PLASMID

24, 163-189 ( 1990)

REVIEW The Tn27 Subgroup

of Bacterial Transposable

Elements

JOHNGRINSTED,*FERNAND~DELACRUZ,-~ANDR~~DIGERSCHMITT# *Department

of Microbiology, University of Bristol, Medical School, University Walk, Bristol BSS I TD, U.K.; tDepartamento de Biologia Molecular, Universidad de Cantabria. 39011 Santander, Spain; and SLehrstuhl flir Genetik, Universitiit Regensburg, Germany

Received May 17, 1990; revised September 28, 1990 The Tn3 family of transposable elements is probably the most successfulgroup of mobile DNA elements in bacteria: there are many different but related members and they are widely distributed in gram-negative and gram-positive bacteria. The Tn21 subgroup of the Tn3 family contains closely related elements that provide most ofthe currently known variation in Tn3-like elements in gram-negative bacteria and that are largely responsible for the problem of multiple resistance to antibiotics in these organisms. This paper reviews the structure, the mechanism of transposition, the mode of acquisition of accessory genes, and the evolution of these eleIllentS.

0 1990 Academic

Press, Inc.

ends of a particular element are usually the same (they are inverted repeats (IRS)), so that I. 1. Bacterial Transposable Elements both can be recognized in the same way. The Transposable elements have been found in specific recognition of this sequenceis a funcall genera of bacteria in which they have been tion of an element-encoded protein, the searched for. These elements play a central transposase. These requirements seem to role in evolution by providing mechanisms have been met many times during evolution, for the generation of diversity, and, in con- and there are many unrelated classesof elejunction with DNA transfer systems, for its ments. In bacteria, most transposable elerapid dissemination to other bacteria (Ajioka ments are either insertion sequences(which and Hartl, 1989; Syvanen, 1984). An out- are lessthan about 1500 bp) or elements that standing example of this activity is the central are related to Tn3. There are many evolurole transposable elements play in the rapid tionarily distinct groups of insertion sespread of antibiotic resistance among bacte- quences (Galas and Chandler, 1989), and rial populations, especially those involved in they can cooperate to form composite transhospital-acquired infections. Nowadays, posons, in which a segment of DNA is most of the transposons encoding multiresis- flanked by copies of an insertion sequenceso tance found in natural isolates of gram-nega- that the whole segment can transpose. The tive bacteria belong to the Tn21 subgroup of Tn3-like elements, on the other hand, are the Tn3 family of transposable elements; in phylogenetically related and have a miniparticular, these Tn2I-like transposons are mum size of rather more than 3 kb (due to consistently found in isolates of bacteria re- the size of the gene that encodes their transsistant to newly introduced antibiotics (gen- posase). Tn3 was the first element in the group that was extensively characterized. tamycin, amikacin, modified penicillins, These elements are probably the most sucetc.). The transposition process involves specific cessful family of mobile DNA elements in recognition of the ends of the element. Both bacteria; there are many different types that 1. INTRODUCTION

163

0147-619X/90 $3.00 Copyright 0 1990 by Academic Press, Inc. All rights ofreproduction in any form reserved.

164

REVIEW

element. The cointegrate can be resolved into the new recombinant plus the original donor SPECIFIC replicon by the action of “resolvase,” an element-encoded site-specific recombination DONOR RECIPIENT enzyme that acts at a specific site (res) in the element. The direct insertion of the element into the recipient without a cointegrate intermediate (“cut and paste”) can also be INTRRYEDUTE achieved from the Shapiro intermediate. In this case,there is specific nicking of the intermediate at the ends of the element. Transposition of Tn3-like elements usually involves a RESOLllTlON cointegrate intermediate (review in Sherratt (1989)). This is not always the case,however, RECOMBINANT COINTECRATE and 1- 10% of transposition products of Tn3, FIG. 1. Model of the mechanism of transposition. Tn21, Tn2501, and TnlOOO did not involve Lines represent single DNA strands with those of the cointegrates (Bennett et al., 1983; Michiels et donor replicon filled and of the recipient hatched. The al., 198’7; Tsai et al., 1987). This has been transposable element is shown as arrows, with the arrow heads indicating the 5’ ends. Newly synthesised DNA is described as “direct transposition” in the shown as dotted. Single strand cuts are introduced into quoted papers, and is simply explained by the the donor replicon at the 3’ margins of the transposable cut and paste mechanism explained above. element, and in the recipient at a random site such that Tn3-like elements are typified by IRS of staggered cuts with 5’ single strand extensions are proabout 38 bp, two genes, tnpA (about 3 kb) duced. 5’ ends of the recipient are then joined to 3’ ends of the donor to give a Shapiro intermediate (boxed). Spe- and tnpR (about 0.55 kb), which encode, recific cutting at the 5’ ends of the element in this interme- spectively, transposaseand resolvase,and res diate (indicated by the arrows), followed by filling in (about 130 bp), at which resolvase acts. In all gives a recombinant by “direct transposition”; replicaTn3-like elements examined except Tn4556 tion of the element in the intermediate, using the 3’ ends (see below), the tnpA gene terminates close to of the recipient as primers of the leading strands of the replicating forks, gives a cointegrate, which can then be or within one of the IRS, and, where present, resolved by recombination across the directly repeated tnpR and res are just upstream of tnpA. The copies of the element to give the recombinant. elements are flanked by a 5-bp repetition of host DNA.

4

are distributed widely through both gramnegative and gram-positive genera.

1.3. The Tn21 Subgroup of Tn3-like Elements

The Tn3 family was initially divided into the Tn3 subgroup and the Tn22 subgroup (Hefhon, 1983), partly on the basisofthe relaThe sequence of reactions involved in the tive direction of transcription of the tnpA and transposition of Tn3-like elements is almost tnpR genes. This classification needs now to certainly similar to that worked out for bacte- be expanded, to incorporate newly discovriophage cc,in which the transposasebinds to ered elements which do not fall into either of the IRS and mediates joining of donor and these two categories (some of which, indeed, recipient replicons (a “Shapiro interme- do not even contain a tnpR gene; see next diate”; see Fig. 1) (Sherratt, 1989). Replica- section). However, the Tn21 subgroup is tion of this intermediate then gives a cointe- well-defined and it is on this that this review grate of the donor and recipient replicons sep- concentrates. This subgroup contains by far arated by directly oriented copies of the the largest number of known elements of the

1.2. Transposition of Elements in the Tn3 Family

REVIEW

Tn3 family, partly due to a mechanism in some of them for the rapid acquisition of accessory genes (Section 7); it also provides many examples of closely related yet different elements, which give a full picture of the way in which transposable elements can evolve. General characteristics of the entire Tn3 family have been reviewed recently (Kleckner, 1981; Heffron, 1983; Grindley and Reed, 1985; Sherratt, 1989). 2. SUBGROUPS

OF THE Tn3 FAMILY

In judging the evolutionary relatedness of transposable elements, two groups of genes can be considered: these are genes that encode transposition functions, and accessory genes, such as those that encode resistance to antibiotics. In general, the latter genescan be acquired easily, so that they are not relevant to the long-term relatedness of the elements. For this, genesand sites required for transposition (mainly tnpA, tnpR, res, and the IRS) have to be considered. The homology between the transposases and resolvases of various elements of the Tn3 family is shown in Fig. 2, and the comparison of IR sequences is shown in Fig. 3. In addition to the Tn3 and Tn21 subgroups, there are at least three others; in general, elements in different subgroups encode transposition proteins that are only about 30% homologous and IRS that are less than 26/38 identical, while elements within a subgroup encode proteins that are at least 70% homologous. The groups are as follows. (A) The Tn3 subgroup. This consists of Tn3 (which encodes resistance to penicillin) and its close relatives such as Tnl and Tn2. TnZOOO is not so closely related (with a transposase only 64% homologous to that of Tn3, and a resolvase with 80% homology), but is also usually included. An interesting recent addition to this subgroup is Tn1331, which encodes both resistance to penicillin and a transposase that complements that of Tn3, but also carries aacA, a gene determining resistance to amikacin (Tolmasky and

165

Crosa, 1987; Nobuta et al., 1988); flanking sequences of this gene contain a “hot spot” for recombination, as seen in Tn2l-like elements (Schmidt et al., 1989; seeSection 7). It seems likely that TnA/3 is also in this category: the element carries uphC, a gene encoding resistance to streptomycin but also encodes resistance to penicillin and contains DNA that is homologous to the tnpA and tnpR genes of Tn3 (Levesque and Jacoby, 1988; Lafond et al., 1989). The tnpA and tnpR genes of elements in the Tn3 subgroup are transcribed divergently. (B) The Tn21 subgroup.Table 1 lists naturally occurring elements in this subgroup. The tnpA and tnpR genes of these elements are transcribed in the same direction, and the products of these genes are at least 70% homologous (Fig. 2B). The IR sequences and homologies of the transposition proteins show that this subgroup can be further divided into the Tn21 branch (Tn21 itself and Tn3926 in Figs. 2B and 3) and the Tni722 branch (Tn501, Tn1721, and Tn4653 in Figs. 2B and 3). The first Tn21-like element to be demonstrated was Tn4 (Kopecko et al., 1976) and Tn21 itself was first mentioned by Nisen et al. ( 1977). There is a plethora of elements whose transposition functions are very closely related to those of Tn2Z but which contain different antibiotic resistance genes. Elements with essentially identical transposition functions have been found in many genera and in many parts of the world (seeTable 1). For instance, Tn4 was discovered as part of R 1, a plasmid from Salmonella paratyphi isolated in the United Kingdom, while Tn21 was originally found as part of R 100, a plasmid from Shigellaflexneri isolated in Japan. Tn2Z itself and many of these elements contain a gene coding for an integrase (in& which is responsible for the easy acquisition of accessorygenes (see Section 7). (C) Tn2501. This is currently the sole known element in this group. It was discovered as part of a plasmid from Yersinia enterocolitica. The element is more closely related to the Tn21 subgroup than to other elements shown (see Figs. 2A and 3). The tnpA

166

REVIEW

A

B

TWA Tn1722 TnuR

72

72

98

100

83

lab

99

100

FIG. 2. Percentage positional identity of transposition proteins of transposable elements in the Tn3 family. A compares examples of the whole family, B just of the Tn2J subgroup. Complete sequencesanalysed are from Allmeier et al. (1990; TnJ72J), Brown et al. (1985; Tn5OJ), Diver et al. (1983; TnZJ, TnSOJ, TnJ72J), Heffron et al. (1979; Tn3), Mahillon and Lereclus (1988; T&430), Michiels et al. (1987; Tn250J), Shaw and Clewell (1985; Tn917-some frameshifts have to be made to bring the tnpA gene into line), Tsuda et al. (1989; Tn4653), Turner and Grinsted (1987, 1989; TnZSOJ, Tn3926), and Ward and Grinsted (1987; Tn2J). The complete sequenceof Tn4556 is also known (Siemieniak et al., 1990); this has not been analysed. “Tn4430 does not possessa tnpR gene. bathetnpR gene of Tn3926 has not been completely sequenced. Assuming that the protein is 186 amino acids, as with the other resolvases shown in B, the sequence analysed misses the amino acids at l-3 and 103-126 (Turner, 1989). “Only a small part of the tnpA gene of Tn4653 has been sequenced.The sequence analyzed only comprises the first 26 amino

and tnpR genesof Tn2501 are transcribed divergently (Michiels et al., 1987). (0) Tn917. Tn55I is very similar to Tn917. These elements come from grampositive bacteria. Their tnpA and tnpR genes are transcribed in the same direction (Shaw and Clewell, 1985). (E) Tn4430. This is the only known element in this group; it is also from gram-positive bacteria, although only distantly related to Tn927. What is most interesting about Tn4430 is that it does not contain a tnpR gene; its resolution is accomplished (although inefficiently) by the product of a “mp I” gene (Mahillon and Lereclus, 1988). The TnpI protein belongs to the integrase family of recombinases, a group of proteins related to the int protein of bacteriophage X (Argos et al., 1986). (F) Tn4556. This element was isolated from Streptomyces fradiae; it is the only known example of this subgroup. Its IRS show it to be quite different from the rest (Fig. 3) (Olson and Chung, 1988). Its sequence (Siemieniak et al., 1990) shows that it is remarkably different: the tnpA gene starts just inside an IR, and then, downstream of this is res followed by tnpR. This is different from all other known elements in the Tn3 family. (G) Other elements.The subgroups above have been well-characterized, particularly by sequencing of transposition genes. Other less well described Tn3-like elements probably comprise additional subgroups. For instance, there is Tn4651, which carries genes encoding toluene degradation. This element does not have a resolvasebut does contain two uncharacterized genes involved in resolution, and its IRS set it apart from other elements (Fig. 3) (Tsuda et al., 1989). A scheme for the overall evolution of elements of the Tn3 family is shown in Fig. 4. It is suggestedthat the initial step in the divergence of these elements was the combination of the tnpA/IR complex with either a gene for acids at the N terminus and the last 37 amino acids (Tsuda et al., 1989).

167

REVIEW 10

IR-39260a IR-Pit IR-210

IR-5010 IR-SOlt IR-1721tb IR-46530~

IR-2501t IR-25010

IR-3

IR-9170 IR-917t IR-4430 IR-45560

IR-4556t IR-46510

IR-4651t

20

30

GGGGTCGTC&&AAAATAAAG~ACGCTAAG GGGGTCGTCTCAGAMA CGGAAAATAAAGCACGCTAAG GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG GGGGGAACCGCGGAMAAATCGTACGCTAAG GGGGGGCTCGClCGTACGCTAAG GGGGAGCCCGCAEMU% GGAAAAMT CGTACGCTMG GGGGACGATAGAGAATTCGGAAAAAATCGTACGCTAAG GGGGTCCGCCTGGAAAACGGAAATTATCCCACGCTAAGactgtttttt GGGGTCCGCTTGGAAAACGGAAAATATCCCACGTTAAGcctgtttttt

GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG GGGGTCCCGAGCGCCTACGAGGAATTTGTATCGATAAG GGGGTCCCGAGCGCTTAGTGGGAATTTGTATCGATAAG GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAG GGGGGTTGAGGAACATCCGAACGAAAACCGGCGCTAAG CGGGGTTGAGGAACATCCGAACGAAAACCGGCGCTAAG GGGGTCATGCCGAGATAAGGCAAAAATTAGGACATTCGTTCTCTAA GGGGTTATGCCGAGATAAGGCAAAAATTAGGACATTCGTTCTGTAA

FIG.3. IR sequencesof transposable elements of the Tn3 family. The top group showsIRS of elements of the Tn2l subgroup, with boldface indicating positions where there are identical residuesin all. The second group shows the IRS of Tn2501, which is not a Tn2I-like element but whose IRS are recognised by the Tn21 transposase(see text); arrow heads show conserved positions for all the IRS recognised efficiently by the Tn2l transposase. The third group shows IRS of other elements belonging to the Tn3 family. Underlined sequencesindicate EcoRI sites. The sequencesare labelled according to the element of origin, with the following letter showing the relevant end of the element in those caseswhere the IRS are not the same (“t” stands for tnpA end and “0” for the other end). ‘IR-3926t is the same as IR-2 1t. bIR- 1721o is the same as IR-5010. ‘IR-4653t is the same as IR-1721 t. Sequencesare from Lett (personal communication) for Tn3926, Zheng et al. (I 98 1) for Tn21, Brown ef al. (1980) for Tn501, Schaffl et al. (198 1) for Tnl721, Tsuda et al. (1989) for Tn4651 and Tn4653, Michiels and Comelis (1984) for Tn2501, Heffron et al. (1979) for Tn3, Shaw and Clewell(1985) for Tn917, Mahillon and Lereclus (1988) for Tn4430, and Olson and Chung (1988) for Tn4556.

resolvase (in most cases)or an integrase gene (in the caseof Tn4430). The product of such gene associations enables efficient, RecA-independent resolution of cointegrate intermediates. The resolvase is related to invertases (Diver et al., 1983; Sherratt, 1989), which can invert DNA segments between recognition sites (Glasgow et al., 1989). If the ancestral tnpR gene were capable of inverting the DNA segment containing the tnpR gene, the different relative directions of transcription of tnpR and tnpA would be easily explained (Grinsted, 1986; Schmitt et al., 1985a,b): the tnpR gene would have started as an invertible segment that would then be locked into one orientation or the other by mutation of the

inversion site on one side or the other. Locking into one orientation or the other could have occurred a number of times (we suggest in Fig. 4, for instance, that Tn3 and Tn2501 diverged at different times), and it is clear that classification of the elements simply on the basis of the orientation is not very useful. The subsequent evolution of the elements by acquisition of accessory DNA is discussed below. 3. STRUCTURE

3.1. Basic Structure of the Transposition Module The order of the genes in elements of the Tn21 subgroup is res-tnpR-tnpA (Fig. 5).

UK, Salmonella paratyphi Japan; Shigella flexneri Australia; Ps. aeruginosa U.S.A.; Sal. typhimurium UK, Ps. aeruginosa France.;Ps. aeruginosa Brazil; Escherichia coli Spain; Ps. aeruginosa India; Escherichia coli India; E. coli Germany; E. coli U.S.A.; Proteus mirabilis Japan; Enterob. cloacae Germany; Sal. typhimurium Germany; Sal. typhimurium Japan; Shigella sonnei Japan; Shigella sonnei Japan; E. coli Japan Japan; Kleb. pneumonia Japan; E. coli Japan; Proteus mirabilis France; Y. enterocolitica Germany; E. coli Pseudomonasputida

Tn4 Tn21 Tn501 Tn1401 Tn1406 Tn 1408 Tn1409 Tn I696 Tnl721 Tn1722 Tnl771 Tn I831 TnZlOl Tn2410 Tn2411 Tn2424 Tn2425 Tn2603 Tn2607 Tn2608 Tn2610 Tn2613 Tn3926 Tn4000 Tn4653 bla(TEM- l)d sul aad. mer sul aadA mer mer std aad bla (PSE- 1) mer sul aadB bla(OXA-5) mer(?) sul aaa!4 bla(CARB-3) sul aadA aadB cat bla(OXA-4) mer sul aaa!4 cml aacCl tet none tet mer sul aadA mer sul aadA bla(PSE- 1) mer sul bla(OXA-2) mer sul aad. mer sul aadA cat aacA1 mer sul aadA mer sul aadA bla(OXA- 1) bla(TEM- Ip sul aadA mer sul aaa!A sul aadA bla(PSE- 1) mer mer mer sul aadA aabB xylf

Resistance genes” 25 19.9 8.4 15.9 17.2 25 14.6 14 11.2 5.6 11.2 17 14.6 18.5 18 25 22 20 24 13.5 24 7.2 7.8 22 70

Tn21 Tn21 Tn1722 Tn21 Tn21 Tn21 Tn21 TnZl Tn1722 Tn1722 Tn1722 TnZl Tn21 TnZIITnl722 Tn21 Tn21 Tn21 Tn21 Tn21 Tn21 Tn21 Tn21 Tn21 Tn21 Tn1722

2 3 4, 19, 20 4, 20 4, 20 4, 20 5 6 6 7 8 9 10 10 11 12 13, 14 13 13 15 13, 14 16 17 18

Refs.

a The genesencode the following: aadA, aminoglycoside 3”-adenyltransferase(AAD-@“), specifying resistance to streptomycin and spectinomycin); aadB, aminoglycoside 2” adenyltransferase (ANT-(2”), resistance to gentamycin and tobramycin); aacA, aminogiycoside 6’-JV-acetyltransferase(AAC-(6’) resistance to amikacin and netilmicin); aacC1, aminoglycoside 3-N’-acetyltransferase (AAC-(3)1), resistance to gentamycin but not to tobramycin); blu, &lactamase (of the type indicated in parentheses); cat, chloramphenicol acetyltransferase (resistance to chloramphenicol); cml, resistance to chloramphenicol (not cut-mediated); mer, the mer operon, encoding resistance to mercuric ions; sul, sulfonamide-resistant dihydropterate synthetase; tet, resistance to tetracycline; xyl, ability to degrade toluene. bThe Tn21 branch and the Tn1722 branch of the Tn21 subgroup are defined in the text. ’ References: 1, Kopecko et al., 1976; 2, Nisen et al., 1977; 3, Bennett et al., 1978;4, Lafond et al., 1989; 5, Rubens et al., 1979;6, Schmitt et al., 1979; 7, Schoffl and Ptihler, 1979b; 8, Meyer et al., 1985; 9, Katsu et al., 1982: 10, Kratz et al., 1983a; 11, Meyer et al. 1983; 12, Meyer et al. 1985; 13, Tanaka et al., 1983a; 14, Tanaka et al. 1983b; 15, Yamamoto et al., 1983; 16, Lett et al., 1985; 17, Schmidt, 1984; 18, Tsuda et al., 1989; 19, Medeiros et al., 1982; 20, Levesque and Jacoby, 1988. d With Tn4, the bla gene is part of Tn3. which is inserted in the mer region; and with Tn2607, the blu gene is part of Tn2601, also inserted in mer. ’ In Tn2410, the b/a gene was probably inserted by homologous recombination of Tn2411 and an R46-related plasmid, resulting in loss of the aadA gene (Nies et al., 1985). ‘The xyl genes of Tn4653 are actually part of another Tn3-like element (Tn4651) (seetext).

Origin

Element

TRANW~SAFILEELEMENTSOFTHET~ZISUBCROUP

TABLE 1

169

REVIEW

bla-

--

I

erm-

FIG. 4. Evolution of the Tn3 family of transposable elements. Details are given in the text. Evolution of the subgroup of TnZI-like elements (the big box in the figure) is shown in Fig. 8. Boxes containing the letters “A,” “ R,” and “I” represent the genesencoding transposase(tnpA), resolvase (tnpR) and integrase, respectively; the small closed box is res. Arrows show directions of transcription; blu encodes resistance to penicillin and em resistance to erythromycin.

The res site is 130 bp and has the typical three-site structure seenin Tn3 (Rogowsky et al., 1985); tnpR and tnpA are transcribed in the same direction away from res, and are separated only by 2 or 3 bp (see below), and tnpA terminates just within one of the IRS. The suggested location of the initiation codon of tnpA is supported by the highly conserved region between this codon and the next possible one (Ward and Grinsted, 1987) and, in T&721, by showing loss of transposition function in a derivative with a deletion that extends into the genejust 10 bp beyond this codon (Section 6.1, Fig. 9). The IRS of Tn21-like elements are 38 bp, and are closely related (Figs. 3A and 3B). The IRS are also imperfect, with two or three differences between the ends (but Tn4653 has six differences). These differences are in the outer part of the IR. In both Tn21 and Tn501 there is an open reading frame that is upstream of res and actually terminates within Site I of res. This would give a protein of 116 amino acids and it has been claimed that this is a gene

(“tnpkf”) involved in regulation of transposition (Hyde and Tu, 1985); this is discussedin Section 6.2. The Tn21 subgroup can be divided into the Tn21 and the TnZ722 branches. These are differentiated by their transposition genes (Fig. 2B), their IRS (Fig. 3), and the patterns of complementation by their transposases (Section 5.3). The location of the transposition module and the general structures of various Tn21-like elements of both branches are shown in Fig. 6. 3.2. The Tn21 Branch A diagram of Tn21 is shown in Fig. 5. In general, the basic structure of an element of this branch is the mer operon plus the transposition genes. In the case of Tn21 itself, there is also an 11.2-kb insert (shaded in Fig. 5), which is discussed below in Section 4.2. The mer operon is complex and consists of at least six genesin Tn21 (seeFig. 5). The transposition genes of Tn21 are organized such

170

REVIEW

,

EHEH

lkb

,

E

FIG. 5. Physical and genetic map of transposon Tn21. The box in the centre represents Tn21 and shows the locations of the mer operon, the genesthat encode resistance to antibiotics (sul and au&I), and the genesthat are involved in transposition (trip). The shaded region in the middle of the element shows the 11.2 kb that is inserted when the sequence is compared with that of Tn.501 (Brown et al., 1986; see text, Section 4.2). Expanded maps of the llzer and trip regions are shown above and below, respectively, and an expanded map of the region including the resistance genes (from coordinate 11.6 to 15.9) is shown in Fig. 10. The various segments shown are each drawn to scale. The direction of translation of the various genes in the expanded maps is indicated by the directions the boxes are pointing. The region ofTn2l that is currently not sequencedis from coordinates 4.9 to 11.6. The overall map of the element is based on de la Cruz and Grinsted (1982). The detailed genetic map of the mer region is based on the sequence data from Barrineau et al. (1984) Misra et al. (1984, 1985) and Brown et al. (1986). The genetic map ofthe transposition region is basedon sequencedata from Diver et al. ( 1983) Hyde and Tu (1985) and Ward and Grinsted (1987). The start of fnpA4 is immediately adjacent to the outside margin of the 25-bp IR that flanks the central region (see above). (It should be noted that the tnpA4gene shown is of doubtful provenance (see text, Section 6.2).) The res site is indicated by the filled box. The typical pattern of EcoRl (E) and Hind111(H) sites of the trip region of elements that are closely related to Tn2I is indicated.

that there are 11-bp between res and the initiation codon of tnpR, and the distal end of the gene is just 2 bp from the start codon of tnpA (Diver et al., 1983; Schmitt et al., 1985b; Ward and Grinsted, 1987). The latter is also the case with Tn3926 (Turner and Grinsted, 1989) (the location of res in Tn3926 has not

yet been determined). The transposition genes of Tn21 itself have a characteristic set of EcoRI and Hind111sites (seeFigs. 5 and 7), which is seen in numerous elements isolated from all over the world (Tn4, Tn21, Tn1401, Tn1406, Tn1409, Tn1831, Tn2410, Tn2411, Tn2424, Tn2425, Tn2603, Tn2607, and Tn4000: Tanaka et al., 1983a,b; Schmidt, 1984; Meyer et al., 1983, 1985; Lafond et al., 1989). So, in spite of these elements differing dramatically with respect to their accessory genes(seeTable 1 and Fig. 1I), their transposition genes are nearly identical. Indeed, it is likely that they are much more like Tn21 than is Tn3926, which does not show these sites (Fig. 7) although encoding a transposase that is 87% homologous with that of Tn21 (Fig. 2B). Many of these elements with transposition genescontaining the restriction enzyme sites characteristic of Tn21 can be considered to have originated from a basic backbone of about 18 kb (equivalent to Tn2412: Kratz et al., 1983) (Fig. 7). This includes the mer, sul, and aad genes,but, together with the transposition apparatus, these only occupy about 10 kb, so there is about 8 kb that does not encode known traits. The various elements can be generated from this backbone by insertions and/or deletions in the hot spot on either side of the aad gene (see Section 7; Fig. 11) or in other regions (Fig. 7). Tn21 itself, for instance, contains just a 1S-kb insertion into the backbone (Clerget et al., 1981; insertion 2 in Fig. 7), and Tn4 contains an insertion of Tn3 into the mer operon (Foster et al., 1979; Schmidt, 1984; insertion 1 in Fig. 7). There are other elements of the Tn21 branch that contain very little noncoding DNA. Tn2613 and Tn3926, for example, contain just mer and complement the transposition functions of Tn21 (Lett et al., 1985; Tanaka et al., 1983a,b); they are only about 7.5 kb, however, and, assuming that the genes responsible for the Hg’ are similar to those of Tn21 and Tn501 (where they occupy about 4 kb: Brown et al., 1986) there is no room for more DNA other than the transposi-

171

REVIEW

Tn21 (18.8kb)

Tn1721 (ll.lkb)

Tn501 (8.4kb) 4

Tn4653 (?Okb)

-111111 Tn4661 (Mkb)

‘&,281(-, T..>:;:::.~:~::. (24kb)

wludlbk

~I...~..\:.

A

-

FIG. 6. Structure of TnZI-like elements. Details of the elements shown are given in the text. The boxes represent the transposition genes, as described in Fig. 3; those boxes that are hatched indicate genes of elements from the Tn21 branch, and the others of the Tnl722 branch. The box containing “A*” in Tnl721 indicates the direct repetition of 2 kb of the fnpA gene (see text), with the arrows showing the duplicated regions. The dotted region in the centre of Tn4653 representsTn4651. which is inserted as shown (seetext). xyl is the genesthat encode the ability to degradetoluene (part of Tn4651); other genesare defined in Table I.

tion functions (Fig. 7). It is suggestedthat an element such as these might have been the progenitor of Tn21 and its close relatives (Section 4).

3.3. The Tnl722 Branch Tn501, Tn1721, and Tn4653 differ from elements of the Tn21 branch in that there are 50 bp between tnpR and res and 3 bp between the end of the termination codon of tnpR and the start of tnpA (compared with 11 and 2 bp, respectively; seeFig. 9 for the sequenceof the DNA that contains the distal end of tnpR and the proximal end of tnpA) (Diver et al., 1983; Rogowsky et al., 1985; Tsuda et al., 1989). The products of both the tnpA genesand the tnpR genes of sequenced TnZ722-like elements show nearly 100% homology (Tn501, Tnl722, and Tn4653 in Fig. 2B), and the IRS are very closely related (Fig. 3B). Interestingly, although Tn4653 produces a functional resolvase (it complements that of T&721), this enzyme cannot resolve cointegrates of its parent element; this is because there is not a functional res site in this ele-

ment (Site I is missing), and it is the resolution functions of another element within Tn4653 (Tn4651; see Fig. 6) that resolve cointegrates (Tsuda et al., 1989). The archetype of this branch is Tnl722. This is the part of the tet transposon Tnl721 (see Fig. 6) that contains the transposition genes; it also contains an unidentified open reading frame of 1.8 kb (Allmeier et al., 1990). TnZ 722 is independently transposable (Schmitt et al., 1981b). In Tnl721 itself, 2 kb of the end of Tnl722 encoding the transposase (including the IR) is duplicated, so that Tn1721 contains three copies of the IR sequence (Schiiffl et al., 198la), enabling the transposase to recognize IRS flanking Tnl722 or Tn1721. Furthermore, the directly duplicated sequence flanks the tet genes(Fig. 6); this can result in RecA-dependent amplification of these genes(Schmitt et al., 1979; Wiebauer et al., 1981). A similar amplification has been reported for Tn1771 (Schiiffl and Ptihler, 1979), which is indistinguishable from Tnl721 (Schoffl et al., 1981). The tet genesin Tnl721 are closely related to those on plasmid RPl (Allmeier et al., 1990;

172

REVIEW

8 1 bp inside the element, indicating that the

mer genes were probably imported by transposition of a Tn21-like element (Tn2613, for example) into a Tnl722-like element; this was then probably followed by a resolvasemediated deletion (indicated by the sudden loss of homology at the crossover point of res when the sequencesof Tn501 and Tn22 are compared) (Grinsted and Brown, 1984, Schmitt et al., 1985a).

3.4. Tn2610 An element that combines the Tn2Z and Tn1722 branches is Tn2610, which has a FIG.7. Backbone of elements closely related to Tn21. Tndl-like IR and transposition genes at one This is based on figures presented by Schmidt (1984) and Meyer et al. (1985). Transposition genesare represented end, and a TnZ 722~like IR and transposition by the boxes, as described in Fig. 5, and the rest of the genesat the other (Fig. 6) (Yamamoto, 1989). backbone of the elements by the solid line. Insertions are Apparently these are not now independent numbered and are shown above this line: 1 is Tn3,2 is an insertion of about 1.5 kb, and 3 of about I .6 kb. EcoRI elements that are simply combining to form a and Hind111sitesare indicated by E and H below the line. composite transposon, but they must have been at some earlier time. Altenebuchner et al., 1983; Waters et al., 1983). The origin of Tn1722 probably involved insertion of Tn1722 close to the tet region of a plasmid like RPl; this was followed, either by a second insertion on the other side of tet (by intramolecular transposition, for example) and deletion, or by gene duplication of the tet and 2 kb of the tnpA gene (Altenbuchner et al., 1981; Grinsted, 1986). Tn46.53 is remarkable for its size: it is 70 kb. But 56 kb of this is another Tn3-like transposon (Tn4652) (Tsuda et al., 1989; see Fig. 6). This leaves about 8.5 kb to account for (assuming that 5.5 kb is Tnl722-like). The sequence of Tn46.53 diverges from that of Tnl722 within the res site (Tsuda et al., 1989), suggesting an insertion here. This explains the inactivity of res, in spite of the active tnpR (see above). Tn4651 could then have inserted into this expanded element. Tn5OZ encodes TnZI-like resistance to mercuric ions but Tnl722-like transposition functions (Brown et al., 1985, 1986; Fig. 2B). The sequenceof Tn501 revealed the probable reason for this anomaly: an IR of Tn21 starts

4. EVOLUTION OF THE Tn27 SUBGROUP

4.1. The Transposition GenesComprisea Single Unit In elements where the tnpA and tnpR genes are divergently expressed, with res between them, there can be interchange of tnpR genes between different elements by resolvase-mediated recombination. Within the Tn2Z subgroup, however, res is upstream of both tnpA and tnpR, so that this cannot occur, and, once formed, the tnpR-tnpA module would be expected to evolve as a single unit. But the homologies between the products of these genes from different elements (Fig. 2B) seem to contradict this: the resolvases are more highly conserved than the transposases,suggesting separate evolution. However, when the nucleotide homology of the genes are computed, the figures for tnpA and tnpR are almost the same, which is consistent with the original assumption. Thus, for some reason, resolvase has been functionally conserved to a far greater extent than has the transposase. (For instance, in the Tn4653 tnpR gene, there are 24 nucleotide changes compared with

REVIEW

j VARIANTS /

FIG. 8. Evolution of elements of the Tn2l subgroup. This figure is an expansion of the box labelled “Tn21like elements” in Fig. 4. Details are given in the text and in Fig. 4. mer and tet represent the genes that encode resistanceto mercuric ions and tetracycline, respectively. ml-int is the cassette that encodes sulfonamide resistance and integrase, and allows easy acquisition of other genes (see text, Section 7); it is this that causesthe large number of variants of Tn2I. Tn4653 encodes the ability to degrade toluene by virtue of the fact that it contains another TnMke element, Tn4651 (see text).

TnZ721(23 in the third position), but the resolvase is unaltered (Tsuda et al., 1989). 4.2. Evolution of the Tn21 and Tn1722 Branches Our present view of the evolution of Tn21-like elements is shown in Fig. 8. This scheme envisagesthat the transposition module (IRS, res, tnpA, and tnpR) acquired either genesthat encode resistance to mercuric ions, giving rise to the Tn21 branch, or about 1.8 kb of DNA to give the Tn1722 progenitor. Almost all of this 1.8 kb in Tnl722 is taken up by an open reading frame that has a codon usagedifferent from that of the transposition genes (Allmeier et al., 1990), supporting its independent acquisition. This implies that mer is typical of the Tn21 branch (unless inactivated, as in Tn4 for instance). However, the discovery of elements with transposition functions closely related to Tn21, but, apparently, not containing mer (e.g., the left end of Tn2610 (Yamamoto, 1989; see Section 3.3) and Tn1409 (Levesque and Jacoby, 1988; Lafond et al., 1989)) suggeststhat there may have been divergence from the Tn21 branch before the acquisition of met-.

173

We consider that an element like Tn2623 (Fig. 7), which consists just of mer genesand transposition genes (Section 3.2), is a good candidate as the immediate ancestor of Tn21 and its variants (Tanaka et al., 1983a). Tn501 also contains little more than mer genes and transposition genes (Brown et al., 1985): it could well have been generated by insertion of an element like Tn2623 into Tn1722 (see Section 3.3) and it is likely that the region between the mer genes and the transposition genes of Tn501 is similar to that in Tn2613. Comparison of sequences shows that Tn22 contains an 11.2-kb insertion between the transposition genes and the mer genes when compared with Tn501 (seeFig. 5); this insertion is flanked by 25 bp inverted repeats outside of which are 5 bp direct repeats; these are characteristics of a transposable element (Brown et al., 1986). Thus, insertion of an 11.2-kb DNA element into, say, Tn2613 could have produced an ancestor of Tn21. The insertion could have occurred either as a single event, or in a number of steps, as suggested by Tanaka et al., 1983a. This 11.2-kb fragment contains the sul-int segment that is responsible for the enormous variation of these elements (Section 7). (It has not been possible to demonstrate the independent mobility ofthis 11.2-kb segment ofTn2Z in Escherichia coli (Grinsted and de la Cruz, unpublished results; Tanaka et al., 1983b).) It appears that the vast majority of presently known elements that are closely related to Tn21 arose from a single line something like that shown, since they can be derived from a common backbone structure (see Section 3.1). 4.3. Geographical Distribution of TnZl-like Elements The occurrence of the same or closely related elements in different strains and genera of bacteria (seeTable 1) is easily explained by their carriage on conjugative plasmids. However, the basis of the widely different geographical locations of isolation of essentially identical elements on the one hand. but the

174

REVIEW

existence of distinct regional variations on the other is not so obvious. For instance, Tnl721 was found as part of a plasmid from a strain from India (Burkardt et al., 1978); it is, however, indistinguishable from Tnl771 (Schoffl et al., 198I), which was discovered in a plasmid from a strain of E. coli isolated in Germany (Schiiffl and Ptihler, 1979b). Similarly, elements of the Tn2Z branch with very similar transposition functions (as shown by distinctive restriction enzyme patterns; see Section 3.2), implying very recent divergence, have been isolated from all over the world (see Section 3.2 for a list and compare to Table 1). But some of the insertions into the basic Tn2I backbone (Fig. 7) are characteristic of particular regions. For instance, the 1S-kb insertion (insertion 2 in Fig. 7) probably occurred in Japan: it occurs in Tn21, Tn2424, Tn2425, Tn2603, and Tn2607, all from plasmids isolated in Japan, but not in those isolated in Europe, such as Tn4 and Tn2411. (Tn2411 is in fact the “European Tn21,” differing from Tn21 only by the absence of the 1.5kb insertion (Kratz et al., 1983). It should be noted, however, that the 1S-kb insertion also occurs in Tn1831 (Fig. 7) which originated in R702, apparently from the U.S. (Hedges and Jacob, 1974).) Also, the 1.6-kb insertion in Tn2425 (insertion 3 in Fig. 7) and in Tn2424 (which is in fact a functional insertion sequence: IS 161 (Meyer et al., 1985)) presumably was acquired in Japan. 5. THE TRANSPOSITION

PROCESS

5.1. Basic Mechanism of Transposition In situ, Tn2Z-like elements are flanked by 5-bp direct repeatsof host DNA (Zheng et al., 198 1; Brown et al., 1980; Grinsted and Brown, 1984; SchSffl et al., 198 1; Turner, 1989; Tsuda et al., 1989), and all can transpose via a cointegrate intermediate (de la Cruz and Grinsted, 1982; Schmitt et al., 198 la; Tanaka et al., 1983b; Schmidt and Klopfer-Kaul, 1984; Lett et al., 1985; Tsuda et al., 1989). It has been reported that the frequency of transposition of elements of the

Tn21 branch is dramatically dependent on the inverse of the size of the elements: the transposition frequency of Tn21 ( 19.5 kb) was 1000 times less than that of Tn2613 (7.5 kb) (Tanaka et al., 1983b), and a deletion of Tn2610 (reduced from 24 to about 11.5 kb) transposed about 100 times more frequently thanTn26IOitself(Yamamoto, 1989).Transposition of TnZ722 also shows a systematic inverse dependence on size; here various Tnl721 derivatives with varying amounts of amplification of the internal tet segment were tested (P. Rogowsky and R. Schmitt, unpublished). The magnitude of this effect was modest, however (rather less than a IO-fold decreasein frequency with a 6-fold increase in size). The reason why the former experiments showed such large effects is not clear: with those of Tanaka et al. (1983b), it may be that the donors used fortuitously contributed to the effect, since the location of an element can dramatically affect the transposition frequency (Grinsted et al., 1988); but this explanation cannot explain the results of Yamamoto ( 1989) becauseall deletions were from the same recombinant. Such dramatic differences have not been seen by other workers. For instance, Grinsted et al. ( 1982) and Hyde and Tu (1985) using similar elements to those examined by Tanaka et al. (1983b), saw no such effect.

5.2. SpeciJicityof Insertion Sites It has been reported that Tn501 displays some degree of regional specificity in sites of insertion, possibly related to the presence of IRS of elements of the Tn3 family (Grinsted et al., 1978). Tn21, Tn501, and Tnl721 also display a marked preference for AT-rich sequences as insertion sites (Grinsted and Brown, 1984; S. Motsch and R. Schmitt, unpublished). As with Tn3 (Kretschmer and Cohen, 1977) the target specificity of transposons of the Tn21 subgroup is highly biased toward plasmids as opposed to chromosomes (Ubben and Schmitt, 1986). Thus, transposition frequencies of Tnl721 were at least lo3 lower

REVIEW

if the E. coli chromosome rather than a plasmid was the target. Similarly, the chromosomes of Rhizobium meliloti, Pseudomonas aeruginosa, and Vibrio cholerae are highly refractory to insertion of TnZ722 or one of its derivatives (Ubben, 1987). Similarly, transposon mutagenesis using TnZ725 (a derivative of TnZ721: Ubben and Schmitt, 1986) yielded rare pro, trp, ilv, and cys auxotrophes and a few lac mutants, but insertions in most other chromosomal genes could not be obtained, in spite of stringent selection (Ubben, 1987). The reason for this is obscure. A transducing X: : TnZ722 (Schmitt et al., 1979) integrates at normal rates into the E. coli chromosome, suggesting that there is no ultimate barrier to the survival of chromosomes containing the transposon; in addition, once inserted into the chromosome, the element can act as a donor at normal rates. It is presumably some property of the chromosome that inhibits its use as a target in transposition.

175

optimum at either room temperature (Tn21 and Tn3926) or 30°C (Tn50Z and TnZ72Z), drops by at least two to three orders of magnitude at 37°C and is barely detectable at 42°C. An effect on transcription is not responsible for this effect: a TnZ 721 derivative containing tnpA-1acZ fusion shows a twofold increase of /3-galactosidase levels at 37°C compared with 30°C (Ubben, 1987). Either transposase itself or the formation of a functional “transpososome” may be temperature-sensitive; alternatively, there may be increased turnover of the transposase at the higher temperature (Heffron, 1983; Sherratt, 1989). The issue may be solved by the selection and characterization of mutants that facilitate high levels of transposition at 37°C and 42°C; these might be encoded by either the element or the host. 5.5. Transposition Immunity

The presence of Tn3 on a target replicon severely reduces the insertion of a second The transposition of derivatives of TnZ721 copy of this element into the same replicon. in various mutant strains has been tested This is “transposition immunity” (Robinson (Ubben, 1987; H. Zitzelsberger and R. et al., 1977); it is only effective in cis and it is Schmitt, unpublished): no difference was the presence of just a single cognate IR seseen in either himA or himB strains (lacking quence in the target that suffices to inhibit IHF), or in& polA, lon, rho, or dam strains; the insertion of the transposon up to 50 kb with hupA there was no effect, but with hupB, away (Kans and Casadaban, 1989; Wallace et there may have been a small reduction in freal., 1981). It is the binding of transposase to quency (the hup mutants lack HU). In strains the IR that causesthe effect (see,for example, containing the topA and gyr mutations deKans and Casadaban, 1989). scribed by Raji et al. (1985), in which the At least some TnZZ-like elements exhibit overall superhelix density is probably retransposition immunity. Thus, the closely reduced, transposition was up to 100 times less lated TnSOZ and TnZ72Z confer immunity than in the equivalent wild-type strain; tranon each other, but transpose at normal frescription of the tnpR and tnpA geneswas also quencies to a target containing Tn2Z. Curireduced in these strains, as shown by 1acZ ously, transposition of Tn2Z into a target fusions (Ubben, 1987). containing one IR of TnZ 721 is not inhibited (W. Mtiller and R. Schmitt, unpublished re5.4. Temperature Sensitivity of sults), although Tn2Z complements TnZ 721 Transposition transposition (de la Cruz and Grinsted, 1982; As with Tn3 (Kretschmer and Cohen, seeSection 5). The efficiency of transposition 1979) transposition of TnZZ-like elements is with the heterologous transposase is reduced temperature sensitive (Ubben, 1987; Turner (see Section 5.6); binding of the transposase et al., 1990). The transposition frequency is to the heterologous IR could also be reduced, 5.3. Eflect of Host Factors

176

REVIEW

to a level that is too low to elicit a detectable reduction in Tn21 transposition. It should be noted that immunity experiments must be carried out in recA strains. Thus, transposition of Tnl725 (a derivative of Tnl722: Ubben and Schmitt, 1986) from a high copy number plasmid to plasmid R388 : : Tnl721 is consistently reduced by between two and three orders of magnitude in a recA strain but not in a ret’ strain (Ubben, 1987). In the latter case, insertions were due to homologous recombination and not transposition, so that the effect of transposition immunity was obscured.

5.6. Complementation of Transposition The transposases of Tn501, TnZ721, and Tn4653 (all elements of the Tnl722 branch) efficiently complement tnpA mutants of each other but not of Tn21, Tn2603, and Tn3926 (elements ofthe Tn21 branch) (Schmitt et al., 198la; Grinsted et al., 1982, 1988; Tanaka et al., 1983b; Tsuda et al., 1989). The Tn2Z branch elements Tn21, Tn2603, Tn2613, Tn3926, and Tn4000 can complement each other’s transposition efficiently (Lett et al., 1985; Turner, 1989; Tanaka et al., 1983b; Schmidt, 1984), and Tn3926 does not complement tnpA mutants of Tn501 or Tnl721 (Lett et al., 1985; Turner, 1989). However, Tn2Z can complement tnpA mutants of Tn502 and Tnl721 at appreciable frequencies (lo- to lOOO-fold less than with the homologous element: Grinsted et al., 1982, 1988). Tsuda et al. (1989) show a 105- 106fold difference between the frequencies of transposition of a homologous element complemented by Tn21 on the one hand, and a Tnl722-like element complemented by Tn21 on the other; it is not clear why there is this discrepancy but we are convinced, particularly by the data of Grinsted et al. ( 1988) of the more relaxed specificity of the Tn21 transposase. This view is strengthened by the ability of Tn2I (but not of Tn501) to mediate transposition of elements that contain a Tn21 IR at one end and a Tn501 IR at the other (at a frequency between that for ele-

ments flanked by two IRS of Tn2I and by two of Tn502) (Grinsted and Brown, 1984; Grinsted et al., 1988). It should also be noted that Tn2610 (Fig. 6) is a natural example of such a heterologous system, in which it is the Tn21-type transposasethat mediates transposition and not the TnZ 722-type (Tsuda et al., 1989). The difference of the Tn21 transposasefrom the others is highlighted by its ability to mediate one-ended transposition (Section 5.4), and to recognize a wide variety of IR sequences(Section 5.5). (It should be emphasized that this increased range of the Tn21 transposase is not a characteristic of all elements in the Tn21 branch: Tn3926 does not show such relaxed properties, either in the IRS it recognizes or in one-ended transposition-see above and Section 5.4.)

5.7. One-Ended Transposition Some TnZI-like elements can carry out efficient “one-ended transposition.” This involves transposition-like events that occur in the presence of transposasewith donor replicons that contain only one compatible IR sequence. The products formed are joint molecules, consisting of the complete recipient and varying lengths of the donor flanked by 5-bp direct repeats of host DNA; the donor segmentsstart precisely at the IR and end at a random sequence (Avila et al., 1984, 1988; Motsch and Schmitt, 1984; Mijtsch et al., 1985). The frequency of one-ended transposition is about 1% of that of the normal twoended element with the homologous Tn2Z and TnZ721 systems. The published data show that the donor segment in the recombinants was usually essentially the whole donor plasmid, sometimes with a repetition of the DNA adjacent to the IR. However, the distribution of lengths of donor DNA in recombinants varies depending on the donor plasmid, with some giving a high proportion in which the donor segment is much smaller than the complete donor plasmid (J. Grinsted, E. Ward, and F. de la Cruz, unpublished data). Tn501 and Tn3926 do not carry out one-

REVIEW

177

ended transposition at significant rates tion (Evans and Brown, 1987). These show (Grinsted et al., 1988; Turner, 1989). This is that the region of the protein that determines particularly surprising in the case of Tn501, which IR is recognised lies within the first whose transposaseand IRS are practically the 2 16 amino acids of the N-terminus. This is same as those of Tnl721. Tn3926, however, consistent with the fact that transposasesare encodesa transposasethat is only 90% homol- more conserved at their C-terminus, suggestogous with that of Tn21, but has IRS that are ing that this region of the protein is responsialmost identical (Figs. 2B and 3). Thus, the ble for the common reactions (such as bond difference in one-ended transposition be- cleavage and ligation); by default, the N-tertween these two elements is likely to reflect a minus should carry the specificity determidifference in the transposases,and determina- nants (Brown et al,, 1985; Ward and tion of the location of the region of the mole- Grinsted, 1987; Turner, 1989). cule responsible should, in principle, be possible by comparison of the sequences of the 5.9. tnpR and Resolvase transposases(Turner and Grinsted, 1989). Cointegrates formed by transposition (Section 3) are resolved into the original donor replicon plus the new recombinant (Fig. 1). 5.8. IR Transposase Interactions This reaction can be mediated either by hoAll these experiments concerning transpomologous recombination between the disition are manifestations of the specific interrectly oriented copies of the element, or, action of the transposase and the IRS. The more efficiently, by the tnpR product (reTn21 transposase will operate on many difsolvase), which is a site-specific recombinase ferent IR sequences,as shown by its ability to acting at the res sites within the elements (recomplement transposition of Tn501 and viewed by Sherratt, 1989). The tnpR genes, Tn1721; it will even complement transposithe yessites, and the mechanism of resolution tion of Tn2501, an element whose transposiof elements of the Tn2Z subgroup are similar tion genes and IRS are not closely related to to those of Tn3 and TnlOOO (Altenbuchner those of Tn21 (seeFigs. 2 and 3) (Michiels et and Schmitt, 1983; Halford et al., 1985; Roal., 1987; Tn50Z and Tnl721 do not complegowsky and Schmitt, 1985; Rogowsky et al., ment Tn2501). Comparison of these 1985). All resolvases of both branches of Tn21-compatible IRS indicates which posiTnZI-like elements that have been examined tions have to be conserved for the transposi(Tn21, Tn502, Tn1721, Tn2603, Tn2610) tion process(Fig. 3). The requirements of this are fully interchangeable, although inactive transposasehave been further investigated by with tnpR mutants of Tn3 (Schmitt et al., testing various synthetic oligonucleotides as 1981a; Diver et al., 1983; Lett et al., 1985; potential IR sequences(Martin et al., 1989). Tanaka et al., 1983b; Tsuda et al., 1989; YaHere, potential IRS were tested both in a onemamoto, 1989). The ability of these resolvended system and in a two-ended system that asesto act on heterologous res sites (the sehad the mutant IR at one end and a Tn22 IR quences of the various sites is shown in Roat the other. Surprisingly, it was found that gowsky et al., 1985) has enabled the plasmids containing just the outer 18 bp of identification of the crossover site in the resothe IR could act as donors in transposition, lution reaction (Rogowsky and Schmitt, although at low frequency; the data also indi1984; Schmitt et al., 1985b). cate that recognition of both IRS of a normal element is involved in the rate-limiting step 5.10. Excision of transposition. Preciseexcision of Tnl721 and its relatives Hybrids of the Tn21 and Tn501 transposases have been produced by generating hy- is a rare, host-mediated processthat occurs in brid genesin vivo by homologous recombina- the absence of transposon-encoded func-

178

REVIEW

tions. By using positive selection of revertants from a set of insertions in a tetracyclineresistance determinant it was found that revertants arose either spontaneously or at higher rates after uv irradiation, and that the frequencies of excision strictly depended on the DNA sequence environment of the inserted element. Mismatch repair and slipped mispairing have been suggested to explain such findings (Schmitt et al., 1989; DasGupta et al., 1987).

Schmitt, 1983), suggestingthat most transposition events probably happen while tnpR transcription is repressed. Furthermore, removal of the tnpR promotor of Tn21 does not prevent transposition (W. P. Diver and J. Grinsted, unpublished results). These data suggestthat tnpA transcription can continue independently of tnpR control. An independent promoter for tnpA in Tnl721 has been inferred from testing a partial deletion of tnpR, which is capable of transposition at about 15fold reduced rates (Schmitt et al., 6. CONTROL OF TRANSPOSITION 198la; Altenbuchner and Schmitt, 1983). An extended deletion analysis involving the dis6.I. Promoters tal end of tnpR and the proximal end of tnpA In Tn3, the divergently transcribed tnpA has revealed a putative promoter and riboand tnpR genes are repressed by resolvase some binding sequencesin the terminal porbinding to res, which overlaps the two pro- tion of tnpR (Fig. 9; S. Miitsch, W. Mtiller moters (Wishart et al., 1983). With elements and R. Schmitt, unpublished results). As in the Tn21 subgroup, however, the two shown in Fig. 9, transposition frequencies genes are arranged in parallel with yes up- drop between one and two orders of magnistream (Section 3). In Tnl721, there is a good tude in deletions extending beyond the prepromoter (40% as efficient as that of lucZ) sumptive -35 and -10 boxes. Deletion 826 that overlaps res (with the -35 sequence in (Fig. 9) which exhibits no detectable transpoSite II and the - 10 sequence in Site III) (Al- sition activity, defines the tnpA gene start at tenbuchner and Schmitt, 1983; Rogowsky the first ATG codon following the tnpR and Schmitt, 1985); Tn21 and Tn501 have translational stop codon (3 bp away). The resimilar sequences in the same relative posi- sults suggestthat low expression of transpostions (Diver et al., 1983). It has been inferred aseduring tnpR gene repression can be attribthat both tnpR and tnpA are transcribed from uted to a promoter showing only 50% homolthis promoter in an operon-like manner. The ogy with the promoter consensus(Harley and notion that the two genes can be transcribed Reynolds, 1987). When a strong promoter together is supported by the observation that, (p&c) was introduced by ligation to the 5’ in Tn501, induction of mercury resistance ends of deletions 835 through 838 (Fig. 9) (mer) by mercurials increases both the pro- transposition rates were raised to 2 X lo-*, portion of cointegrates that are resolved and about 10 times the wild-type level, indicating the transposition frequency (Schmitt et al., that tnpA of Tnl721 can be transcribed from 1981a; Kitts et al., 1982), implying read adjacent promoters. But no such increase in through from the mer promoter, which is at transposition frequency was seen in Tn21 the other end of the element. (It should be when ptac was driving tnpR in the plasmid noted, however, that resolvase and transpos- pEAK6, giving enormous overexpression of ase activities of Tn2613 are not affected by tnpR (Halford et al., 1985; Grinsted, unpubmercurials (Tanaka et al., 1983b), although lished). However, ptac inserted in the EcoRI the organisation of the genes in the relevant site 50 bp upstream of the initiation codon of regions is likely to be very similar (Sec- tnpA of hybrid tnpA geneswith a Tn21 proxition 4).) mal end (see Section 5.8) did give overexHowever, as in Tn3, expression of the pression, as indicated by transposition freTnl721 tnpR gene is autoregulated by the quency and the appearance of a protein of the binding of resolvaseto res(Altenbuchner and expected size after induction (L. Evans and

179

REVIEW

I

tnpR

I

D ii -5

10

tnpA

D

D

D

E

!

f

-6 10

-6 10

-6 10

--

DXPL-2 e

lW4lO

+-xr--cat ‘..I.__

Tn2603

_____c=l_