offered suggestions for its improvement. This work was supported by Public Health Service grants GM20693 and GM-35642.
-12
REFERENCES
Anderegg, R. J., Betz, R., Carr, S. A., Crabb, J. W. -9 and Duntze, W. (1988). Structure of Saccharomyces cerevisiae mating hormone a-factor. Identification of Sfarnesyl cysteine as a structural component. J . Biol. Chem. 263,18236-18240. Bricmont, P. A. and Cooper, T. G. (1989). A gene product needed for induction of allantoin system genes in Saccharomyces cerevisiae but not for their transcriptional activation. Mol. Cell. Biol. 9,3869-3877. Bricmont, P. A., Daugherty, J. R. and Cooper, T. G. (1991).The DAL81 gene is required for induced expression of two differently regulated nitrogen catabolic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 1161-1 166. Chisholm, G. and Cooper, T. G. (1982). Isolation and characterization of mutants that produce the allantoin A B C D E F G degrading enzymes constitutively in Saccharomyces Figure 3. Autoradiograph of the S1 nuclease protected fragcerevisiae. Mol. Cell. Biol. 2, 1088-1095. ments used to determine the 5’ termini as described in the text. Poly A + RNA (15 micrograms) was hybridized to the 5’-32P-Cooper, T. G. (1982). Nitrogen metabolism in Saccharomyces cerevisiae. In Strathern, J. N., Jones, E. W. and labeled DNA probe at 66°C. Following S1 treatment as described Broach, J. (Eds), The Molecular Biology of the Yeast in the text, the protected fragments were resolved on an 8% polyacrylamide sequencing gel along with the products of Saccharomyces. Metabolism and Gene Expression. Maxam-Gilbert sequence reactions. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 39-99. Cooper, T. G., Ferguson, D., Rai, R. and Bysani, N. The data presented in this work show ureidogly(1990). The GLN3 gene product is required for collate hydrolase to be a relatively small protein in transcriptional activation of allantoin system gene yeast. Comparisons with ureidoglycollate hydrolase expression in Saccharomyces cerevisiae. J. Bacteriol. sequences from other organisms are not possible at 172,1014-1018. this time because this is the first report of a sequence Cooper, T. G., Rai, R. and Yoo, H . 3 . (1989). Requirefor this enzyme. The transcriptional regulatory elment of upstream activation sequence for nitrogen ements found upstream of DAL3 correlate well with catabolite repression of the allantoin system genes observed characteristics of its expression. Sensiin Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 544&5444. tivity to nitrogen catabolite repression predicted that multiple copies of the WAS,, element Coornaert, D., Vissers, S. and Andre, B. (1991). The pleiotropic UGA35 (DURL) regulatory gene of Sacwould be found and they were. Inducer indepencharomyces cerevisiae: cloning, sequence and identity dence predicted a lack of allantoin pathway-specific with theDAL81 gene. Gene97,163-171. DAL UIS sequences and none were observed. A Genbauffe, F. S. and Cooper, T. G. (1986). Induction and third interesting characteristic of DAL3 expression repression of the urea amidolyase gene in Succharomay also be explained by the sequence data we myces cerevisiae. Mol. Cell. Biol. 6,3954-3964. obtained. Yo0 e t al. (1985) found DAL3 mRNA Glomset, J. A., Gelb, M. H. and Farnsworth, C. C. was present at extremely low levels compared to (1990). Prenyl proteins in eukaryotic cells: a new type of all of the other genes in the D A L cluster on membrane anchor. Trends Biochem. Sci. 15,139-142.
698 Gould, S. J., Keller, G. A. and Subramani, S. (1987). Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J . Cell. Biol. 105, 2923-293 1. Gould, S. J., Keller, G. A. and Subramani, S. (1988). Identification of peroxisomal targeting signals located at the carboxy terminus of four peroxisomal proteins. J . Cell. Biol. 107,897-905. Gould, S. J., Keller, G. A., Hosken, N., Wilkinson, J . and Subramani, S. (1989). A conserved tripeptide sorts proteins to peroxisomes. J . Cell. Biol. 108, 1657-1664. Kamiya, Y., Sakurai, A., Tamura, S. and Takahashi, N. (1978). Structure of Rhodotorucine A, a novel lipopeptide inducing mating to formation and Rhodosporidium toruloides. Biochem. Biophys. Res. Commun. 83, 1077- 1083. Lowry, D. R. and Willumsen, B. M. (1989). New clue to Ras lipid glue. Nuture 341,384-385. Luche, R. M., Sumrada, R. and Cooper, T. G. (1990). A cis-acting element present in multiple genes serves as a repressor protein binding site for the yeast C A R f gene. Mol. Cell. Biol. 10, 3884-3895. Maxam, A. M. and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74, 56&564. Olive. M. G., Daugherty, J. R. and Cooper, T. G. (1991). DAI.82, a second gene required for induction of allantoin system gene transcription in Saccharomyces cerevisiae. J . Bactcriol. 173,255-26 1. Powers, S., Michaelis, S., Broek, D., Santa Anna, S. A., Field, J., Herskowitz, 1. and Wigler, M . (1986). RAM, a gene of yeast required for a functional modification of
H.S. Y O 0 AND T. G . COOPER
RAS proteins and for production of mating pheromone a-factor. Cell47,413422. Rai, R., Genbauffe, F. S., Lea, H. Z. and Cooper, T. G. (1987). Transcriptional regulation of the DALS gene in Saccharomyces cerevisiae. J . Bucteriol. 169,3521-3524. Rai, R., Genbauffe, F. S., Sumrada, R. A. and Cooper, T. G. (1989). Identification of sequences responsible for transcriptional activation of the allantoate permease gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 602-608. Schafer, W. R., Kim, R., Sterne, R., Thorner, J., Kim, S. H. and Rine, J. (1989). Genetic and pharmacological suppression of oncogenic mutations in RAS genes of yeast and humans. Science 245,379-385. Sumrada, R. A. and Cooper, T. G. (1987). Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast. Proc. Natl. Acad. Sci. USA 8 4 , 3 9 9 7 4 0 I . Treston, A. M. and Mulshine, J. L. (1989). Beyond transcriptional events. Nature 337,406. Turoscy, V. and Cooper, T. G. (1982). Pleiotropic control of five eukaryotic genes by multiple regulatory elements. J . Bacreriol. 151, 1237-1 246. Yoo, H . 4 . and Cooper, T. G. (1989). The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene's expression. Mol. Cell. Biol. 9,3231-3243. Yoo, H.-S., Genbauffe, F. S. and Cooper, T. G. (1985). Identification of the ureidoglycollate hydrolase gene in the DA L gene cluster of Succharomyces cerevisiae. Mol. Cell. B i d . 5,2279-2288.
VOL.
7: 693-698 (199 1)
The Ureidoglycollate Hydrolase (DAL3)Gene in Saccharomyces cerevisiae HYANG SOOK YOO* AND TERRANCE G. COOPER? Department of Microbiology and Immunology. University of Tennessee, Memphis, Tennessee 38163, U . S . A .
Received 29 March 1991; accepted 3 April 1991
The DAL3 gene has been sequenced and found to encode a 195 amino acid protein with a molecular weight of 21 727. The four carboxy-terminal amino acids of DAL3 product (Cys-Ile-Ile-Ile)are homologous to those (CAAX) previously shown to be the primary structural signal for post-translational farnesylation of yeast RAS protein and mating factor. This modification is reported to be responsible for membrane localization of proteins containing it. The upstream region of DAL3 contains six copies of a sequence that is homologous to the positively acting D A L UAS,,, reported to be required for transcriptional activation of the DALS and DAL7 genes. Missing from the DAL3 upstream region werc any sequences related to those shown to be required for a DAL7 response to inducer, the UZS element. This correlates with the previous report that DAL3 expression is independent of the allantoin pathway inducer. KEY WORDS - Succharomyces
INTRODUCTION
cerevisiae; protein sorting; post-translational modification; allantoin pathway.
responses to inducer are differing compositions of cis-acting elements in their 5' flanking regions. Genes associated with the allantoin catabolic Only a single element, UAS,,, has been found pathway have been used for some time to study the upstream of DALS and its function in heterologous mechanisms of regulated gene expression and expression vectors has been shown to be inducer metabolic integration in yeast. The nine structural independent (Rai et al., 1989). DAL7, on the other genes share in common a high sensitivity to nitrogen hand, has been reported to possess three different catabolite repression, which has been shown to cis-acting elements (Yo0 and Cooper, 1989). In occur at the level of transcription (Cooper, 1982; addition to UAS,,,, a negatively acting element Yo0 et a/., 1985; Rai et al., 1987; Genbauffe and (URS) and one required for response to inducer Cooper, 1986). Correlated with this sensitivity has (UIS) have been reported to occur upstream of been the finding that expression of the two best- DAL7. Response to inducer and operation of the studied genes, DALS and DAL7, depends upon the UIS element in heterologous expression vector same upstream activation sequence, UAS,,, which systems has been shown to require the DAL8I and possesses the sequence GATAA at its core (Rai et DAL82 gene products (Turoscy and Cooper, 1982; a/., 1989; Yo0 and Cooper, 1989). Cooper et a/. Turoscy et al., 1984; Bricmont and Cooper, 1989; (1 989) have shown that UAS,, is necessary and Oliveet al., 1991; Bricmont et al., 1991).The DAL81 sufficient for transcriptional sensitivity to nitrogen product is likely to be a general transcription factor catabolite repression and requires a functional since it is also required for expression of other GLN3 product for its operation (Cooper et al., inducible genes associated with nitrogen catabolism 1990). The DALS and DAL7 genes differ in their in yeast (Bricmont et al., 1991; Coornaert et al., response to the allantoin pathway inducer. DALS 1991). DAL82, on the other hand, appears to be transcription is independent of inducer, while allantoin pathway specific and a good candidate for inducer is required for DAL7 expression (Rai et al., the gene product that interacts with the UZSelement 1987; Yo0 et al., 1985). Correlated with the upstream of the inducible D A L genes (Olive et al., 1991). *Present address: Genetic Engineering Research Institute, Korea The purpose of this work is to test further Institute of Science and Technology, Daeduk Science Town, the suggestion that expression characteristics of Daejeon, Korea. tcorresponding author. allantoin system genes are correlated with the 0749%503X/91/07069346 $05.00 0 199 I by John Wiley & Sons Ltd
1
694
H. S. YO0 AND T. G. COOPER
AvaI
Hindlll
3
Aval
%
z ' 1
Hindlll
I
1
Hinfl
pTC7 pTC12
1-1
PVT6
Figure 1. Restriction map of the DAL gene cluster on the right arm of chromosome IX along with the inserts of recombinant plasmids previously shown to contain this region (Yo0 et al., 1985). Also shown is the Maxam-Gilbert sequence strategy by which the sequence of the DALS gene and its flanking sequences were determined. Filled circles and closed squares indicate radioactive labeling at the 5' and 3' termini, respectively.
presence of cis-acting elements situated in their upstream region (Rai et al., 1989; Yo0 and Cooper, 1989). The DAL3 gene encoding ureidoglycollate hydrolase, the third enzymatic step in allantoin degradation, has been cloned as part of the D A L gene cluster on the right arm of chromosome IX (Yo0 et al., 1985). Ureidoglycollate hydrolase production has been previously measured and found to be independent of inducer, but sensitive to nitrogen catabolite repression (Cooper, 1982; Yo0 et al., 1985). If the above correlations are physiologically significant, the upstream region of DAL3 would be expected to contain multiple copies of the UAS,,, element in a manner similar to that observed for DALS. The UZS element required for response to inducer, on the other hand, would not be expected to be present. To test this idea, we sequenced the DAL3 gene and its flanking sequences. The results of those sequence studies support the correlation we have reported earlier.
METHODS The plasmids and cloning methods used in this work have been described by Yo0 et al. (1985). Yeast strains and medium used in this work have been described by Chisholm and Cooper (1 982). Maxam and Gilbert (1977) sequencing procedures and S1 nuclease mapping methods have been described by Genbauffe and Cooper (1986). The G C G DNA sequence analysis programs have been used for sequence analysis. RESULTS AND DISCUSSION Nucleotide sequence of the DAL3 gene The 1.8 kb HindIII-Sac1 fragment from the right end of plasmid pTC7 (Figure 1) contains the entire DAL3 gene and was used to generate a high resolution restriction map. Using this information and the Maxam-Gilbert strategy depicted in Figure 1, we determined the nucleotide sequence of DAL3
UREIDOGLYCOLLATE HYDROLASE GENE IN YEAST
and its flanking regions. Both strands of DNA were completely sequenced and every restriction site used for primary or secondary digestion and/or for labelling purposes was crossed. The nucleotide and deduced amino acid sequences of the DAL3 gene are presented in Figure 2. An open reading frame of 585 bp ending with a single stop codon was observed. The amino acid sequence deduced from the open reading frame predicts that it encodes a 195 amino acid protein with a calculated molecular weight of 21 727 and ap , of 5 2 . The four carboxy-terminal amino acids of DAL3 product are Cys-Ile-Ile-Ile (Figure 2, boldly underlined). The motif CAAX, where A indicates an aliphatic residue and X any residue, has been shown to be the primary structural signal for posttranslational farnesylation or other prenylation of proteins containing it (Glomset et al., 1990; Lowry and Willumsen, 1989). The first reported yeast protein with this modification was mating factor from Rhodosporidium toruloides (Kamiya et al., 1978). Protein-linked farnesyl groups were subsequently reported for S. cerevisiae mating factor and RAS protein. Mutations affecting this post-translational modification were demonstrated to result in loss of mating factor and RAS function (Treston and Mulshine, 1989; Schafer et al., 1989;Anderegg et al., 1988; Power et al., 1986). The long chain, thiolinked prenyl group, most often farnesol, is suggested to mediate attachment of the protein containing it to the cell membrane. The finding of this structural motif in ureidoglycollate hydrolase raises the possibility that this enzyme is membrane found. The DAL7 product, which is highly homologous to malate synthase, contains the carboxyterminal sequence Ser-Lys-Leu (Yo0 and Cooper, 1989). This tripeptide has been reported to be the structural signal targeting proteins to the peroxysome (Gould et al., 1987, 1988, 1989). These observations raise the strong possibility that at least some of the allantoin catabolic enzymes are membrane bound or sequestered in the peroxysome. Termini of DAL3 transcripts
To identify the 5' terminus of DAL3 transcripts, we radioactively labeled a 2 10 bp HinfI-DdeI DNA fragment. The separated strands were hybridized to 15 micrograms of poly At RNA isolated from wild-type strain M970 grown in minimal glucose allantoin medium. A similar experiment was performed using 8 micrograms of poly A' RNA derived from da180 mutant strain M1081 grown in
695 minimal glucose proline medium. After hybridization, the reaction mixture was treated with 1200 units of SI nuclease at 15,23 and 37"C, respectively, and the protected fragments resolved on a 10% polyacrylamide-urea sequencing gel. At 15 and 23"C, four protected fragments terminating at positions -9 to - 12 were observed (lanes E to G, Figure 3 left panel). However, at 37°C the species terminating at position - 12 predominated. When RNA derived from the da180 mutant, in which DAL3 mRNA levels are much higher, was used, only two species terminating at positions - 12 and - 13 were observed (data not shown). No protected species were observed when the other strand of DNA was used for hybridization, or RNA was omitted from the reaction mixture (data not shown). Sequences homologous to DAL gene regulatory elements upstream of DAL3 DAL3 gene expression has been shown to be independent of the allantoin pathway inducer, but sensitive to nitrogen catabolite repression. Therefore, we expected to find sequences homologous to the UAS,, upstream of DAL3. UAS,,, which possesses the core sequence GATAA, has been found upstream of every DAL gene studied thus far and has been shown to be necessary and sufficient for sensitivity to nitrogen catabolite repression (Cooper et al., 1989; Rai et al., 1989; Yo0 and Cooper, 1989). Six sequences homologous to UAS,, were observed upstream of the TATAA box at positions - 75 to - 69 (underlined, Figure 2). Also located upstream of DAL3 was a nearly perfect consensus sequence for the upstream repression sequence ( U R S l )(bracketed in the 5' region, Figure 2), which has been shown to negatively regulate CAR1 expression (Sumrada and Cooper, 1987; Luche et al., 1990). The observation that DAL3 expression was independent of the allantoin pathway inducer led to the expectation that the DAL UIS element, previously shown to be required for response to inducer, would not be present upstream of DAL3. This was found to be the case. Substrates for the first three enzymatic steps of allantoin degradation, allantoinase, allantoicase and ureidoglycollate hydrolase are structurally similar. Therefore, we searched for regions of structural similarities in the primary sequences of the enzymes catalysing these reactions. Extensive amino acid similarity was observed between residues 1 to 150 of the DAL3 peptide and residues 150 to 300 of the DAL2 gene product.
-420* -400*
-380'
-360*
GATCTAGTCTTAACGACCCCAAGAACG -340'
ACTGTTGATCAAGCGCCGCTGTCCTTTT~GGCTTTCGGCGGCGTATTTTCTGGTTTAGA~CACCCATTT~ -320* -300* -280* -260* TGTTGAGTTTTTTGTCATGATCCACGATAT~GAAATACGACATTTCTAGGGTAACATCAGAATGCCCTTGC~T -240* -220* -200' -180' A T T G T T A G G G T T A T T T T C T A G A A T T T T G G A A A T A A T G -160" -140* -120* -loo*
+
C C A G A T A A G A T A A G A T G G A T T G G C A A A T A A A T G G G G A A A G
-8O* -60* -40* -20* TTCATGTGCATTCGCATATATAAGTCAGTAACTGTCATCCAA~GCTCTTGATGCTTATCTTGTA~TCTT
J.
20' 40' TGAAGCAAAGATATG GTG ACC GTG GTG GCG GAG ACA TTG ACG AAA GAG TCC TTC GAG GAG TAT M e t V a l T h r V a l V a l Ala G l u Thr Leu Thr L y s G l u Ser Pha G l u G l u Tyr
60* 80' loo* GGG ACG ATA ATT TCG CCA GAT GAA GAG ATT TCA AGG ATG CAA AAC CTT GAA AAA GGT GCA G l y Thr I l e I l e Ser P r o Aap G l u G l u 11s Ser A r g Mot G l n A s n Leu G l u Lys G l y Ala
120' 140* 160* AAC CAG GGA ACA GCG ATC AAA TTG CTT CAA GTA AGC CAG GTA GAG AAT AAA TCT ACC AGT A s n G l n G l y T h r Ala I l e L y s Leu L e u G l n V a l Ser G l n V a l G l u Aan L y s S e r T h r Sor 180* 200* 220* AAA GTT CCC AAT TGG AAC CTA TTC CGT TGC TTT CCA CAG CCG CAC CTG AAT AGA GTA TTC L y s V a l P r o A s n T r p Aan L e u Phe Arg C y s Phe P r o G l n P r o His Leu A s n A r g V a l Phe 240* 260* 280* ACT CAA GGC TCC AAT CAG GCG ATT TCT CAT TCT ATC AAA GTC CTC GAA AAG CAT CCG TGT T h r G l n G l y Ser Aan G l n A l a I l e Ser His Ser I l e L y s V a l L e u G l u L y s His P r o C y s 300* 320f 340* AGT ACG CAG ACG TTT GTG CCT ATG GGG AGA ACG TCA GCG GAA GTA GCA TAC TTG GTA GTA Ser Thr G l n T h r Phe V a l P r o M e t G l y Arg T h r S e r Ala G l u V a l Ala Tyr Leu V a l V a l 360* 380* 400* GTC GCT AAA GAA ATT GGA AAT AAG CCA GAC TTG TCT ACG TTG AGG GCT T T T ACA TGT TTG V a l Ala L y s G l u I l e G l y Aan Lys P r o A s p Leu Ser Thr Leu A r g Ala Phe T h r C y s L e u 420* 440* 460* GGT AAT CAG GCC GTT ACC TAT GGC TTA GGT ACC TGG CAT GCG CCC ATG ATA GTA CTT GGC G l y Asn G l n A l a V a l Thr T y r G l y L e u G l y T h r T r p His Ala P r o M e t 110 V a l Leu G l y 480* 500* 520* AAG GAA GAA CAT TTG GAT TTT TCA GTC TTA ATC TAC GAA AGT CTG GAC CCT GAC AGG CCC L y s G l u G l u His Leu Aap Phe Ser V a l Leu I l e T y r G l u Ser Leu Asp P r o A s p Arg P r o 540* 560' 580* GAG AAG GAC TGT GTG GAA GAA CAC TAC AGC GAT GGC GAC GTT TGT ATT ATC ATC TAATTCT G l u L y s A s p C y s V a l G l u G l u His Tyr S e r A s p G l y Asp V a l C y s I l e I l e I l e ***
600' 620* 640* 660* GCGACTGTGGGCGAAGTAAATATGTAAATGTTCATGTATTAGTAATTTCATAGG~TACGATT~GACAT~TCTC 680* 700* 720* 740* C G C T G A A A G T T G C G G T G C G A T A G A A T A C C G C ~ T T T T G G T T T 800* 760' 780*
+ DAL7
CATAAGTTTTGGCTTA~TTGGATAAGGTACATCGTGAAAGTATCACAAAGATTGGA~TTTCGTC
Figure 2. Nucleotide sequence of the D A W gene and its flanking sequences. The TATA sequence is boldly underlined. Sequences with homology to the D A L UAS,,, are underlined with a single line, and those homologous to the DAL UISaredoubly underlined. The vertical arrows indicate the termini of the principal 5' Sl protection fragments described in the text. The sequence that is homologous of the CARI WRSI is bracketed. The prenylation signal sequence is boldly underlined in the amino acid sequence. Accession NO. M64778.
697
UREIDOGLYCOLLATE HYDROLASE GENE IN YEAST
chromosome IX. Correlated with this finding was the observation of a URSI site in the DAL3 upstream region. Genetic analysis will be required to determine the validity of this correlation. ACKNOWLEDGEMENTS We thank members of the University of Tennessee yeast group who read the manuscript and offered suggestions for its improvement. This work was supported by Public Health Service grants GM20693 and GM-35642.
-12
REFERENCES
Anderegg, R. J., Betz, R., Carr, S. A., Crabb, J. W. -9 and Duntze, W. (1988). Structure of Saccharomyces cerevisiae mating hormone a-factor. Identification of Sfarnesyl cysteine as a structural component. J . Biol. Chem. 263,18236-18240. Bricmont, P. A. and Cooper, T. G. (1989). A gene product needed for induction of allantoin system genes in Saccharomyces cerevisiae but not for their transcriptional activation. Mol. Cell. Biol. 9,3869-3877. Bricmont, P. A., Daugherty, J. R. and Cooper, T. G. (1991).The DAL81 gene is required for induced expression of two differently regulated nitrogen catabolic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 1161-1 166. Chisholm, G. and Cooper, T. G. (1982). Isolation and characterization of mutants that produce the allantoin A B C D E F G degrading enzymes constitutively in Saccharomyces Figure 3. Autoradiograph of the S1 nuclease protected fragcerevisiae. Mol. Cell. Biol. 2, 1088-1095. ments used to determine the 5’ termini as described in the text. Poly A + RNA (15 micrograms) was hybridized to the 5’-32P-Cooper, T. G. (1982). Nitrogen metabolism in Saccharomyces cerevisiae. In Strathern, J. N., Jones, E. W. and labeled DNA probe at 66°C. Following S1 treatment as described Broach, J. (Eds), The Molecular Biology of the Yeast in the text, the protected fragments were resolved on an 8% polyacrylamide sequencing gel along with the products of Saccharomyces. Metabolism and Gene Expression. Maxam-Gilbert sequence reactions. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 39-99. Cooper, T. G., Ferguson, D., Rai, R. and Bysani, N. The data presented in this work show ureidogly(1990). The GLN3 gene product is required for collate hydrolase to be a relatively small protein in transcriptional activation of allantoin system gene yeast. Comparisons with ureidoglycollate hydrolase expression in Saccharomyces cerevisiae. J. Bacteriol. sequences from other organisms are not possible at 172,1014-1018. this time because this is the first report of a sequence Cooper, T. G., Rai, R. and Yoo, H . 3 . (1989). Requirefor this enzyme. The transcriptional regulatory elment of upstream activation sequence for nitrogen ements found upstream of DAL3 correlate well with catabolite repression of the allantoin system genes observed characteristics of its expression. Sensiin Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 544&5444. tivity to nitrogen catabolite repression predicted that multiple copies of the WAS,, element Coornaert, D., Vissers, S. and Andre, B. (1991). The pleiotropic UGA35 (DURL) regulatory gene of Sacwould be found and they were. Inducer indepencharomyces cerevisiae: cloning, sequence and identity dence predicted a lack of allantoin pathway-specific with theDAL81 gene. Gene97,163-171. DAL UIS sequences and none were observed. A Genbauffe, F. S. and Cooper, T. G. (1986). Induction and third interesting characteristic of DAL3 expression repression of the urea amidolyase gene in Succharomay also be explained by the sequence data we myces cerevisiae. Mol. Cell. Biol. 6,3954-3964. obtained. Yo0 e t al. (1985) found DAL3 mRNA Glomset, J. A., Gelb, M. H. and Farnsworth, C. C. was present at extremely low levels compared to (1990). Prenyl proteins in eukaryotic cells: a new type of all of the other genes in the D A L cluster on membrane anchor. Trends Biochem. Sci. 15,139-142.
698 Gould, S. J., Keller, G. A. and Subramani, S. (1987). Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J . Cell. Biol. 105, 2923-293 1. Gould, S. J., Keller, G. A. and Subramani, S. (1988). Identification of peroxisomal targeting signals located at the carboxy terminus of four peroxisomal proteins. J . Cell. Biol. 107,897-905. Gould, S. J., Keller, G. A., Hosken, N., Wilkinson, J . and Subramani, S. (1989). A conserved tripeptide sorts proteins to peroxisomes. J . Cell. Biol. 108, 1657-1664. Kamiya, Y., Sakurai, A., Tamura, S. and Takahashi, N. (1978). Structure of Rhodotorucine A, a novel lipopeptide inducing mating to formation and Rhodosporidium toruloides. Biochem. Biophys. Res. Commun. 83, 1077- 1083. Lowry, D. R. and Willumsen, B. M. (1989). New clue to Ras lipid glue. Nuture 341,384-385. Luche, R. M., Sumrada, R. and Cooper, T. G. (1990). A cis-acting element present in multiple genes serves as a repressor protein binding site for the yeast C A R f gene. Mol. Cell. Biol. 10, 3884-3895. Maxam, A. M. and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74, 56&564. Olive. M. G., Daugherty, J. R. and Cooper, T. G. (1991). DAI.82, a second gene required for induction of allantoin system gene transcription in Saccharomyces cerevisiae. J . Bactcriol. 173,255-26 1. Powers, S., Michaelis, S., Broek, D., Santa Anna, S. A., Field, J., Herskowitz, 1. and Wigler, M . (1986). RAM, a gene of yeast required for a functional modification of
H.S. Y O 0 AND T. G . COOPER
RAS proteins and for production of mating pheromone a-factor. Cell47,413422. Rai, R., Genbauffe, F. S., Lea, H. Z. and Cooper, T. G. (1987). Transcriptional regulation of the DALS gene in Saccharomyces cerevisiae. J . Bucteriol. 169,3521-3524. Rai, R., Genbauffe, F. S., Sumrada, R. A. and Cooper, T. G. (1989). Identification of sequences responsible for transcriptional activation of the allantoate permease gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 602-608. Schafer, W. R., Kim, R., Sterne, R., Thorner, J., Kim, S. H. and Rine, J. (1989). Genetic and pharmacological suppression of oncogenic mutations in RAS genes of yeast and humans. Science 245,379-385. Sumrada, R. A. and Cooper, T. G. (1987). Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast. Proc. Natl. Acad. Sci. USA 8 4 , 3 9 9 7 4 0 I . Treston, A. M. and Mulshine, J. L. (1989). Beyond transcriptional events. Nature 337,406. Turoscy, V. and Cooper, T. G. (1982). Pleiotropic control of five eukaryotic genes by multiple regulatory elements. J . Bacreriol. 151, 1237-1 246. Yoo, H . 4 . and Cooper, T. G. (1989). The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene's expression. Mol. Cell. Biol. 9,3231-3243. Yoo, H.-S., Genbauffe, F. S. and Cooper, T. G. (1985). Identification of the ureidoglycollate hydrolase gene in the DA L gene cluster of Succharomyces cerevisiae. Mol. Cell. B i d . 5,2279-2288.
