Curr Microbiol (2014) 69:703–707 DOI 10.1007/s00284-014-0642-4

The Truncated Major Pilin Subunit Sbp2 of the srtBCD Pilus Cluster Still Contributes to Streptococcus suis Pathogenesis in the Absence of Pilus Shaft Jing Shao • Wei Zhang • Zongfu Wu Chengping Lu

•

Received: 14 March 2014 / Accepted: 13 May 2014 / Published online: 3 July 2014 Ó Springer Science+Business Media New York 2014

Abstract Streptococcus suis serotype 2 (SS2) is an emerging zoonotic agent responsible for a number of infections in pigs and humans. Pili have been proposed as virulence factors in Gram-positive bacteria. However, due to the abolition of pili production, the function of the srtBCD pilus cluster, especially the truncated major pilin subunit Sbp2 (Sbp20 , Sbp200 ), has not been explored. In this study, isogenic mutants (Dsbp20 , Dsbp200 ) were constructed by homologous replacement in SS2 strain P1/7. Deletion of sbp20 attenuated the virulence in a zebrafish model as shown by more than an eightfold increase in the LD50 of Dsbp20 , compared with that of the parent strain. In addition, the adhesion of Dsbp20 to HEp-2 cell monolayers decreased significantly. Compared with the parent strain, no obvious differences in virulence and adherence efficiency were observed for Dsbp200 . Our data suggest that Sbp20 could be involved in SS2 pathogenesis despite absence of its pilus shaft.

Electronic supplementary material The online version of this article (doi:10.1007/s00284-014-0642-4) contains supplementary material, which is available to authorized users. J. Shao  W. Zhang  Z. Wu  C. Lu (&) Key Lab of Animal Bacteriology, Ministry of Agriculture, Nanjing 210095, China e-mail: [email protected] J. Shao  W. Zhang  Z. Wu  C. Lu OIE Reference Laboratory for Swine Streptococcosis, Nanjing 210095, China

Introduction Streptococcus suis (SS) is a major swine pathogen that causes a variety of serious diseases, including meningitis, septicemia, endocarditis, and sudden death [5, 10, 14]. Among the 33 serotypes based on capsular antigens that have been described, serotype 2 (SS2) is the most virulent and most frequently isolated serotype. SS2 can also affect humans in close contact with diseased pigs or swine products [1, 2, 17]. Although a set of virulence factors have been identified, the pathogenic mechanisms of SS2 are still unclear [5]. Gram-positive pili are covalently linked polymers of protein subunits, which contain a single major pilin subunit to form the pilus backbone, as well as one or more minor (or ancillary) pilin subunits to incorporate into the pilus [11, 13, 18, 19]. Pili have been proposed to play an important role in virulence, adherence to and invasion of host cells and biofilm formation [11–13, 18]. The presence of thin, pilus-like structures on the surface of S. suis was noticed as early as 1990 by ultrastructural studies using electron microscopy [9]. The srtBCD cluster has recently been identified as a putative pilus gene cluster in S. suis, corresponding to loci ssu1885, ssu1886, and ssu1888 of the strain P1/7 genome [7, 15]. Unfortunately, several mutations have been found in the major pilin subunit gene sbp2 resulting in separation into sbp20 and sbp200 ; as a result, intact pilus structures may not be formed on the bacterial surface [15]. Recently, the detection of Sbp20 in P1/7 bacterial proteins by isobaric tags for relative and absolute quantitation (iTRAQ) technology does not support the hypothesis that the truncated sbp2 represents a pseudogene (unpublished data). Therefore, the objective of this study was to determine the effect of the truncated major pilin subunit Sbp2 on the overall pathogenesis of SS2 in the absence of pilus-like structures.

123

704

J. Shao et al.: Streptococcus suis Pathogenesis in the Absence of Pilus Shaft

Materials and Methods Bacterial Strains, Plasmids, and Culture Conditions Bacterial strains and plasmids used in this study are listed in Supplementary Table 1. SS2 virulent strain P1/7, purchased from ATCC, was originally isolated in the United Kingdom in 1976 from a pig dying of meningitis [8]. All S. suis strains were grown in Todd-Hewitt broth (THB, Oxoid, UK) and plated on Todd-Hewitt agar (THA) at 37 °C in a 5 % CO2 atmosphere, unless otherwise specified. Escherichia coli strains were cultured in Luria–Bertani (LB, Becton–Dickinson) medium at 37 °C. When required, the following antibiotics were added to the medium at the indicated concentrations: for S. suis, spectinomycin, 100 lg/mL; for E. coli, ampicillin, 100 lg/mL; and spectinomycin, 50 lg/mL.

a previous method [16]. The single-crossover mutant was obtained by culturing the cells on THA with spectinomycin at 37 °C, and the double-crossover mutants were generated by repeated passaging at 28 °C on THA without spectinomycin. The deletion of target genes was confirmed by PCR and sequence analyses. Complementation of Mutants A DNA fragment containing the target gene and promoter sequence was amplified from the genomic DNA of S. suis P1/7 using specific primers (shown in Table 1). After digestion by endonucleases, the fragment was ligated into the E. coli–S. suis shuttle vector pSET2 [16] at the PstI/ BamHI sites. The recombinant plasmid was electroporated into the deletion mutant, screened on THB agar under selection pressure for spectinomycin resistance.

Construction of the Deletion Mutants (Dsbp20 , Dsbp200 )

Determination of Virulence in Zebrafish

Upstream and downstream regions of the target gene were amplified by PCR with specific primers (shown in Table 1) and fused by overlap-extension PCR [20]. After digestion with PstI and BamHI, the resulting fragment was cloned into the same restriction enzyme sites of the temperaturesensitive S. suis–E. coli shuttle vector pSET4S [16] to generate the knockout vectors pSET4S-sbp20 and pSET4Ssbp200 . P1/7 competent cells were prepared and subjected to electrotransformation with the knockout vectors, based on

Strains were cultured to the exponential growth phase at 37 °C, washed twice in PBS, and adjusted to the appropriate doses. Zebrafish were anesthetized with tricaine methanesulfonate (MS-222) (Hangzhou Animal Medicine Factory) at a concentration of 90 mg/L. Five groups of 15 zebrafish were intraperitoneally injected with tenfold serially diluted suspensions containing 104–107 CFU of bacteria in PBS. Negative controls were injected with PBS. Bacterial CFUs contained in the injected inoculum were

Table 1 Primers used in this study Primers

Sequence (50 –30 )a

Restriction sites

Functions

Sbp20 -A

GAGTCACTGCAGTAAGAAATACCGTTTCCAGAT

PstI

For amplification upstream of sbp20

0

Sbp2 -B

CATTACGATTTTGTGAACAAT

Sbp20 -C

ATTGTTCACAAAATCGTAATGGTTGAAATCGGTCAGGAAAT

Sbp20 -D

CTGATCGGATCCTTCTTTTGCTTGTGTTACTG

0

AGTTGCTAGTGGTGTGACGAC

0

Sbp2 -Y

CATCTTTTCGTAAGCAGTGTC

Sbp20 -IN1

TCGGAGATTTGAAGAATTATT

0

Sbp2 -IN2

AGGAGTTTTGGTATCAAAGTA

Sbp200 -A

GAGTCACTGCAGCAGTGTTTACTGTGTTCCTAA

Sbp2 -X

00

Sbp2 -B

ATTATTCAATTTCACCATGA

Sbp200 -C

TCATGGTGAAATTGAATAATATTCCACAAACGGGTGGTATC

00

For amplification downstream of sbp20 BamHI For sequencing and identifying Dsbp20 For identifying Dsbp20 PstI

For amplification upstream of sbp200 For amplification downstream of sbp200

Sbp2 -D

CTGATCGGATCCTGCAATCACCACCACATTTCC

Sbp200 -X Sbp200 -Y

AACAGGTGGTATGGGTATCAT GCCCCAGATTCAACCTGACAA

For sequencing and identifying Dsbp200

Sbp200 -IN1

ATTAGAAGAAAAAGCAAGAGA

For identifying Dsbp200

00

BamHI

Sbp2 -IN2

GCGATTTCTTTTGCTTGTGTT

Csbp20 -1

CGACTGCAGTCATTGCTTTTGCCGTTGAGC

PstI

Csbp20 -2

CGAGGATCCAATTTCACCATCTTTTGGAGT

BamHI

a

Restriction sites are underlined

123

For complementation

J. Shao et al.: Streptococcus suis Pathogenesis in the Absence of Pilus Shaft

confirmed by plating on THA. Mortality was monitored until 7 days post-infection. The experiment was repeated three times. The 50 % lethal dose (LD50) results were calculated to determine the differences in virulence between the parental, mutant, and complementation strains in the zebrafish model. Statistical analyses were performed using one-way ANOVA and Dunnett’s multiple comparisons test.

705

calculated by dividing the number of bacteria remaining attached to cells after the incubation period by the total bacterial inoculation number. The assay was performed three times in triplicate. Statistical analyses were performed using one-way ANOVA and Dunnett’s multiple comparisons test.

Results Adherence to HEp-2 Cells Construction of the Mutant Strains The human laryngeal carcinoma cell line HEp-2 was grown in 24-well cell culture plates to 70–80 % confluence. Bacterial strains were grown to early exponential phase, harvested and washed in PBS, resuspended in fresh cell culture medium without antibiotics, and added to the monolayers with a multiplicity of infection (moi) of 100. Infection was performed in medium without FCS. Infected monolayers were centrifuged for 15 min at 8009g to synchronize infection and incubated for 2 h at 37 °C in 5 % CO2. To stop the infection and to remove nonadherent bacteria, cells were washed five times with PBS. Cell-associated bacteria were quantified by lysing the monolayer with 100 lL of trypsin for 15 min at 37 °C, and then disrupted by adding 900 lL of sterile water to release all bacteria. After suspension by vigorous pipetting, colony-forming units (CFU) were determined by plating serial dilutions. Results were expressed as adherence rates,

A

PCR and sequencing results confirmed successful construction of the isogenic knockout mutants (Dsbp20 and Dsbp200 ) as well as the complementation strain CDsbp20 . Specific primers ‘‘-X’’/‘‘-Y’’ were used for sequencing and distinguishing the wild-type strain and deletion mutant strains. As shown in Fig. 1, primers Sbp20 -X/Sbp20 -Y or Sbp200 -X/Sbp200 -Y amplified fragments of 2,592- or 3,008bp flanking the upstream and downstream regions of sbp20 or sbp200 in the WT strain P1/7, respectively. A smaller band (1,882- or 2,042-bp) was amplified in the corresponding mutant. Primers Sbp20 -IN1/Sbp20 -IN2 or Sbp200 IN1/Sbp200 -IN2 amplified a 350- or 606-bp fragment of sbp20 or sbp200 in the WT strain P1/7, but no bands were detected in the mutant strain. In addition, sbp20 and sbp200 were deleted with no polar effects on flanking genes (Supplementary Figure 1).

1821 bp

729

1

sbp2’’

sbp2’

B

Fig. 1 Construction and confirmation of the P1/7 knockout mutant strain Dsbp20 , Dsbp200 . a Sketch map of truncated sbp2. The fragment between the black arrows shows the deleted portion. b Schematic representation of the chromosomal structures before (up) and after (down) homologous replacement events between pSET4 s-sbp20 /200 and the chromosome of P1/7. The target sbp gene is represented by red arrows. The upstream(U) and downstream(D) sequences of the sbp are represented by orange and yellow boxes, respectively. Black

C

arrow indicates the spc gene. c PCR confirmation of knockout mutant strains. The primer combinations used in the PCR were as follows: lanes 1 and 2, Sbp20 -X/Sbp20 -Y; lanes 3 and 4, Sbp200 -X/Sbp200 -Y; lanes 5 and 6, Sbp20 -IN1/Sbp20 -IN2; lanes 7 and 8, Sbp200 -IN1/ Sbp200 -IN2. Genomic DNA from the following strains was used as the template: wild-type strain P1/7 (lanes 2, 4, 5, 7); sbp20 mutant (lanes 1, 6); sbp200 mutant (lanes 3, 8). The 5 kb DNA ladder marker is shown on the left (M) (Color figure online)

123

706

J. Shao et al.: Streptococcus suis Pathogenesis in the Absence of Pilus Shaft

Deletion of sbp20 Attenuates the Virulence in Zebrafish The effect of the sbp20 gene on virulence was evaluated in the zebrafish model. Mortality of zebrafish was observed within 7 days after the challenge. As shown in Table 2, the LD50 value was 1.78 9 105 CFU/fish for P1/7, 1.45 9 106 CFU/fish for Dsbp20 , and 6.01 9 105 CFU/fish for the complement strain CDsbp20 . These results indicated that the deletion of sbp20 partially attenuated the virulence of SS2 in zebrafish (p \ 0.001). However, no obvious differences in bacterial virulence were observed in the Dsbp200 , compared with that of the parent strain (Table 2). Sbp20 is Indispensable for Adhesion to HEp-2 Cells To determine the role of the major pilin subunit Sbp20 in adherence, the wild-type strain P1/7, mutant strain Dsbp20 , and complementation strain CDsbp20 were analyzed in adhesion assays with HEp-2 cells as described. Compared with P1/7, Dsbp20 showed a significant reduction of 65.37 % (p \ 0.001) in the efficiency of adherence to HEp2 cells (Fig. 2), while the adherence of the CDsbp20 was approximately 2.39 times that of the mutant strain. Thus, Table 2 Calculations of LD50 on P1/7 and its derivatives for zebrafish Dose (CFU/ fish)

Number of death/total P1/7

Dsbp20

CDsbp20

Dsbp200

2.0 9 107

15/15

15/15

15/15

15/15

6

2.0 9 10

14/15

6/15

10/15

12/15

2.0 9 105

7/15

2/15

4/15

8/15

2.0 9 104

2/15

1/15

1/15

4/15

LD50

1.78 9 105

1.45 9 106

6.01 9 105

1.34 9 105

Fig. 2 Effects of sbp20 and sbp200 inactivation on adherence to HEp-2 cells. The adhesion of mutant strain Dsbp20 decreased significantly compared with that of the parental strain P1/7. ***P \ 0.001

123

the results revealed that Sbp20 is indispensable for promoting the effective binding of the pathogen to host cells. However, no obvious differences in the adherence efficiency of Dsbp200 were observed, compared with that of the parent strain (Fig. 2).

Discussion The srtBCD cluster contains three sortase-like genes (srtB, srtC, and srtD) and four pilin subunit protein genes (designated sbp1, sbp2, sbp3, and sbp4), which encode putative cell-wall anchor family proteins [6]. The genetic organization of the srtBCD cluster is similar to the known pilus gene cluster of Streptococcus pneumonia TIGR4 (rlrA islet) [18]. The srtBCD homologs in S. pneumonia mediate the assembly and surface topology of adhesive pili, and deletion of the srtBCD cluster completely prevents pneumococcal pilus biogenesis [3]. However, the putative backbone gene sbp2 is truncated by nonsense mutations in a large collection of SS2 strains, resulting in sbp20 and sbp200 . Sbp20 and Sbp200 showed 33 and 39 % identity with N-terminal and C-terminal halves, respectively, of the cellwall surface anchor family protein SAL1486 of Streptococcus agalactiae 515, suggesting that sbp20 and sbp200 had been separated from a single gene encoding a cell-wall anchor family protein [15]. Although pilus polymerization was disrupted, our study suggested that involvement of the backbone protein Sbp20 in SS2 pathogenesis was retained. In addition to the srtBCD cluster, another two pilus gene clusters have been reported in the S. suis P1/7 genome. The srtE cluster was deemed unlikely to be able to mediate pili formation since it lacks the genes encoding the major and minor pilin subunits [6]. The srtF cluster was the first identified pilus cluster in SS [4, 15]. Immunogold electron microscopy (IEM) results showed the presence of pilus-like appendages on the SS surface. However, Fittipaldi and colleagues suggested that the srtF cluster may not be critical for full virulence of some highly invasive S. suis isolates [6]. Given these observations, it is reasonable to assume that production of pilus fibers may not be necessary for SS pathogenesis. More specifically, some pilus-like appendages, which were long, slender, flexible, and extended from the bacterial cell-wall, might be dispensable for virulence, whereas certain pilin monomers were able to function independently as virulence factors despite the lack of piluslike structures, such as Sbp20 of srtBCD cluster. Numerous reports describing SS virulence factors have been published in recent years. Fittipaldi et al. [5] summarized more than 70 virulence factors proposed so far. Several cell-associated or secreted factors, with definite functions and attenuated virulence of deletion mutants in

J. Shao et al.: Streptococcus suis Pathogenesis in the Absence of Pilus Shaft

animal infection models, are clearly major in the pathogenesis of SS infections. Others with putative or unknown roles are minor virulence factor candidates, which may contribute to pathogenesis within the specific host environment. Due to the abolition of pili production, the function of the srtBCD pilus cluster, especially the major pilin subunit Sbp2, has been ignored. In this study, our data showed for the first time that the truncated Sbp2 (Sbp20 ) was still involved in pathogenesis of SS2 in the absence of the pilus shaft. The results also provide insights into the correlation between the production of pili and virulence. However, whether Sbp20 is anchored to the cell-wall by certain alternative way(s) hitherto unknown or is secreted into the supernatant due to the lack of the anchor domain contained in Sbp200 remains to be established. Acknowledgments This work was supported by Grants from the National Basic Research Program of China (973 program) (No. 2012CB518804), the Central University Basic Scientific Research Fund ‘‘Function Research of New Virulence Gene Clusters in Streptococcus suis’’ (No. KYZ201116), the Priority Academic Program Development of Jiangsu Higher Education Institutions, and the Special Fund for Public Welfare Industry of Chinese Ministry of Agriculture (Nos. 201303041 and 200903055).

7.

8.

9.

10.

11.

12.

13.

References 1. Arends JP, Zanen HC (1988) Meningitis caused by Streptococcus suis in humans. Rev Infect Dis 10:131–137 2. Chang B, Wada A, Ikebe T, Ohnishi M, Mita K, Endo M, Matsuo H, Asatuma Y, Kuramoto S, Sekiguchi H, Yamazaki M, Yoshikawa H, Watabe N, Yamada H, Kurita S, Imai Y, Watanabe H (2006) Characteristics of Streptococcus suis isolated from patients in Japan. Jpn J Infect Dis 59:397–399 3. Falker S, Nelson AL, Morfeldt E, Jonas K, Hultenby K, Ries J, Melefors O, Normark S, Henriques-Normark B (2008) Sortasemediated assembly and surface topology of adhesive pneumococcal pili. Mol Microbiol 70:595–607 4. Fittipaldi N, Gottschalk M, Vanier G, Daigle F, Harel J (2007) Use of selective capture of transcribed sequences to identify genes preferentially expressed by Streptococcus suis upon interaction with porcine brain microvascular endothelial cells. Appl Environ Microbiol 73:4359–4364 5. Fittipaldi N, Segura M, Grenier D, Gottschalk M (2012) Virulence factors involved in the pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future Microbiol 7:259–279 6. Fittipaldi N, Takamatsu D, de la Cruz Dominguez-Punaro M, Lecours MP, Montpetit D, Osaki M, Sekizaki T, Gottschalk M

14.

15.

16.

17.

18.

19. 20.

707 (2010) Mutations in the gene encoding the ancillary pilin subunit of the Streptococcus suis srtF cluster result in pili formed by the major subunit only. PLoS ONE 5:e8426 Garibaldi M, Rodriguez-Ortega MJ, Mandanici F, Cardaci A, Midiri A, Papasergi S, Gambadoro O, Cavallari V, Teti G, Beninati C (2010) Immunoprotective activities of a Streptococcus suis pilus subunit in murine models of infection. Vaccine 28:3609–3616 Holden MT, Hauser H, Sanders M, Ngo TH, Cherevach I, Cronin A, Goodhead I, Mungall K, Quail MA, Price C, Rabbinowitsch E, Sharp S, Croucher NJ, Chieu TB, Mai NT, Diep TS, Chinh NT, Kehoe M, Leigh JA, Ward PN, Dowson CG, Whatmore AM, Chanter N, Iversen P, Gottschalk M, Slater JD, Smith HE, Spratt BG, Xu J, Ye C, Bentley S, Barrell BG, Schultsz C, Maskell DJ, Parkhill J (2009) Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis. PLoS ONE 4:e6072 Jacques M, Gottschalk M, Foiry B, Higgins R (1990) Ultrastructural study of surface components of Streptococcus suis. J Bacteriol 172:2833–2838 Lee GT, Chiu CY, Haller BL, Denn PM, Hall CS, Gerberding JL (2008) Streptococcus suis meningitis, United States. Emerg Infect Dis 14:183–185 Mandlik A, Swierczynski A, Das A, Ton-That H (2008) Pili in Gram-positive bacteria: assembly, involvement in colonization and biofilm development. Trends Microbiol 16:33–40 Proft T, Baker EN (2009) Pili in Gram-negative and Grampositive bacteria—structure, assembly and their role in disease. Cell Mol Life Sci 66:613–635 Scott JR, Zahner D (2006) Pili with strong attachments: grampositive bacteria do it differently. Mol Microbiol 62:320–330 Staats JJ, Feder I, Okwumabua O, Chengappa MM (1997) Streptococcus suis: past and present. Vet Res Commun 21:381–407 Takamatsu D, Nishino H, Ishiji T, Ishii J, Osaki M, Fittipaldi N, Gottschalk M, Tharavichitkul P, Takai S, Sekizaki T (2009) Genetic organization and preferential distribution of putative pilus gene clusters in Streptococcus suis. Vet Microbiol 138:132–139 Takamatsu D, Osaki M, Sekizaki T (2001) Construction and characterization of Streptococcus suis–Escherichia coli shuttle cloning vectors. Plasmid 45:101–113 Takamatsu D, Wongsawan K, Osaki M, Nishino H, Ishiji T, Tharavichitkul P, Khantawa B, Fongcom A, Takai S, Sekizaki T (2008) Streptococcus suis in humans, Thailand. Emerg Infect Dis 14:181–183 Telford JL, Barocchi MA, Margarit I, Rappuoli R, Grandi G (2006) Pili in gram-positive pathogens. Nat Rev Microbiol 4:509–519 Ton-That H, Schneewind O (2004) Assembly of pili in Grampositive bacteria. Trends Microbiol 12:228–234 Warrens AN, Jones MD, Lechler RI (1997) Splicing by overlap extension by PCR using asymmetric amplification: an improved technique for the generation of hybrid proteins of immunological interest. Gene 186:29–35

123