Molecular and Biochemical Parasitology, 38 (1990) 141-150

!4!

Elsevier MOLBIO 01261

The TOP2 gene of Trypanosoma brucei: a single-copy gene that shares extensive homology with other TOP2 genes encoding eukaryotic D N A topoisomerase II Phyllis R. Strauss1,2 and James C. Wang1 IDepartment of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA, U.S.A., and 2Department of Biology, Northeastern University, Boston, MA, U.S.A.

(Received 20 June 1989; accepted 24 July 1989)

A mixed oligonucleotide probe containing sequences encoding a septapeptide found in yeast, Drosophila and human DNA topoisomerase II was used to screen a genomic library of Trypanosoma brucei. A positive was obtained, and nucleotide sequencing shows that the entire gene encoding DNA topoisomerase It of this organism, TbrTOP2, resides within the T. brucei insert of the clone. A single open reading frame of 1221 triplet codons starting from the first ATG was identified; the amino acid sequence deduced from it is highly homologousto other eukaryoticDNA topoisomeraseII and correspondsto a 137-kDapolypeptide.Analysis of restriction endonuclease digests of T. brucei DNA by blot hybridization followinggel electrophoresis indicates that TbrTOP2 is a single-copy gene. Key words: Topoisomerase II; Trypanosome; Trypanosoma brucei; DNA sequence

Introduction The biological importance of D N A topoisomerases is now well recognized (for recent reviews, see refs. 1-3). Two types of the enzymes, the type I enzymes that transiently break D N A strands one at a time, and the type II enzymes that transiently break complementary strands in a duplex D N A in concert, enable the D N A strands to pass each o t h e r and thus alleviate the topological constraints that would otherwise hinder vital processes such as replication, transcription, and chromosomal condensation and decondensation. In addition, prokaryotic as well as eukaryotic Correspondence address: Phyllis R. Strauss, Dept. of Biology, Northeastern University, Boston, MA 02115, U.S.A. Abbreviations: SSC, saline sodium citrate; SDS, sodium do-

decyl sulfate. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBankT M Data Bank with the accession number M26803.

D N A topoisomerases have emerged as important targets of therapeutics. Antibiotics targeting bacterial gyrase (bacterial D N A topoisomerase II) and antitumor drugs targeting eukaryotic D N A topoisomerases I and II have been extensively studied in the laboratory and applied clinically (reviewed in refs. 4 and 5). The clinically important drugs all appear to stabilize a class of complexes termed the 'cleavable complexes' [6,7], so named because the breakage of D N A phosphodiester bonds, which is accompanied by the formation of DNA-protein phosphotyrosine bonds, is revealed upon treatment of such a complex with a protein denaturant. Studies of the D N A topoisomerases of the trypanosomes have been stimulated by the unique topology of the mitocbondrial D N A in these protozoans. Each trypanosome possesses a single mitochondrion, termed the kinetoplast. The D N A of the kinetoplast consists of a catenated network of two -lasses of D N A rings, several 'maxi-circles' containing the genetic information for mitochondrion-coded proteins, and thousands of

0166-6851/90/$03.50 © 1990 Elsevier Science Publishers B.V. (Biomedical Division)

142

'mini-circles' of unknown function (reviewed in refs. 8-10). Each element of kinetoplast DNA replicates once and only once during the cell division cycle. Replication of such a catenated network and the distribution of the newly replicated networks to progeny cells presumably require a DNA topoisomerase or topoisomerases. In support of this notion, when the kinetoplasts are exposed to protein denaturants in the presence of drugs that stabilize the cleavable complexes of eukaryotic type II DNA topoisomerases, cleavage of kinetoplast DNA minicircles is readily observed [111. The clinical importance of the topoisomerase-targeting drugs, viewed in the light of the health and economic threats posed by the trypanosomes, has provided additional stimuli for the study of trypanosomal DNA topoisomerases. There have been several reports on the purification of DNA topoisomerases from trypanosomes. Shlomai and Zadok [12] and Shlomai and Linial [13] partially purified an activity from cell extracts of Crithidia fasciculata. Similar to the type II enzymes of other organisms, this activity was shown to catenate/decatenate double-stranded DNA rings in the presence of Mg(II) and ATP. That the activity is most likely a type II topoisomerase was further supported by its ability to decatenate a network of covalent closed DNA rings. In contrast, all known type I topoisomerases can unlink a pair of interlocked DNA rings only if at least one of them contains a nick or gap [1,2]. A Mg(II) and ATP-dependent activity that catalyzes the decatenation of covalently closed rings was also found in cell extracts of Leishmania donovani [14]. Unlike the C. fasciculata enzyme, the L. donovani activity does not catenate DNA rings under a variety of conditions. An ATP-independent type II DNA topoisomerase from Trypanosoma cruzi was partially purified and characterized [15]. The size of the native enzyme was estimated to be about 200 kDa. The subunit structure of the enzyme was undetermined, although peptides ranging from 50-110 kDa were observed. More recently, a type II DNA topoisomerase has been purified to near homogeneity from C. fasciculata [16]. Similar to the well-characterized DNA topoisomerase II from other eukaryotes, this enzyme appears to be a homodimer with a

subunit size of 132 kDa. Subcellular fractionation and immunocytochemical localization experiments indicate, however, that the trypanosome enzyme is enriched in the kinetoplast [17], whereas the known type II DNA topoisomerase in other eukaryotes is mainly a nuclear activity [1-31. It is uncertain whether the trypanosome type II topoisomerase preparations described above contained primarily one and the same enzyme or whether they contained distinct activities, such as a nuclear enzyme in some cases and a mitochondrial enzyme in others. The likelihood of proteolysis and the low purity of enzyme preparations in a number of instances obscure the characterization of the enzymes; these complications also make it uncertain whether some of the novel features reported for these trypanosome activities reflect true differences from the well-characterized DNA topoisomerases of other eukaryotes. These uncertainties led us to screen for genes encoding D N A topoisomerases of the trypanosomatid Trypanosoma brucei. We report in this communication the cloning of a single-copy gene TbrTOP2 that encodes DNA topoisomerase II of this organism. The entire coding sequence of the gene has been determined and a comparison of TbrTOP2 with the TOP2 genes of other organisms shows that the trypanosome enzyme is highly homologous to the known DNA topoisomerase II of other eukaryotes. Materials and Methods

Materials. A genomic library constructed by the insertion of a partial Sau3A digest of T. brucei strain 427 DNA into the BamHI site of phage hEMBL3 was kindly provided by Dr. Thomas Beals in the laboratory of Dr. J. Boothroyd (Stanford University); purified genomic DNA from the same strain was obtained from Dr. Christine Witte. Purified DNA from T. brucei strain 366D was kindly provided by Dr. C.C. Wang (University of California, San Francisco). The mixed oligonucleotide probe was the one reported previously [18]. The phage-plasmid pBluescript KS was obtained from Stratagene (La Jolla, CA). All other reagents were purchased from commercial sources.

1A~

l-lrJ

Methods. Screening of the phage library by hybridization with the mixed oligonucleotide probe 32p-labeled at its 5' terminus was carried out as described previously [18]. Blots were hybridized with the probe at 42°C in 5 x SSC (1 x SSC is 0.15 M NaCI/0.16 M Naa-citrate)/l% dried milk powder/l% sodium dodecyl sulfate (SDS), washed twice in 5 × SSC containing 1% SDS at room temperature and then 2--4 times at 42°C in 2 x SSC containing 1% SDS. The nucleotide sequence of the TbrTOP2 gene was obtained from two contiguous BamHI fragments derived from one of the positives. The bulk of the gene resides on the 5.6-kb fragment, while a short stretch of coding sequence is present at one end of the 6.5-kb BamHI fragment. After the two fragments were subcloned in the BamHI site of pBluescript KS, subclones were prepared for sequencing by means of the exonudease IlI/mung bean nuclease procedure [19]. Nucleotide sequencing was performed by the dideoxynucleotide chain termination method [20], using both "1"7 DNA polymerase purchased from United States Biochemical Corporation (Cleveland, OH) and the Klenow fragment of Escherichia coli DNA polymerase I purchased from New England Biolabs (Beverly, MA); the procedures recommended by the manufacturers were used. Sequencing artifacts in a particular region were usually observed only with one or the other enzyme. Sequencing primers were purchased from Stratagene or United States Biochemical; a primer homologous to nucleotides 925-942 of pBluescript was also synthesized and used in the sequencing of one set of subclones. Results

The TbrTOP2 gene encoding T. brucei DNA topoisomerase H is identified by the use of a universal oligonucleotide probe for eukaryotic TOP2 genes. A mixed oligonucleotide 5' ATG-AT(A,C,or T)-ATG-AC(G,A,C, or T)-GA(C or T)CA(G or A)-GA(C or T)-CTGCAGCCCCCCCCGGCTGCAG 3' was previously used in the cloning of the human TOP2 gene [18]. The first 21 nucleotides of this mixed oligonucleotide code for a seven amino acid stretch Met-Ile-Met-ThrAsp-Gin-Asia that was initially found in both Sac-

charomyces cerevisiae and Drosophila melanogaster DNA topoisomerase II [21,22]. The remaining nucleotides were included for the formation of a hairpin loop with a PstI site in the stem. A radioactive complement of the 5' overhang could be synthesized by extending the 3' end of the oligonucleotide with DNA Polymerase I for use as the probe upon its separation from the unlabeled template following digestion with PstI. The suecessful cloning of the human TOP2 gene by means of this probe [18] and the identification of the same septapeptide in the TOP2 gene of Schizosaccharomyces pombe [24] suggest that this mixed oligonucleotide probe might be useful in the cloning of the TOP2 gene of any eukaryotic organism. This approach appeared particularly attractive in the cloning of the TOP2 genes of trypanosomes in view of the low genomic complexity of these organisms [23]. As reported in the cloning of human TOP2, the unextended mixed oligonucleotide, 32p-labeled at the 5' end, could also be used directly in the screening of libraries [18]. Screening of a T. brucei genomic library in phage kEMBL3 with the 5' end-labeled probe identified nine potential positives out of a tetal of 36 000 phage plaques on six agar plates. The nine were mixed and rescreened, whereupon four positive plaques were picked and screened once more. Two of these rescreened positive, kTbrTOP2-i and hTbrTOP2-4, were plaque-purified and characterized further. DNA samples of the two positives were extracted from phage grown from individual plaques. Three BamHI fragments, 5.3, 4.1 and 2.6 kb long, were shown to be present within the trypanosome DNA insert in kTbrTOP2-1; kTbrTOP2-4 similarly contained three major BamHI fragments, 6.5, 5.6 and 1.3 kb in size. Each of the six BamHI fragments was isolated following preparative electrophoresis and subcloned into the BamHI site of pBluescript KS. Partial nucleotide sequencing of the inserts in these subclones was then carried out by the dideoxynucleotide chain termination method [20], using oligonucleotide primers that hybridized to sequences on one or the other side of the BamHI site in the plasmid vector (see the Materials and Methods section). Examination of these prelimi-

144 O ( 1 ) CGCAG CTTGTAG GGGACGACTTGTGTGCATATCGTTGTTGTTATTATTATTA TTTAG TTTGACTGCTTATACACA

GCG gAG GCA CAC Net Ata Otu AtQ HIS

75 90 30 45 60 AAG TAT AAG AAG CTC AOA CCT ATT GAG CAT GTA CTC ACA CGA CCA GAG ATG TAG ATT GGT AGT CTC GAC ACA ACG Lys T y r Lys L y s Leu ThP P r o l i e Giu HIS Vat Leu ThPA_.~PPo G(u Het T~P I l e G l y S e t Leu Asp Thr T h r 105 120 135 150 165 GCA ACC CCC ATG TTT ATA TAC CAT GAA GAG AAG GGT CAC ATG GTG TGG GAG ~CG GTG AAA CTG AAT CAC GGT TTG A t a ThP P r o N e t Phe 11e T y r Asp GLu Gin L y s Gty H i s Net Vot Trp Glu Thr Va| L y s Leu Asn H i s G|~ Leu 180 195 210 225 e40 CTG AAA ATE GTG GAT GAA ATT ETG CTA AAT GCA TCT OAT AAC ATC TCC AAC AGA AGT GCG CGC ATG hOG TAT ATC Leu L y s l i e V a t Asp Gtu l i e Leu Leu Ash A i o $ e r A s p A s n l i e SeP Ash AP8 S e t A t ~ A r g N e t ThP T y r l i e 255 270 285 300 315 CGC GTG ACC ATC ACG GAC ACG GGT GAG ATT ACT ATA GAG AAC GAG GGT GCT GGG ATC CCC ATC GTA CGC ACT CGG Arg VaL Thr [ r e T h r Asp THP Gty Giu I l e Thr [ r e Gtu ASh Asp G t y A l a G l y I r e P r o I r e Vnt APg S e t AP8 330 345 360 375 390 GAG CAT AAA TTA TAT ATA CCA GAG ATG GTA TTC GGT CAC CTA CTT ACC AGC TCT AAT TAT GAT GAG GAT AAC CAA Gtu HIS Lys Leu T y r I r e P r o GLu Met V o l Phe Gty HIS Leu Leu Thr S e t S e t Asn T y r Asp Asp Asp Asn Gin 405 420 435 450 465 AAT GCA GTT GCT GGT CGC CAC GGT TAG GGT GCA AAG CTA ACC AAC ATT CTT TCC CTG AGe TTT TCC GTC TGC TGC Ash ALa Vat A t a G i y A r 8 HIS Giy T y r G l y A i a L y s Leu Thr As_~___nlte Leu S e t Leu S e t Phe S e t VaL Cys Cys 480 495 510 525 540 CGC ACA AAT GGG AGG GAG TTT CAC ATG AGT TGG GAG CAT CAC ATG AGG AAG GCA ACG GCT CCA CGC GTT TCA AAC Arg Thr ASh G t y Arg Gtu Phe H I s Net S e t T r p g i n Asp HIS Nee Ar C Ly5 A t a ThP A t a Pro APg Vot S e t Asn 555 570 585 600 615 GTC GGC ACA AAA GAG AAA AAT GTC ACG CGT GTG AAG TTT CTC CCC GAG TAG GAG CGA TTT GGC ATG AAG GAG AAG Vat Gty Thr L y s Gtu L y s hsn VnL Thr APg Vat L y s Phe Leu Pro ASp T y r Glu AP8 Phe Gty Net Lys Gtu L y s 630 645 660 675 690 AAA ATT TCA AAC GAG ATG AAG CGT GTG CTC TAG AAG CGC ATT ATG GAC CTT TCC GCA ATG TTT CCG AAT ATT CAA Ly5 lLe Set hsn Asp N e t L y s AP8 VaL Leu T y r L y s Arg [ l e Net Asp Leu S e t A t e Met Phe P r o Ash [ r e Gin 705 720 735 750 765 ATA ACC CTG hAG GGC TCA TCC TTT GGC TTC AAG TCC TTT AAG GAG TAT GCG ACT CTG TAG AGT GCC ATG ACC CCA [ | e ThP Leu ASh G i y S e t S e t Phe G i y Phe L y s S e t Phe Lys Asp T y r ALG Thr Leu T y r S e t A ( ~ Met Thr P r o 780 795 810 825 840 AAG GGA GAG AAA CCA CCG CCA CCA TAG GTA TAG GAG ACT AAA AGC GGT TGC GTT GCC TTC ATT CCT TCA GTA GTC LyS GLy Gtu L y s P r o P r o P r o P r o T y r Vat T y r GLU Ser Lys Ser Gty Cys Vat A l e Phe l i e PPo Set Vat VaL 855 870 885 900 915 CCC GGG GTG CGG CGG ATG TTT GGT GTG GTC AAC GGT GTG GTA ACG TAT AAT GGC GGT ACG CAT TGC AAT GCT GCG Pro GLy VaL AP8 APg Net Phe Gty Vat V ~ i Ash GLy Vot Vat Thr T y r Ash Gty G l y T h r H i s Cys Asn A t a A t a 930 945 960 975 990 GAG fiAT ATA TTG ACC GGC TGC CTC GAT GGC GTG GAA CGG GAA TTA AAG AAG gAG AAC AAA GTG ATG GAG ACT AAT Gin Asp l i e Leu Thr Gty Cys Leu Asp Gty Vat G i u Arg GLu Leu Lys L y s Gtu Ash L y s VQi Net Asp Thr Asn 1005 1020 1035 1050 1065 CGA GTG CTT GGT CAC TTC ACT ATT CTA GTT TTC CTC GTG CAG GTG CAG CCA hAG TTT GAT TGT GAG hAT AAA GCT Arg Vat Leu h r g HiS Phe T h r [Le Leu Vat Phe Leu VoL Gtn Vat Gin P r o Lys Phe Asp S e t g i n ASh L~S A t a 1080 1095 I110 1125 1140 CGA CTT GTT TCT ACC CCC ACG ATG CCC CGT GTT CCT COG CAA CAT GTG ATG AAA TAT CTT CTG CGC ATG CCT TTT AP8 Leu Vat S e t Thr P r o T h r Met P r o A r g Vat PPo A r 8 Gtn Asp v ~ t Net Lys T y r Leu Leu APg Net PPo Phe 1155 1170 IIR~ t~nN 5~1~ CTC GAg GCT CAT GTG AGT ACT ATT ACG-GGG GAG TTA GCG C A G ' ~ CTA hAT AAG GAG'A;C GGC ACC GGA CGC'CG~ Leu Gtu A t a HIS Val Set T h r ILe Thr G l y Gkn Leu A i a g i n Gtu Leu Ash L y s Gtu l i e Gly ThP Gty h r g h r 8 1230 1245 1260 1275 1290 ATG AGT AGC AAA ACC CTC CTG ACC TCC ATA ACG AAA GTG GTA CAT GCA ACT TCT ACA CGC CGT GAC CCA AAA CAT Met S e t Set L y s Thr Leu Leu Thr Set I1~ Thr L y s Leu r o t As~ A l a ThP SeP Thr A r 8 APQ Asp Pro Lys H i s 1305 L320 1335 1350 1365 ACC CGG ACG TTA ATT GTT ACT GAG GGT GAG TCC GCA hAG GCT CTC GCG GAG AAC TCT TTA TCG AGT GAG CAA AAG Thr A r g Thr Le__uuIte Vat THP GLu GL~ Asp Ser h ( n Lys A t a Leu A | n g i n Asn S e t Leu S e t SEP Asp g i n L y s 1380 1395 1410 1425 1440 CGA TAT ACA GGC GTA TTT CCG CTT CGG GGT AAG CTG CTA AAC GTG CGT AAC hAG AAT CTT AAG CGA CTG AGG AAC Arg T y r Thr Gty V a l Phe P r o Leu A r s , G l y L~s Leu Leu Asn Vat AP8 Asn Lys ASh Leu L y s APg Leu APg Ash 1455 1470 1485 L500 1515 TGC AAG GAG TTG CAG GAA CTG TTT TGT GCG CTG GGG CTT GAG CTA GAT AAA CAT TAG AGC GAG GCC CAT GAA TTA Cys Lys G t u L e u Gin GLu Leu Phe Cys A l a Leu Gty Leu G(u Leu Asp Lys Asp T y r ThP Asp h t a Asp Gtu Leu 1530 o118o 1545 1560 1575 1590 CGG TAC CAA CGC ATArC~T ATC ATG ACA GAT CAG GAC]GCA CAT GGC TCA CAC ATT AAG GGT TTG GTT ATC AAC GCG A r g T y P G I n A r g [Le Leu [ r e Met Thr Asp GLn Asp A t a Asp Gty Set HIS l i e Lys Gty Leu Vat I t e Asn A i o 1605 )620 1635 1650 :665 TTC GAG TCT TTG TGG CCC TCG TTG CTG GTA CGC AAT CCT GGG TTC ATC TCT ATA TTC TCC ACA GCC ATC GTA AAG Phe Gtu Set Leu T r p Pro S e t Leu Leu Vat A r 8 Asn Pro Gty Phe I l e S e t l i e Phe S e t Thr P r o i r e Va| L y s

1680 1695 1710 1725 1740 GCA CGA CTG CGC GAC AAG TCG GTG GTA TCC TTC TTC AGC ATG AAG GAG TTT CAC AAG TGG GAG CGC TCA AAT GCA qIo AP0 Leu AP8 Asp Lys SeP VoI Vat Ser Phe Phv Set Net Lys G|u Phe HIS L y s TPp Gin AP9 Set Asn A t a 1755 1770 1785 1800 1815 AAT ACA CCA TAG ACA TGT AAG TAC TAT AAG GGT CTC GGT ACT TCT ACC ACT GCT GAG GGA AAA gAG TAG TTC AAG ASh Thr Pro T y r Thr Cys Lys T y r T y r L y s GLy Leu Gty ThP Set Thr Thr A ( o Glu G l y Lys Glu T y r Phe L y s

1830 1845 1860 1875 IB90 GAT ATG GAG AAA CAC ACA ATG CGC TTA CTC GTG GAC CGC TCC CAT CAT hAG CTT CTT GAG AAT GTT TTC GAC TCA Asp Met Gtu L y s H i s Thr N e t AP8 Leu Leu v o t Asp AP8 SPr Asp H i s Lys Leu Leu Asp Ash Vat Phe ASp SeP

Fig. l(a).

145 1905 1920 1935 1950 1965 Q (~)CAG GAG GTA GAA TGG CGA AAG GAC TGG ATG ACC AAG GCG AAT 6CT TTT ACC GGC GAG 6TA OAT ATT QAT CGT AGC Gtn Gtu Vat G|u Trp Arg Lys ASp Trp Met TI~- Lys A i o Asn A t a Phe Thr Gty GLu V~l Asp lLe Asp APg SeP

1980 1995 2010 2025 2040 AAG AAA ATG CTA ACO GTC ACA GAT TTT GTG CAT AAG GAG ATG GTT CAT TTC GCC CTT GTT GGT AAI GCC CGT OCG Ly~ Ly~ Ne~ Leo ThP V ~ Thr Asp Phe V s t HI~ Lys GLu He¢ Ve,t HIS Phe ALa Leu Ve,L G|y Ass A | a A P g A L a 2055 2070 2095 2100 2115 CTT GCG CAC TCT GTA GAC GGO CTT AAO CCT TCT CAG CGA AAG ATT ATt TGG OCT CTT ATG CGG CGG FCC GGT AAT LgU A l a H i s Set Ve,I Asp 61y Leu Lys Pro $e~ GLn AP~ Lys t i e t i e Trp A t a Leu Net Arg A r 8 Set Oty Ass

2130 2145 2160 2175 2190 GAG GCG GCG AAG GTG GCA CAA CTA TCA GOT TAC ATA TCA GAA GCT TCC OCT TTT CAT CAT GOT GAO ACT TCA TTG G[U ALO A | a Lys VoL A l a Gin Leu Sen G i y Ty~ I r e Set GIu Ale, Set Ate, P~e H i s H i s G t y : G t u rhp SeP Leu 2250 2265 2205 P~20 2235 CAO OAG ACG ATO ATT AAO ATG OCG CAG AOC TTC ACT GGT GGT AAC AAC GTC AAC CTT CTC GTC CCT 6AG ~Gt CAG Gin GLu Thr Net [ r e Lys Met Ate, G(n SeP Phe Thr GLy Gly Asn ASS Val ASs Leu Le~ Val P~o G | u G L y 6 t n 2325 2340 8280 2295 2310 m TTC GOT TCT COT CA(; CAA CTr' Gr;,T AAT OAT CAT 6CG GCO CCC Ct';,T TAC AT1" TTC ACA AAG CTT TCA AAA GTA CICC Phe Gly Set AP8 Gin Gin Leu Gly ASS ASp H;s; Ale. A t a Pro A r D l T y r l l i e Phe The- Lys Leu Set Lys VoL A t a 2355 2370 2385 2400 2415 CGC TTG CTT TTC CCT AGT GAA OAT 6AC CCA TTO CTA OAC TAC ATT 0T6 GAA GAG OGT CAG CA(I GTO GAG CCG AAC A,'g Leu Leu Phe Pro Set 61u Asp Asp P r o Leu Leu ASp TyP ILe Vat Glu Glu Oty Gin GLn Ve.l Gtu Pro As;n e430 2445 2460 2475 2490 CAT TAI~ GTT CCA ATE CTA CCG CT8 CTC r"TC TGC AAr" r;GA AGT GTi'; GI~.C ATC GOT TTC 00(3 TTT TCG TCG AAT ATT HIS T y r Ve.L PrO I r e Leu Pro Leu L e u ~ C y s Asn Gty Set Vat GIy i r e G i y Phe Gty Phe Set Set Asn l i e 2505 2520 2535 2550 2565 CCA CCA TTC CAr" CGG TTO GAP GTA TCT (;CA GCG 6TA CGA GCG ATG ATT AGC GGC GAA Cr;T GCC AAG ]'C0 OTT GTC PrO Pro Phe HIS AP8 Leu Asp Vat Set Ata, ALo Vot A r 0 A l a Met 11e Set, G i y Gtu A r g Ate, L y s Set Vat Vot e580 2595 2610 26E5 2640 COT CGA CTT GTG CC6 TOG GCT GTA 6GC TTT CA~ OGT GAG ATA COT CGT GGC CCC GAA GGA GAG TTT ATT 0C1" GTG Arg AP8 Leu VaL Pro Trp A ( a VaL CLy Phe Gtn G l y r;,Lu t i e At' 8 APO G|y Pr'o Glu Gly GIu Phe t i e Ato, Val 2655 ~70 2685 2700 2715 GGA ACG TAT ACT TAC TGT AAt;. GGT GOT rOT GTO CAT GTT ACG GAG CTT CCT TGG A[:G TOT AGC OTT GAA r:.CA TTC Gty Thr T y r TIer T y r Cys Lys G i y Gty APO Ve.t H i s Val Thr 6 t u Leu Pr'o Trp T h r Cys Ser Vst 6 t u A t s Phe 2730 2745 2760 2775 2790 CIST GAG CA(; ATT TCT TAC CTr" GCC ACA AAG r;'AT ATT GTT AAr" CGC AT1" GCC GAC TAT TCC GGC GCC AAT CAC GTT APg OLU H i s I r e S e t T y r Leu Ale. Thr L y s Asp l i t . Vo, t Ass APO [ | e Ate. Asp T y r S e t F,Ly A t a A!;n HI5 Va I 2805 2820 2835 2850 2865 GAC ATT GAT GTG GAA F,TT GCT CAG GGT GCG GTO AAC ACG TAT GCT EAr;, TGC GAG TCG GAA CTT GGC CTC ACG CAA ASp I r e Asp Ve.I GlU Vsl Ale, GLn Gty A l a Val A s . ThP T y r ALa Glu Cyg Olu Ser" 91¢* Leu Gly Leu Thr GLn 2880 e895 291. 0 2925 2940 CGT ATT CAC ATC AAC GGT ACA GTC TTT TI~A CCG AAT GGA ACT CTT TCA CCT CTG GAA AGT GAC CTC ACA CCC GTC AP0 [ | e HIS | l e Astl Gly Thr VaL Phe S e t Pro Ass GLy ThP Leu Set Pro Leu Otu Set Asp Leu ThP Pro Vat 2955 ;2970 2985 CTr CAG TGG CAC TAC GAC CGC AGA CTT GAT TTA TAT AAA AAG AGC, CGA Leu Gtrl Trp H i s Tyt" Asp APQ APO Leu Asp Lebl T y r Lys Lys ._._._ ArK] AP8 3030 3045 3060 GAA TTG OCC AGA GAG AAO TCG ACA CTC AAA TTT GTG CAA CAC TTC GOT Giu Leu A l a /~'Q Gtu Lys Set Thr Leu Lys Phe Vat Gin HIS Phe GLy

3000 3015 CAA CGT AAT TTt'; ACt';, CTG TTG GAG CAr. 0 If~ Ar'8 A~;rt LelJ Thr Leu Leu Gtu Gin 3075 3090 GCC GGC CAC ATT 8AC TTT t;,CG AAT GCT ALa G i y HIS l i e Asf~ Phe A t a A~;n A l a

3105 3120 3135 3150 3165 ACG GAG 1[3CA ACA CTT GAA AAG F,TG TOT TCA AAG TTA GGG TTA 6TA CGT F;,TA GAT GAC_ TCG TTC GAC TAC ATT TTG Thr Giu Ai, a TOP Leu r;,lu Ly$ Val Cys Set Lys Leu Oty Leu VaL APB Vat Asp Asp Set" Phe Asp Tyr l i e Leu 3180 3195 31~10 3225 3240 CGT AAA CCC ATC ACG TTC TAT ACC AAA ACA AGT TTT GAA AAT CTT CTC AAG AAG ATC GCG GAG ACG GAG CGG CGC AP¢~ Lys Pro l i e The" Phe T y r Thr Lys T h r $e;" Phe r;,Lu Ass Leu Leu Lys L y s [ | e A t a 61u Thr GiU At"8 APg 3255 3270 3285 3300 3315 ATT GAA GCT CTC AAG AAO ACA ACC CCT GTO CAG TTO TOG TTG GGC OAA CTT (;AT CAA TTT GAT CGC TTC TTT CAG r t e 61u A l a Leu L y s Lys Thr Thr Pro Val Gin Leu Trp Leu Oly GtU Leu AsD Gin Phe Asp APQ Phe PP~e Gin 3330 3345 3360 3375 3390 GAC CAT GAG AAA AAO ATG GTG OAr', OCT ATT TTG AAG OAA A0A AGG CAG CGA TI~A CCC CCO AGC C,,AC CTT CTC r'CT ASp HIS Glu LyS Lys Net VaL Olu A14 l i e Leu L y s Gtu Ar'D Arg Gin Arg Set P r o Pro Set Asp Leu Leu PrO 3405 3420 3435 3450 3465 GGT CTT CAA CAG CCG CGT CTG GAG GTG GAO GAG GCA AAG G[~T GGT AAA AAA TTT GAG ATG r'00 GTT CAG GT6 CGA GLy Leu Gin GLn P r o APQ Leu Otu Ve.I Gtu Glu ALa L y s Gty Gty Ly5; Lys Phe G[u Nee Arg Ve.!, r;In Vo.t AP8 3480 3495 3510 3525 3540 AAG TAC GTC CCT CCA CCA ACC AAG CGO GGA GCA GGG GGC COT AOT GAT GGT OAf.. GGA GOC (;CA ACT OCG GCC GOT Lys T y r Vat Pro Pro Pro Thr Lys Arg Gty A t a 6 l y Gty Arg S e t ASp City ASp Gty Gty Ate. ThP A i a Ate, Gty 3555 3570 3585 3600 3615 GCT GCT GCA GCC GTG GGG GGA AOA GGT GAA AAG pal';, GGC CCG GGA CGA GCC GGT GGG i';,TT CGA COT ATG GTA CTC ALa A t a Ate, A l a Vo t Gly 61y APQ Gty Glu Lys Lys GLy Pro Gty AP8 Ate, 61y GIy Vat A r 8 Arg Net VOt Leu 3630 3645 3660 GAC GCC CTT C.LC F, AAG CGT GTG ACA COT TTG CTF, CCG COT CTG CTG T T C J ~ T C G ASp A l a Leu AIO, LyS APg Vat ThP Arg Leu I.eu Pro AP0 Leu Leu P~e .~..~3705 3720 3735 GCT CAG CAT TAL~.AJAGA AAA AAA ATC AAT GOT AAG A T T [ ~ i / C A ~ A G A

GCA A ~ A C ,

3780 AAA AAA / s ~ A A

3675 3690 TTT CGA AAG TAT ATT CTT CTG

3750 GTT TCT CC.,C T A m p A

3765 TCAI'~'~AAA CAT

3795 3810 3825 3940 AAA AAC ATT TTG GTG CAA AAA AAA AAA GGG CAG IT'P,,-'~-I~I"TGTGGTGGTGGCAGAATGAT

3855 3870 GAAGAAACTGAACGGATGGGCGAGTOOOTG~GATGAAATAAA

Fig. l(a) continued.

146 b

1000

0 B I I

p

l--l, II I I

Sm

X

K

H3

n

I

I

J

b|

F----

I

I

2000

b

I

II

I

I

I

!

I J

q

1

I

I

1

I

I

3000

2000

SI

H3SoH3 P SI

I/

//

,

,

I

4000

F

I

E PASta

\/I/

I

I

II

I I I ! 6

,,

I I

I

S

,

,

I

q

,

,

I

i

Fig. 1. (a) 4 Nucleotide sequence of the Trypanosoma brucei TOP2 gene and the amino acid sequence of T. brucei DNA topoisomerase II deduced from it. The nucleotide sequence is numbered from the boxed putative ATG start codon. Nucleotides 1531-1551, which correspond to the region recognized by the 'universal oligonucleotide probe', and nucleotides 2311-2313, which most likely encode the active site tyrosine of the T. brucei enzyme, are also boxed. The positions of 85 amino acids that are strictly conserved in seven other prokaryotic and eukaryotic type II DNA topoisomerases are underlined; 83 of these are also conserved in the T. brucei enzyme (doubly underlined), and the remaining 2 are substituted by analogous amino acids (singly underlined). (b) A The various subcloned segments that were used in the sequencing of TbrTOP2 region. Rightward arrows indicate that the lower strands were sequenced; leftward arrows indicate that the upper strands were sequenced. Several landmark restriction enzyme sites are indicated in the figure: A, ApaI; B, BamHI; E, EagI; H3, HindllI; Hp, HpaI; K, KpnI; P, PstI; Sa, Sail; Sm, Sinai; X, XhoI. ATG and oligo indicates the positions of the putative translational start and the oiigonucleotide probe sequence, respectively.

nary sequences and all possible amino acid sequences deduced from them showed clearly that the T. Brucei DNA inserts in kTbrTOP2-4 contained sequences that were highly homologous to sequences of other eukaryotic TOP2 genes. For the other clone, kTbrTOP2-1, no such sequence homology was detected. Blot hybridization of the inserts showed that this clone was apparently recognized by the 3' part of the mixed oligonucleotide; none of the in~erts from this clone was recognized by the 5'-labeled probe if the probe was first digested with Pstl to i ea~ove 17 nucleotides from its 3' end.

Nucleotide sequencing shows that the T. brucei TOP2 gene is highly homologous to the TOP2 genes of other eukaryotes and encodes a 137-kilodalton polypeptide. Several sets of subclones were constructed for the sequencing of the T. brucei DNA inserts in kTbrTOP2-4 (see Materials and Methods). A long open reading frame containing 1227 triplet codons was identified, six of which preceded the first methionine codon. This long open reading frame was followed by a number of stop codons in all frames (10 within a region of 182 bp). The nucleotide sequence encompassing the open reading frame and the translated amino acid sequence from the first ATG to the first stop codon are depicted in Fig. 1, some of the landmark restriction sites and the various segments used in the sequencing experiments are also indicated in the figure. Results of sequence homology searches between the amino acid sequence shown in Fig. 1 and amino acid sequences of known eukaryotic and prokaryotic type II DNA topoisomerases left little doubt that the long open reading frame corresponded to the coding region of the T. brucei TOP2 gene, which will be referred to as TbrTOP2. Comparing the first 1100 amino acids of the T. brucei sequence with the corresponding sequences of DNA topoisomerase II of S. cerevisiae [211, S. pombe [24], D. melanogaster [22] or humans [18], identical residues occurred at coaresponding positions 32-33% of the time and identical or similar residues occurred at corresponding positions 46-47% of the time. When the first 1100 amino acids of the T. brucei sequence were compared with the corresponding sequences of E. coli [25,26] and Bacillus subtilis [27] DNA gyrase or phage T4 DNA topoisomerase [28-30], 19-20% identical and 30-32% identical or similar residues occurred at corresponding positions. Furthermore, among 86 positions at which identical amino acids were found in all seven other known prokaryotic and eukaryotic type II DNA topoisomerase sequences, 84 were found to have the same amino acids in the trypanosome DNA topoisomerase II sequence as well (doubly underlined in Fig. 1); the remaining two positions were occupied by similar substitutions (a valine instead of an isoleucine, and an alanine instead of proline; singly underlined in Fig. 1).

147

The TbrTOP2 gene is a single copy gene. A number of trypanosome genes are known to be present as tandem repeats (reviewed in ref. 31). To test whether TbrTOP2 falls in this class, samples of genomic T. brucei DNA were separately digested with the restriction enzymes BamHI, EcoRI, Psd, Asp718 (an isoschizomer of KpnI) and XhoI. The digests were extracted with phenol and ethanol-precipitated, resuspended in and loaded in a sample well of a 1% agarose gel. Following electrophoresis, blot hybridization [32] was carried out with a 32p-labeled probe extending from a BamHI site at nucleotide position 291 to a SalI site at nucleotide position 3031 (see Fig. 1 for numbering).

RESTRICTION ENZYME

B

E

P

A

X

MW (KB)

H

_14 8.4

O

_

5.6

,_

3.6

_

2.3

i

1.2

Fig. 2. A Southern blot showing that TbrTOP2 is a singlecopy gene. After restriction endonuclease digests of T. brucei DNA were phenol extracted and ethanol precipitated, the DNA was redissolved and loaded in separate lanes in a 0.8% agarose gel. The gel blot following electrophoresis was probed with a BamHI (at nucleotide 291) to SalI (at nucleotide 3031) fragment of TbrTOP2, which had been 32p-labeled by nick translation. The lanes from left to right contained digests of BamHI (B), EcoRI (E), PstI (P), Asp718 (A), Xhol (X) and Hpal (H), respectively. The horizontal lines in the right margin mark the positions of the size markers in kilobase pairs which were run on the same gel and stained with ethidium for viewing by photography over a UV light source.

As shown in Fig. 2, in each case the observed band or bands agrees with that expected from the sequence data if TbrTOP2 is a single-copy gene. The BamHI digest gave the expected single 5.6kb band (lane 1 of Fig. 2). There are two PstI sites in the TbrTOP2 sequence, at nucleotide positions 2514 and 3543; therefore a 1.03-kb and one additional fragment corresponding to the sequenees upstream from nucleotide 2514 are expected using the particular labeled probes. In full agreement with this expectation, two bands were observed (lane 3 of Fig. 2), one of which measured 1.07 kb, in agreement with the size of the predicted 1.03-kb band. Asp718, XhoI, and HpaI, which cut singly within TbrTOP2 at nucleotide positions 1515, 1139, and 2750, respectively, gave in each case two fragments as expected: 9 and 5.1 kb for Asp718 (lane 4 of Fig. 2); 8.5 and 4.3 kb for XhoI (lane 5 of Fig. 2; and 11 and >14 kb for HpaI (lane 6 of Fig. 2). Because the fainter, slower-migrating bands in lane 4 are not stoichiometric, while the slowest migrating band in lane 5 appears to be the sum of the two smaller bands, they are probably due to incomplete digestion of the genomic DNA samples. EcoRI restriction endonuclease, which is not expected to cut within the sequenced region, yielded an expected single band with a size around 14 kb (lane 2 of Fig. 2). In addition to the blot analysis, two additional observations confirmed the likelihood that the TbrTOP2 gene was present as a single copy. First, the 5.6-kb BarnHI fragment carrying the bulk of the gene plus 2 kb of downstream sequences, including another open reading frame, did not crosshybridize with the upstream 6.5-kb BamHI fragment carrying the first 291 nucleotides of TbrTOP2. Second, no sequences corresponding to any part of TbrTOP2 were identified downstream of the gene in the 5.6-kb BamHI fragment. Thus, no homologous regions were identified for at least 6 kb upstream and 2 kb downstream from TbrTOP2. Discussion

We have cloned and sequenced the gene TbrTOP2 encoding T. brucei DNA topoisomerase II through the use of a mixed oligonucleotide probe encoding a septapeptide Met-Ile-MeZ-Thr-

148

Asp-Gin-Asp. Interestingly, the first amino acid of the corresponding septapeptide in the T. brucei enzyme turned out to be a leucine and, therefore, only a maximum of 19 contiguous nucleotides in the mixed probe matched the TbrTOP2 sequence. The successful cloning of the human and trypanosome TOP2 gene through the use of this probe suggests that it can be used as an universal probe in the cloning of the TOP2 gene of any eukaryotic organism. Based on the sequence data presented here and elsewhere [18,21,22,24], oligonucleotide probes can also be readily designed for the cloning of prokaryotic type II DNA topoisomerase genes. The nucleotide sequence of TbrTOP2 and the amino acid sequence deduced from it show few surprises. Among the amino acids in the trypanosome enzyme that are strictly conserved in all type II DNA topoisomerase of known sequences (doubly underlined in Fig. 2), Tyr771 is readily identified as the active site tyrosine from its position in the polypeptide chain and from the strictly conserved arginine immediately preceding it [33]. When the amino acid sequences of the five eukaryotic enzymes from T. brucei, D. melanogaster, S. cerevisiae, 5. pombe and humans are compared, the trypanosome enzyme exhibits less homology that that among the other four; identical residues found in the other four are often re.piaL:eu . . . . . . . . in . . me t r ypanosome enzyme. A stron giy hydrophilic stretch of 36-52 amino acids present around residue 1100 (amino acids 1061-1117 in D. melanogaster, 1061-1108 in S cerevisiae, 1060-1096 in S. pombe and 1084-1127 in humans) is notably missing in the T. brucei enzyme, as it is absent in the B. subtilis and phage T4 enzymes, although present in E. coli gyrase. The lower degree of homology exhibited by trypanosome DNA topoisomerase II relative to the other eukaryotic type II topoisomerases is consistent with the position of this organism on the evolutionary ladder [34,35]. Furthermore, since the type II and type I topoisomerases have no significant sequence homology, there is ao question that the gene which has been cloned is a type II topoisome~ase. The DNA sequences regulating trypanosome transcription and translation have proved elusive. In keeping with the finding that trypanosome

mRNAs possess a spliced leader sequence [36], several potential trypanosome RNA splice sites, (C/U),NNAG, are located upstream of t~e first ATG start codon in TbrTOP2. Furthermore, the overall Kozak consensus sequence for eukaryotic ribosome binding sites, GCCGCC(A or G__)CCATGG [36], apparently does not hold for trypanosome genes; only the underlined critical purine at position - 3 in the Kozak consensus sequence is present in the trypanosome genes. When a total of 35 trypanosome gene sequences available in GenBank, in several recent publications [38-40], in press [41], and in preparation (B. Smiley, personal communication) were surveyed, 30 are A residues and 4 are G residues at this position. A pyrimidine (C) is present at this position only in the gene encoding the large subunit of RNA polymerase III [39]. Two other VSG sequences with a pyrimidine (C) at position - 3 are known either to be a pseudogene or to have had the spliced leader acceptor site removed (B. Smiley, personal communication). The cloning and sequencing of a trypanosome DNA topoisomerase II gene homologous to other eukaryotic type II DNA topoisomerases of nuclear origin should be useful in answering the question on the existence of a mitochondrial type II DNA topoisomerase d~stinct from the nuclear enzyme in the trypanosomes. There is now strong evidence that a type ii enzyme with a peptide mass of 132 kDa is enriched in the kinetoplast of C. fasciculata [17]. Although the gene encoding this enzyme could be distinct from CfaTOP2 the C. fasciculata equivalent of TbrTOP2, we feel that the alternative is more likely. The agreement between the peptide masses of the 132-kDa C. fasciculata enzyme and other eukaryotic DNA topoisomerases II, especially that of the T. brucei enzyme predicted from the TbrFOP2 gene sequence, hints that the C. fasciculata enzyme might fall in the same category as the others. Ample precedence exists for mitochondrial and cytosolic enzymes encoded from a single gene [42]. Furthermore, as mentioned in the Introduction, it is known that treatment of Trypanosoma equiperdum with protein denaturants in the presence of a number of eukaryotic DNA topoisomerase IItargeting antitumor drugs, which are known to stabilize the cleavable complexes between DNA

149

and eukaryotic DNA topoisomerase II, leads to linearization of the kinetoplast minicircles with protein molecules bound to both 5' termini of the severed ends [11]. Thus, either a distinct kinetoplast type II topoisomerase is also acted upon by the drugs targeting the nuclear enzyme or, more likely, the nuclear type II enzyme is also present in the kinetoplast. Finally, the economic and health hazards of the trypanosomes make the search of potential drug targets in these organisms a pressing matter. In view of the importance of both prokaryotic and eukaryotic DNA topoisomerase II as targets of therapeutics, the cloning and sequencing of the

gene encoding the trypanosome enzyme should facilitate the screening and design of drugs against these parasites.

Acknowledgements We thank Dr. Paul Caron for his help in the compilation and analysis of the sequence data, and Drs. J.C. Boothroyd and C.-C. Wang for providing materials. This work was supported by a U.S. Public Health Service Grant (GM 24544). P.R.S. was a visiting scholar at Harvard University in the year 1988.

References 1 Wang, J.C. (1985) DNA topoisomerases. Annu. Rev. Biochem. 54, 665-697. 2 Vosberg, H.-P. (1985) DNA topoisomerases: enzymes that control DNA conformation. Curr. Topics Microbiol. Immunol. 114, 19-102. 3 Yanagida, M. and Wang, J.C. (1987) Yeast DNA topoisomerases and their structural genes. In: Nucleic Acids and Molecular Biology, Vol. 1 (Eckstein, F. and Lilley, D.M.J., eds.), pp. 196-209, Springer-Verlag, Berlin/Heidelberg. 4 Liu, L,F. (1989) DNA topoisomerase poisons as antitumor drugs. Annu. Rev. Biochem. 58, 351-375. 5 Drilica, K. and Franco, R.J. (1988) Inhibitors of DNA topoisomerases. Biochemistry 27, 2253-2259. 6 Glisson, B.S. and Ross, W.E. (1987) DNA topoisomerase IL A primer on the enzyme and its unique role as a multidrug target in cancer chemotherapy. Pharmacol. Ther. 32, 89-106. 7 Minford, J., Pommier, Y., Filipski, J., Kohn, K.W., Kerrigan, D., Mattern, M., Michaels, S., Schwartz, R. and Zwelling, L.A. (1986) Isolation of intercalator-dependent protein-linked DNA strand cleavage activity from cell nuclei and identification as topoisomerase II. Biochemistry 25, 9--16. 8 Stuart, K. (1983) Kinetoplast DNA, mitochondrial DNA with a difference. Mol. Biochem. Parasitol. 9, 93-104. 9 Simpson, L. (1987) The mitoehondrial genome of kinetoplastid protozoa. Genomic organization, transcription, replication and evolution. Annu. Rev. Microbiol. 41, 363-382. 10 Ryan, K.A., Shapiro, T.A., Rauch, C.A. and Englund, P.T. (1988) Replication of kinetoplast DNA in trypanosomes. Annu. Rev. Microbiol. 42, 339-358. 11 Shapiro, T.A., Klein, V.A. and Englund, P.T. (1989) Drug-promoted cleavage of k~r~etoplastminicircles. J. Biol. Chem. 264, 4173--4178. 12 Shlomai, J. and Zadok, A. (1983) Reversible decatenation of kinetoplast DNA by a DNA topoisomerase from trypanosomatids. Nuclei- Acids Res. 11, 4019--4034.

13 Shlomai, J. and Linial, M. (1986) A nicking enzyme from trypanosomatids which specifically affects the topological linkage of duplex DNA circles. J. Biol. Chem. 261, 16219-16225. 14 Chakraborty, A.K. and Majumder, H.K. (1987) Decatenation of kinetoplast DNA by an ATP-dependent DNA topoisomerase from the kinetoplast hemoflagellate Leishmania donovani. Mol. Biochem. Parasitol. 26, 215-224. 15 Douc-Rasy, S., Kayser, A., Riou, J.-F. and Riou, G. (1986) ATP independent type II topoisomcrase from trypanosomes. Proc. Natl. Aead. Sci. USA 83, 7152-7156. 16 Melendy, T. and Ray, D.S. (1989) Novobiocin affinity purification of a mitochondrial type II topoisomcrase from the Trypanosomatid Crithidia fasciculata. J. Bio!. Chem. 264, 1870-1876. 17 Melendy, T., Sheline, C. and Ray, D.S. (1988) Localization of a type II DNA topoisomerase to two sites at the periphery of the kinetoplast DNA of Crithidia fasciculata. Cell 55, 1083-1088. 18 Tsai-Pflugfelder, M., Liu, L.F., Liu, A.A., Tewey, K.M., Whang-Peng, J., Knutsen, T., Huebner, K., Croce, C.M. and Wang, J.M. (1988) Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22. Proc. Natl. Acad. Sci. USA 85, 7177-7181. 19 Labeit, S., Lehrach, H. and Goody, R.S. (1987) DNA sequencing using alpha-thiodeoxynucleotides. Methods Enzymol. 155, 166--177. 20 Zhang, H., Scholl, R., Browse, J. and Somerville, C. (!988) Double-stranded DNA sequencing as a choice for DNA sequencing. Nucleic Acids Res. 16, 12220. 21 Giaever, G., Lynn, R., Goto, T. and Wang, J.C. (1986) The complete nucleotide sequence of the structural gene TOP2 of yeast DNA topoisomerase II. J. Biol. Chem. 261, 12448--12454. 22 Wyekoff, E., Natalie.; D., Nolan, J., Lee, M. and Hseih, T.-S. (1989) Structure of the Drosophila topoisomerase II gene. Nucleotide sequence and homology among topoisomerases II. J. Mol. Biol. 205, 1-13.

150 23 Borst, P., Van der Ploeg, M., Van Hoek, J.F., Tas, J. and James, J. (1982) On the DNA content and ploidy of trypanosomes. Mol. Biochem. Parasitol. 6, 13-23. 24 Uemura, T., Morikawa, K. and Yanagida, M. (1986) The nueleotide sequence of the fission yeast DNA topoisomer.. ase II geae: structural and functional relations to other DNA topoisomerases. EMBO J. 5, 2355-2361. 25 Swanberg, S.L. and Wang, J.C. (1987) Cloning and sequencing of the Escherichia coil gyrA gene coding for the A subunit of DNA gyrase. J. Mol. Biol. 197, 729-736. 26 Yamagishi, .I., Yoshida, H,, Yamayoshi, M. and Nakamura, S. (1986) Nalidixic acid-resistant mutations of the gyrB gene of Escherichia coll. Moi. Gen. Genet. 204, 367-373. 27 Moriya, S., Ogasawara, N. and Yoshikawa, H. (1985) Structure and function of the region of the replication origin of the Bacti~s _~::btilis chromosome III. Nucleotide sequence of some 10000 base pairs in the origin region. Nucleic Acids Res. 13, 2251-2265. 28 Huang, W.-M. (1986) The 52-protein subunit of T4 DNA topoisomerase is homologous to the gyrA-protein of gyrase. Nucleic Acids Res. 14, 7379-7390. 29 Huang, W.-M. (1986) Nucleotide sequence of a type II DNA topoisomerase gene, bacteriophage T4 gene 39. Nucleic Acids Res. 14, 7751-776. 30 Huang, W.-M., Ao, S.-Z., Casjens, S., Orlandi, R., Zeikus, R., Weiss, R., Winge, D. and Fang, M. (1988) A persistent untranslated sequence within bacteriophage T4 DNA topoisomerase gene 60. Science 239, 1005-1012. 31 Clayton, C.E. (1988) The molecular biology of the Kinetoplastidae. In: Genetic Engineering, Vol. 7 (Rigby, P.W.J., ed.), pp. 1-56, Academic Press, New York.

32 Maniatis, T., Fritsch, E.F, and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual, Coid Spring Harbor Laboratory, Cold Spring Harbor, NY. 33 Worland, S. and Wang, J.C. (1989) Inducible over expression, purification and active site mapping of DNA topoisomerase II from the yeast Saccharomyces cerevisiae. J. Biol. Chem. 264, 4412--4416. 34 Sogin, M.L., Elwood, H.J. and Gunderson, J.H. (1986) Evolutionary diversity of eukaryotic small-subunit rRNA genes. Proc. Natl. Acad. Sci. USA 83, 1383--1387. 35 Michels, P.A.M. (1986) Evolutionary aspects of trypanosomes: analysis of genes. J. Mol. Biol. 24, 45-52. 36 Parsons, M., Nelson, R.G., Watkins, K.P. and Agabian, N. (1984) Trypanosome mRNAs share a common 5' spliced leader sequence. Cell 38, 309--316. 37 Kozak, M. (1989) The scanning model for translocation: an update. J. Cell Evoi. 108, 229-241. 38 Kirchhoff, L.V., Kim, K.S., Engman, D.M. and Donelson, J.E. (1988) Ubiquitin genes in Trypanosomatidae. J. Bval. Chem. 263, 12698--12704. 39 Kock, J., Evers, R. and Cornelissen, A.W.C.A. (1988) Structure and sequence of the gene for the I,~rgest subunit of trypanosomal RNA polymerase III. Nucleic Acids Res. 16, 875,~8772. 40 Evers, R., Hammer, A., Kock, J., Jess, W., Borst, P., Memet, S. and Cornelissen, W.C.A. (1989) Trypanosoma brucei contains two RNA polymerase II largest subunit genes with an altered C terminal domain. CeB 56, 585--597. 41 Suzuki, T., Sato, M., Yoshida, T. and Tuboi, S. (1989) Rat liver mitochondrial and cytosolic fumarases with identical amino acid sequences are encoded from a single gene. J. Biol. Chem. 264, 2581-2586.