0013.7227/92/1311-0159$03.00/0 Endocrinology Copyright 0 1992 by The Endocrine
Vol. 131, No. 1 Printed in lJ.S.A
Society
The Regulation of Two Distinct Glucose (GLUT1 and GLUT4) Gene Expressions Thyroid Cells by Thyrotropin YOSHIYUKI HOSAKA, TOYOSHI ENDO, AND Third Department 409-38, Japan
of
MASATO TAWATA, TOSHIMASA ONAYA
Internal
Medicine,
AKIHIRO
University
of
KURIHARA,
Yamanashi
Medical
MASAYUKI School, Tamaho,
Transporter in Cultured
Rat
OHTAKA, Yamanashi
ABSTRACT We investigated the glucose transporter mRNAs expressed in FRTL5, a rat thyroid cell line, and their regulation by TSH by means of the polymerase chain reaction. FRTL5 cells as well as rat thyroid tissue expressed three types of glucose transporter mRNAs: GLUT1 or erythrocyte/HepG2/brain isoform, GLUT2 or pancreatic @cell/liver isoform, and GLUT4 or muscle/fat isoform. GLUT1 mRNA predominated, GLUT4 mRNA was minor, and GLUT2 mRNA expression was faint. Incubation of FRTL5 cells with TSH induced a timeand concentration-dependent increase in GLUT1 mRNA levels, while GLUT4 mRNA levels were decreased. The response of GLUT1 mRNA to TSH was evident at 3 h, and the maximal response was achieved at
12 h. TSH at a dose of 1 mu/ml elicited an approximately 3-fold increase in GLUT1 mRNA levels. (Bu),cAMP (1 mM), 8-bromo-CAMP (1 mM), and forskolin (50 fiM) mimicked the effect of TSH on GLUT1 and GLUT4 mRNA levels. The increase in GLUT1 mRNA by TSH was correlated with the increase in GLUT1 protein and the increase in 2-deoxyglucose transport activity. These observations suggest that in thyroid cells, TSH stimulates glucose transport at least in part by enhancing GLUT1 gene expression, and that the effect of TSH on GLUT1 and GLUT4 mRNA levels is mediated by a CAMP-dependent pathway. (Endocrinology 131: 159-165,1992)
P
Cell culture
OLYPEPTIDE hormones regulate a variety of intracellular processes by modulating the availability of nutrients. In thyroid cells, TSH induces a number of metabolic effects, which, in turn, influence virtually all aspects of thyroid cellular function (1). Glucose is an essential substrate for several thyroid cell functions (l-3). The presence of glucose in the incubation medium enhances both the organification process and TSH-induced thyroid hormone synthesis in thyroid slices (2, 3). Moreover, TSH has been shown to increase glucose transport in cultured thyroid cells (4). With the exception of the luminal sodium-glucose transport system of renal and intestinal epithelium (5), the uptake of glucose into cells occurs by facilitated diffusion mediated by glucose transport proteins, of which there are at least five distinct types with partial sequence homology and differing tissue distribution. However, little is known about glucose transporters in thyroid cells and the precise mechanisms by which glucose transport is regulated by TSH. The first question to be answered is which glucose transporters are expressed in thyroid cells? The second is does TSH affect their gene expressions? In this study we examined the glucose transporter mRNAs expressed in rat thyroid tissue and FRTL5 cells and investigated their regulation by TSH in FRTL5 cells. Materials Rat thyroid
FRTL5, a continuous line of differentiated rat thyroid cells whose characteristics have been extensively described (6, 7), was kindly provided by Dr. Leonard D. Kohn (NIH). Cells were maintained in monolayer culture in Ham’s F-12K medium supplemented with 5% calf serum (Gibco, Grand Island, NY) and a h-hormone mixture (6H medium) including 10 &ml insulin (Sigma Chemical Co., St. Louis, MO) and 10 mu/ml TSH (Sigma Chemical Co.). Cells were cultured in loo-mm petri dishes (Corning Medical, Medfield, MA) or 12.well tissue culture dishes (Costar, Cambridge, MA) at 37 C under 5% COZ in air in a watersaturated incubator. The medium was changed twice a week, and when confluence was reached, the cells were subcultured (1:lO split) using a 0.05% trypsin and 1 rnM EDTA mixture in Ca’+- and Mg*+-free Hanks’ solution. To investigate the effect of TSH, when cells reached confluence, TSH and insulin were removed, since insulin affects glucose transport in FRTL5 cells (8). The concentration of serum in the medium was gradually decreased to 0.2% in 8 days, The cells were then preincubated for varying periods with the additives indicated in the text. During preincubation, the medium was changed every 12 h to maintain the glucose concentration.
Oligonucleotides
and Methods
tissue
Rat thyroid tissue was obtained from 2-week-old killed by cardiac puncture under ether anesthesia.
male
Received October 23, 1991. Address all correspondence and requests for reprints masa Onaya, Third Department of Internal Medicine, Yamanashi Medical School, Tamaho, Yamanashi 409-38,
Wistar
used for amplification
Forward and reverse primers for GLUTI, GLUT2, GLUT3, GLUT4, and GLUT5 cDNA were designed from the cDNA sequences of rat brain (9), rat liver (lo), human fetal skeletal muscle (1 l), rat skeletal muscle (12), and human small intestine (13), respectively. Primers of @-actin cDNA were designed from the sequence of the rat p-actin gene (14). They were synthesized on a DNA synthesizer (Applied Biosystems, Tokyo, Japan). The primers are described in Table 1.
rats
Quantitative
analyses of glucose transporter
mRNAs
To measure the relative abundance of glucose transporter mRNA levels, we slightly modified the methods of Chelly et al. (15) and Wang et al. (16). After preincubation, FRTL5 cells were harvested by trypsinization and lysed with 4 M guanidine thiocyanate containing 0.5%
to: Dr. ToshiUniversity of Japan.
59
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
160
GLUCOSE
TABLE
1.
TRANSPORTER
primer
Location
GLUT2
5’ ACTCAACGAGCATCTTCGAG 5’ CTTACGTGTTCTTCCTTTTT
3’ 3’
GLUT3 GLUT4 GLUT5 &A&in
5’ 5’ 5’ 5’
3’ 3’ 3’ 3’
GLUT1
Endo. Voll31.
TCCAACTTCCTAGTCGGATT TTTCCAGTATGTTGCGGATG CAGCATCGTCTGTGTCATCT TGTTTGAGACCTTCAACACC
Western blot analysis of glucose transporter
1992 No 1
glucose transport
Location
5’ AAGAGCTGGTCACCTGTCTT 5’ GTGTAGTCCTACACTCATGA
3’ 3’
1636-1655 1638-1657
5’ 5’ 5’ 5’
3’ 3’ 3’ 3’
1681-1700 1616-1635 1531-1550 739-758
GATGCTGTTCATCTCCATGA TCAGTCATTCTCATCTGGCC TTCAGTTCCTCCTTTTCCGG CGCTCATTGCCGATAGTGAT
culture dishes. After preincubation, the cells were rinsed 3 times with 1 ml Dulbecco’s phosphate buffer and incubated in Krebs-Ringer-HEPES (20 mM), pH 7.4, at 22 C in the presence of the glucose analog. Glucose transport activity was measured by adding 0.1 mM [3H]2-deoxy-oglucose (1 &/ml). Nonfacilitated uptake was determined in the presence of 20 PM cytochalasin-B. To measure the initial uptake rate, a 5min incubation was used. The incubations were terminated by rapidly washing the cells 3 times with ice-cold PBS, pH 7.4, containing 100 mM D-glucose. The cells were then solubilized in 0.5 ml 0.1 N NaOH, and a 0.4-ml aliquot was diluted in 4 ml IWO-FLUOR 15 (Packard, Downers Grove, IL) and counted for radioactivity in a liquid scintillation @-counter (Aloka LSC-3600, Tokyo, Japan).
Results Glucose transporter cells
mRNAs
in rat thyroid
tissue and FRTL5
We first examined the glucose transporter mRNAs expressedin rat thyroid tissue. When amplifications were carried out for 35 cycles, as shown in Fig. lA, GLUTI, GLUT2, and GLUT4 mRNAs were recognized. The GLUT1 mRNA was strongly detected, the signal of GLUT4 mRNA was weak, and the GLUT2 mRNA was faintly detected. When
A.
rat thyroid tissue GLUT1
GLUT2
GLUT3
GLUT4
GLUTS
protein
After preincubation, the cells were homogenized with ice-cold buffer containing 250 mM sucrose, 10 mM Tris, and 2 mM EDTA, pH 7.4. The homogenates were centrifuged at 3,700 X g for 25 min at 4 C. The supernatant was centrifuged at 200,000 X g for 70 min at 4 C to obtain total postnuclear membranes. The membranes were resuspended in homogenization buffer by repeated passage through a 25-gauge needle. The samples (50 kg) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. Immunoblotting and staining were performed according to the method of Towbin et al. (18) and Hawkes et al. (19) with slight modification. For the determination of GLUT1 protein, the nitrocellulose membranes were incubated overnight at 4 C with rabbit anti-GLUT1 antiserum 281 (1:200) in Tris-buffered saline containing 5% skim milk. Rabbit antiGLUT1 antiserum 281 was raised in this laboratory against the peptide corresponding to amino acid sequence 463-492 of the carboxyl-terminal region of the rat brain glucose transporter (9). After washing in Trisbuffered saline containing 0.3% Tween-20, the membranes were further exposed for 1 h at room temperature to peroxidase-labeled antirabbit immunoglobulin G (Jackson Immunoresearch Laboratory, Bar Harbor, ME; 1:400). The membranes were washed as described above, and the peroxidase activity was demonstrated with diaminobenzidine-HzOz. of
Reverse primer
1085-1104 1382-1401 1475-1496 1416-1435 1200-1219 368-387
laurylsalcosin. Total RNA was extracted using a cesium chloride gradient centrifugation technique (17). Fifteen micrograms of total RNA were heated at 70 C for 10 min, cooled slowly to 42 C, and then reverse transcribed at 42 C for 120 min in a 20-~1 reaction mixture containing 50 mM Tris-HCl (pH 8.3), 100 mM KCI, 10 mM MgC12, 10 mM dithiothreitol, 0.25 mM deoxy-NTPs, 0.2 pg oligo(dT), 400 U RNasin (Takara Shuzo Co., Kyoto, Japan), and 11 U Rous-associated virus 2 (RAV-2) reverse transcriptase (Takara Shuzo Co., Kyoto, Japan). GLUTl, GLUT4, or fl-actin cDNA fragments were then amplified by polymerase chain reaction (PCR) in a 50-~1 reaction mixture containing 0.511 of the reverse transcription mixture as a template, 0.25 mM deoxy-NTPs, 2.5 U Thermus a9uaf1cs DNA polymerase (Takara Shuzo Co., Kyoto, Japan), and 0.5 fig forward and reverse primers. To monitor the reaction, the forward primer was 5’-end labeled with ?’ to a specific activity of 5 X 10’ cpm/ pg using T4 polynucleotide kinase (Takara Shuzo Co., Kyoto, Japan). The final concentration of PCR buffer was 50 mM Tris-HCl (pH 8.3), 1 mM MgQ, 30 mM KCI, and 10 mM dithiothreitol.The mixture was overlaid with 50 ~1 mineral oil. PCRs were carried out by 22-30 cycles with Atto thermal cycler (Atto Co., Tokyo, Japan). The cycle conditions were one cycle of 1 min at 93 C, 1.5 min at 60 C, and 1.5 min at 72 C. However, at the beginning of the first cycle, the reactions were held for 5 min at 93 C to ensure complete denaturation. Ten microliters of PCR product mixture were then electrophoresed in 2% agarose gels in Trisacetate-EDTA buffer containing ethidium bromide and visualized under UV rays. After electrophoresis, the appropriate bands were cut out from the gel, and radioactivity was determined by scintillation counting. To correct the tube to tube variation in PCR, duplicate determination was performed for each experiment. The relative ? radioactivity of each GLUT PCR product was divided by the relative ?’ radioactivity of fiactin PCR product and expressed as the relative abundance of GLUT mRNAs. Data are the mean f SEM of three independently performed experiments.
Hexose previously
IN THYROID
Oligonucleotides used for amplification Forward
Measurement
mRNAs
activity
transport assays in FRTW cells were performed as described by Flletti et nl. (4). The cells were plated in 12-well tissue
B.
FRTL 5 cells GLUT1
GLUT2
GLUT3
GLUT4
GLUT5
1. Glucose transporter mRNAs expressed in rat thyroid tissue and FRTL5 cells. A, The ethidium bromide-stained PCR products amplified from total RNA extracted from rat thyroid tissue. Fifteen micrograms of total RNA were reverse transcribed in a 20-~1 reaction into cDNA, using oligo(dT) as a primer; 0.5 ~1 of the reactions was used for PCR amplification. PCR was performed with 35 cycles of reactions using a pair of specific primers, as described in Materials and Methods. B, Ethidium bromide-stained PCR products amplified from total RNA extracted from FRTL5 cells. bp, Basepairs. FIG.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
TRANSPORTER
we used the RNA samples extracted from FRTL5 cells, as shown in Fig. lB, similar results were observed. With respect to GLUT3 and GLUT5 mRNAs, it is possible that we did not detect them because of the differences in cDNA sequences between humans and rats, as GLUT3 and GLUT5 cDNA sequences are so far available only for humans (11, 13). GLUTl, GLUT2, and GLUT4 cDNAs were sufficiently amplified when they were amplified from rat brain, liver, and skeletal muscle, respectively (data not shown). Effects of TSH on glucose transporter
mRNA
levels
Based on the results shown in Fig. 1, we next examined the effects of TSH on GLUT1 and GLUT4 mRNA levels using FRTL5 cells. In preliminary experiments we determined the number of PCR cycles that would be adequate for quantitative analysis. After observing the amount of PCR product after each cycle, we found the amplification to be exponential within 22-30 cycles for GLUT1 mRNA, 27-32 cycles for GLUT4 mRNA, and 18-25 cycles for p-actin mRNA (data not shown). Therefore, PCR was carried out by 25, 30, and 22 cycles for GLUTl, GLUT4, and @-actin mRNA, respectively. The GLUT2 mRNA levels were too low to analyze quantitatively. Interassay (tube to tube) variability in our PCR protocol was less than 5%. When FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum, were treated with 1 mu/ml TSH, the GLUT1 mRNA level showed a time-dependent increase (Fig. 2A). In contrast, GLUT4 mRNA levels were slightly decreased (Fig. 2B). The @-actin mRNA levels did not change during 36 h (Fig. 2C). The relative abundance of GLUT1 and GLUT4 mRNA levels corrected by @actin mRNA are shown in Fig. 2, D and E. The GLUT1 mRNA level significantly increased at 6 h, reached a maximum at 12 h, showing a 3-fold increase over the basal value, and thereafter decreased gradually (Fig. 2D). In contrast, the GLUT4 mRNA level was gradually decreased to 40% of the basal value at 36 h (Fig. 2E). We then investigated the TSH concentration dependency on GLUT1 and GLUT4 mRNA levels 12 h after exposure. As shown in Fig. 3A, the effect of TSH on the GLUT1 mRNA level was concentration dependent. A significant increase was observed at a concentration of 0.01 mu/ml TSH, and a maximal stimulation was observed at 1 mu/ml TSH, achieving a 3-fold increase. However, the GLUT4 mRNA level gradually decreased in response to the TSH concentration (Fig. 3B). Effects of CAMP on GLUT1
and GLUT4
mRNA
levels
The majority of the actions of TSH on thyroid cells are mediated by a CAMP-dependent pathway (20). To assess whether CAMP plays a role in the modulation of glucose transporter mRNA levels, we examined the effects of three agents, 8-bromo-CAMP, (Bu)~cAMP, and forskolin, which increase the intracellular CAMP level or mimic the action of CAMP in various types of cells. When the cells incubated in control medium were exposed for 12 h to 8-bromo-CAMP (1 mM), (Bu)*cAMP (1 mM), and forskolin (50 PM), the GLUT1
mRNAs
IN THYROID
161
mRNA level increased 2.6-, 2.8-, and 3.1-fold, respectively (Fig. 4A). In contrast, the GLUT4 mRNA level was decreased 40-60% by each of the three agents (Fig. 48). Effects of TSH and CAMP on GLUT1
protein
levels
To correlate the changes in glucose transporter mRNA levels with their protein levels, Western blot analysis was performed on total postnuclear membrane from the cells. Figure 5 shows that the rabbit anti-GLUT1 antiserum 281 recognized a protein with a molecular mass of 55 kilodaltons. The signal was increased by the addition of TSH (1 mu/ml) or (Bu),cAMP (1 mM) for 12 h. Thus, TSH is capable of increasing the amount of GLUT1 protein, and the effect of TSH is mimicked by CAMP. On the other hand, the GLUT4 isoform could not be detected in FRTL5 cells by a mouse anti-GLUT4 monoclonal antibody (Genzyme Co., Cambridge, MA) by Western blotting (data not shown). Effects of TSH and CAMP on glucose transport
activity
Previous studies have demonstrated that TSH increases glucose transport in thyroid cells (4, 21). Consistent with these studies, 2-deoxyglucose transport in FRTL5 cells was increased by TSH in a concentration-dependent manner within the range 0.01-1.0 mu/ml. (Bu),cAMP (1 mM) mimicked the effect of TSH (Table 2). Effects of actinomycin-D
on GLUT1
mRNA
levels
In the last of our experiments, we examined whether the TSH-stimulated increase in the expression of GLUT1 mRNA is due to a transcriptional or posttranscriptional mechanism. The cells were pretreated with 1 Fg/ml actinomycin-D for 30 min before the addition of TSH and then exposed to 1 mu/ ml TSH for 6 h. As shown in Fig. 6, the stimulatory effect of TSH on GLUT1 mRNA levels was completely suppressed.
Discussion Recent studies have established that the facilitative diffusion of glucose across the plasma membrane of mammalian cells is mediated by a family of structurally related glucose transport proteins (9-13, 22-24). These proteins have distinct tissue distributions, biochemical properties, and modes of regulation. This diversity presumably allows the uptake of glucose to be precisely controlled under different physiological conditions. RNA-blotting studies have revealed that most tissues express plural facilitative transporter isoforms, and that a single cell can express more than one transporter isoform. In this study we used the PCR to examine the expression of glucose transporter mRNAs. This technique is extremely sensitive, because of the amplification. It is also highly specific, because detection requires annealing of both the reverse and forward primers. Using this approach, we detected three types of glucose transporter (GLUTl, GLUT2, and GLUT4) mRNAs in rat thyroid tissue and FRTL5 cells. It may be misleading to conclude the relative abundance of GLUTI, GLUT2, and GLUT4 mRNAs only from the results
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
162
GLUCOSE TRANSPORTER
mRNAs IN THYROID
A. GLUT1
FIG. 2. Time course of GLUT1 and GLUT4 mRNA levels after the addition of 1 mu/ml TSH. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum, were treated with 1 mu/ml TSH. After preincubation for the indicated period, the cells were harvested. Fifteen micrograms of total RNA were prepared and reverse transcribed into cDNA in 20-~1 reactions; 0.5 ~1 of the reactions was used for PCR. GLUT1 (A), GLUT4 (B), and @-actin (C) cDNA fragments were amplified by PCR using “P end-labeled forward primer, as described in Materials and Methods. PCR was carried out by 25, 30, and 22 cycles for GLUTl, GLUT4, and /3-actin cDNA, respectively. The relative abundance of GLUT1 and GLUT4 mRNA normalized by p-actin mRNA is presented in D and E, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. 0 h). bp, Basepairs.
571
B. GLUT4
Endo. Vol131.
bp p*
0
3
6
122436
0
3
6
122436
0
3
6
122436
220 bp -
C. p-actin
Time (h) E.
6 Time FIG. 3. Concentration dependency of TSH on GLUT1 and GLUT4 mRNAs. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with the indicated concentration of TSH. After 12 h of preincubation, the cells were harvested and subjected to the analysis described in Fig. 2. The relative abundance of GLUT1 and GLUT4 mRNA normalized by (3-actin mRNA is presented in A and B, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. control).
1992 No 1
4
6
1;
(h)
2’4 Time
3’6
(h)
A.
”
OL
1
0
0.01
0.1 TSH
of Fig. 1, becauseit is possible that they simply reflect the different efficiencies of the primers used for PCR. However, in Western blot analysis using anti-GLUT4 antibody, we could not detect GLUT4 protein in FRTL5 cells. The same antibody recognized GLUT4 protein in rat skeletal muscle (data not shown). On the other hand, GLUT1 protein was observed by Western blot analysis in FRTW cells. These results strongly suggest that GLUT1 mainly plays a role in the transport of glucose in thyroid cells. Our results also suggestthe possibility that PCR can detect GLUT4 transcripts
(mu/ml)
1
10
0
0.01
0.1
TSH
1
10
(mu/ml)
in tissues that were previously thought not to express this gene. A variety of hormones, including growth factors (25, 26), insulin (27, 28), thyroid hormone (29), and glucocorticoids (30), have been reported to affect glucose transporter mRNA expression. However, further studies are needed to learn how plural transporter mRNAs expressedin a single cell are regulated. One reason for the difficulty is that the Northern blotting technique is not sufficiently sensitive to analyze the alterations of minor forms of transporter mRNAs. Some
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
TRANSPORTER
mRNAs
IN THYROID
A. FIG. 4. Effects of 8bromo-CAMP (8BC), (Bu& (DBC), and forskolin (FRK) on GLUT1 and GLUT4 mRNA levels. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with 1 mM 8-bromo-CAMP, 1 mM (Bu),cAMP, and 50 PM forskolin. After 12 h of preincubation, the cells were harvested and subjected to the analysis described in Fig. 2. The relative abundance of GLUT1 and GLUT4 mRNAs normalized by fl-actin mRNA is presented in A and B, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. control).
B.
s t 553 & 2
C g 5 1 E F 2 0
2
’
L control
(lmU/ml)
TSH
8BC
(lmU/ml)
(1mM)
COIWOi
(1mM)
FRK (50@8)
TABLE 2. Effect of TSH and CAMP on 2-deoxyglucose uptake in FRTL5 cells
UW
2-DC uptake (pmol/ fig DNA.5 min)
Additives
94 KDa
None 1.1 f 0.08 TSH (0.01 mu/ml) 5.2 + 0.26 TSH (0.1 mu/ml) 1.5 + 0.22 TSH (1.0 mu/ml) 12.1 -+ 0.12 (Bu)~cAMP (1 mM) 10.3 3~ 0.18 FRTL5 cells were incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with the indicated concentration of TSH or 1 mM (Bu),cAMP for 12 h. 2Deoxyglucose (2-DG) transport was then measured, as described in Materials and Methods. Values are the mean +- SEM of three independently performed experiments.
67
43
DBC (1mM)
-c
2-
30
COntrOl
TSH DBC 1 mu/ml 1 mM
FIG. 5. Western blot analysis of the GLUT1 protein in FRTL5 cells. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with 1 mM TSH or 1 mM (Bu)~cAMP. After 12 h of preincubation, total postnuclear membranes were isolated and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membrane and reacted with anti-GLUT1 antiserum 281, as described in Materials and Methods. The result shown is the representative of four independently performed experiments. Mr, Mol wt.
investigators have recently reported that the PCR technique can be used to measure the abundance of mRNA (15, 16). Backus et al. (31) reported that the hybridization technique and PCR yield similar quantitation. The present study using the PCR technique demonstrated that in FRTL5 cells, TSH specifically increasesthe predominant form, GLUT1 mRNA
1 -
d
i
6
Time (h) FIG. 6. Effects of actinomycin-D on the accumulation of GLUT1 mRNA levels. FRTLB cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were pretreated with (0) or without (0) 1 rg/ml actinomycin-D. The cells were then exposed to 1 mu/ml TSH. After the indicated periods, the cells were harvested and subjected to the analysis described in Fig. 2. Values are the mean + SEM of three independently performed experiments.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
164
GLUCOSE
TRANSPORTER
levels, while GLUT4 mRNA levels were decreased. GLUT2 mRNA levels were too low to analyze quantitatively. Further, we demonstrated that TSH increased GLUT1 protein levels and 2-deoxyglucose uptake activities. Our observations suggest that the effect of TSH on glucose transport in thyroid cells is at least in part accompanied by increased expression of GLUT1 mRNA and protein. The physiological significance of the decrease in GLUT4 mRNA expression is unknown. Further study is needed to reveal the role of GLUT4 in thyroid cells. The agents 8-bromo-CAMP, (Bu&, and forskolin mimicked the effect of TSH on GLUT1 and GLUT4 mRNA levels. (Bu),cAMP mimicked the stimulatory effect of TSH on GLUT1 protein expression and 2-deoxyglucose uptake. Our results are consistent with previous reports of these agents on glucose transport in various types of cells. It has been reported that cholera toxin and 8-bromo-CAMP increase the uptake of 2-deoxyglucose in NIH 3T3 fibroblasts (32). Cholera toxin, (Bu)~cAMP, and 8-bromo-CAMP significantly increase the transport of glucose in primary cultures of canine thyroid cells (21). Kaestner et al. (33) recently reported that CAMP causes the transcriptional repression of the GLUT4 gene and the transcriptional stimulation of the GLUT1 gene in 3T3 adipocytes. Their data and ours suggest that these effects of CAMP on GLUT1 and GLUT4 mRNA expression are universal regardless of tissue or cell type. The present study suggests that TSH increases the amount of GLUT1 protein in thyroid cells. However, a disparity between the effect of TSH on the extent of GLUT1 mRNA levels (3-fold) and its effect on the extent of transport stimulation (12-fold) was observed. Therefore, an additional possibility exists, such as promoting the recruitment of glucose transporter from the intracellular pool to the cell surface or stimulating the intrinsic activity of glucose transporter. Insulin has been reported to increase the translocation of glucose transporter to the cell surface in adipose cells (34, 35). On the other hand, the enhancement of transporter intrinsic activity was also suggested by the disparity between the extent of transporter recruitment to the plasma membrane and the extent of transport stimulation (36, 37). It would be of considerable interest to learn whether TSH influences GLUT1 in these processes. Experiments to resolve these problems are currently in progress.
mRNAs
5
6
7
8
9
10
11
12 13
14
15
16
17
18
19 20
21
Acknowledgments The authors ami Nakamura,
express their appreciation to Tomoko and Yukiko Sato for their secretarial
Kawaguchi, assistance.
Man-
22
23
References 1. Dumont JE 1971 The action of thyrotropin on thyroid metabolism. Vitam Horm 29:287-412 2. Schussler GC, lngbar SH 1961 The role of intermediary carbohydrate metabolism in regulating organic iodinations in the thyroid gland. J Clin Invest 40:1394-1412 3. Ahn CS, Rosenberg IN 1980 Glucose dependence of thyrotropinstimulated thyroid hormone formation. Endocrinology 107:18611866 4. Filetti S, Damante G, Foti D 1987 Thyrotropin stimulates glucose
24
25
26.
IN THYROID
Endo - 1992 Vol131. No 1
transport in cultured rat thyroid cells. Endocrinology 120:25762581 Hedigar MA, Coady MJ, Ikeda TS, Wright EM 1987 Expression cloning and cDNA sequencing of the Na’/glucose co-transporter. Nature 330:379-381 Ambesi-Impiombato FS, Picone R, Tramontano D 1982 Influence of hormones and serum on growth and differentiation of the thyroid cell strain FRTL. In: Serbasku DA, Sato GH, Pardee A (eds) Cold Spring Harbor Symposia on Quantitative Biology. Cold Spring Harbor Laboratory, Cold Spring Harbor, vol 9:483 Ambesi-Impiombato FS, Parks LAM, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Nat1 Acad Sci USA 77:3455-3459 Trischitta V, Damante G, Foti D 1987 Insulin binding and biological activities in the FRTL-5 rat thyroid cell line. Metabolism 36:379383 Birnbaum MJ, Haspel HC, Rosen OM 1986 Cloning and characterization of a cDNA encoding the rat brain glucose transporterprotein. Proc Nat1 Acad Sci USA 83:5784-5788 Thorens B, Sarkar HK, Kaback HR, Lodish HF 1988 Cloning and functional expression in bacteria of a novel glucose transporter present in liver, intestine, kidney, and pancreatic islet cells. Cell 55:281-290 Kayano T, Fukumoto H, Eddy RL, Fan YS, Byers MG, Shows TB, Bell GI 1988 Evidence for a family of human glucose transporterlike proteins. Sequence and gene localization of a protein expressed in fetal skeletal muscle and other tissues, J Biol Chem 263:1524515248 Birnbaum MJ 1989 Identification of a novel gene encoding an insulin-responsive glucose transporter protein. Cell 57:305-315 Kayano T, Burant CF, Fukumoto H, Gould GW, Fan Y, Eddy RL, Byers MG, Shows TB, Seino S, Bell GI 1990 Human facilitative glucose transporters. J Biol Chem 265:13276-13282 Nude1 U, Zakut R, Shani M, Neuman S, Levy Z, Yaffe D 1983 The nucleotide sequence of the rat cytoplasmic p-actin gene. Nucleic Acids Res 11:1759-1771 Chelly J, Kaplan JC, Maire I’, Gautron S, Kahn A 1988 Transcription of the dystrophin gene in human muscle and non-muscle tissues. Nature 333:858-860 Wang AM, Doyle MV, Mark DF 1989 Quantitation of mRNA by the polymerase chain reaction. Proc Nat1 Acad Sci USA 86:97179721 Chirgwin M, Przybyla AE, MacDonald RJ, Rutter WJ 1979 lsolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299 Towbin H, Staehelin T, Gordon I 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and aoulications. Proc Nat1 Acad Sci USA 76:3450-4354 Hawke’s R, Niday E, Gordon J 1982 A dot-immunobinding assay for monoclonal and other antibodies. Anal Biochem 119:142-147 Dumont JE, Vassart G 1979 Thyroid gland metabolism and the action of TSH. In: DeGroot Lj (ed) Textbook of Endocrinology. Grune and Stratton, New York, pp 311-329 Haraguchi K, Rani CSS, Field JB 1988 Effects of thyrotropin, carbachol, and protein kinase-C stimulators on glucose transport and glucose oxidation bv primary cultures of dog- thyroid cells. _ Endo&inology 12331288:1295 _ Mueckler M, Caruso C, Baldwin SA, Panic0 M, Blench I, Morris HR, Allard ‘WJ, Lienhard GE, Lodish HF 1985 Sequence and structure of a human glucose transporter. Science 229:941-945 Fukumoto H, Seino S, Imura H, Seino Y, Eddy RL, Fukushima Y, Byers MG, Shows TB, Bell GI 1988 Sequence, tissue distribution, and chromosomal localization of mRNA encoding a human glucose transporter-like protein. Proc Nat1 Acad Sci USA 85:5434-5438 Fukumoto H, Kayano T, Buse JB, Edwards Y, Pilch PF, Bell GI, Seino S 1989 Cloning and characterization of the major insulinresponsive glucose transporter expressed in human skeletal muscle and other insulin-responsive tissues. J Biol Chem 264:7776-7779 Rollins BJ, Morrison ED, Usher P, Flier JS 1988 Platelet-derived growth factor regulates glucose transporter expression. J Biol Chem 263~16523-16526 Hiraki Y, Rosen OM, Birnbaum MJ 1988 Growth factors rapidly
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
27.
28.
29.
30.
31.
TRANSPORTER
induce expression of the glucose transporter gene. J Biol Chem 263:13655-13662 Kosaki A, Kuzuya H, Yoshimasa Y, Yamada K, Okamoto M, Nishimura H, Kakehi T, Takada J, Seino Y, Imura H 1988 Regulation of glucose-transporter gene expression by insulin in cultured human fibroblasts. Diabetes 37:1583-1586 Werner H, Raizada MK, Mudd IM, Foty HL, Simpson IA, Roberts CT, LeRoith D 1989 Regulation of rat brain/HepG2 glucose transporter gene expression by insulin and insulin-like growth factor-I in primary cultures of neural and glial cells. Endocrinology 125:314320 Weinstein SP, Watts J, Graves PN, Haber RS 1990 Stimulation of glucose transport by thyroid hormone in ARL 15 cells: increased abundance of glucose transporter protein and messenger ribonucleic acid. Endocrinology 126:1421-1429 Garvey WT, Huecksteadt TP, Lima FB, Birnbaum MJ 1989 Expression of a glucose transporter gene cloned from brain in cellular models of insulin resistance: dexamethasone decreases transporter mRNA in primary cultured adipocytes. Mol Endocrinol 3:11321141 Backus JW, Eagleton MJ, Harris SG, Sparks CE, Sparks JD, Smith
mRNAs
32.
33.
34.
35.
36.
37.
IN THYROID
165
HC 1990 Quantitation of endogenous liver apolipoprotein B mRNA editing. Biochem Biophys Res Commun 170:513-518 Hiraki Y, MacMorrow IM, Birnbaum MJ 1989 The regulation of glucose transporter gene expression by cyclic adenosine monophosphate in NIH 3T3 fibroblasts. Mol Endocrinol 3:1470-1476 Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot M, Lane MD 1991 Transcriptional repression of the mouse insulin-responsive glucose transporter (GLUT4) gene by CAMP. Proc Nat1 Acad Sci USA 88:1933-1937 Cushman SW, Wardzala LJ 1980 Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell. J Biol Chem 255:4758-4762 Kono T, Robinson FW, Blevins TL, Ezaki 0 1982 Evidence that translocation of the glucose transport activity is the major mechanism of insulin action on glucose transport in fat cells. J Biol Chem 257:10942-10947 Baly DI, Horuk R 1987 Dissociation of insulin-stimulated glucose transport from the translocation of glucose carriers in rat adipose cells. J Biol Chem 262:21-24 Jones TLZ, Cushman SW 1989 Acute effects of cycloheximide on the translocation of glucose transporters in rat adipose cells. J Biol Chem 264:7874-7877
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
Vol. 131, No. 1 Printed in lJ.S.A
Society
The Regulation of Two Distinct Glucose (GLUT1 and GLUT4) Gene Expressions Thyroid Cells by Thyrotropin YOSHIYUKI HOSAKA, TOYOSHI ENDO, AND Third Department 409-38, Japan
of
MASATO TAWATA, TOSHIMASA ONAYA
Internal
Medicine,
AKIHIRO
University
of
KURIHARA,
Yamanashi
Medical
MASAYUKI School, Tamaho,
Transporter in Cultured
Rat
OHTAKA, Yamanashi
ABSTRACT We investigated the glucose transporter mRNAs expressed in FRTL5, a rat thyroid cell line, and their regulation by TSH by means of the polymerase chain reaction. FRTL5 cells as well as rat thyroid tissue expressed three types of glucose transporter mRNAs: GLUT1 or erythrocyte/HepG2/brain isoform, GLUT2 or pancreatic @cell/liver isoform, and GLUT4 or muscle/fat isoform. GLUT1 mRNA predominated, GLUT4 mRNA was minor, and GLUT2 mRNA expression was faint. Incubation of FRTL5 cells with TSH induced a timeand concentration-dependent increase in GLUT1 mRNA levels, while GLUT4 mRNA levels were decreased. The response of GLUT1 mRNA to TSH was evident at 3 h, and the maximal response was achieved at
12 h. TSH at a dose of 1 mu/ml elicited an approximately 3-fold increase in GLUT1 mRNA levels. (Bu),cAMP (1 mM), 8-bromo-CAMP (1 mM), and forskolin (50 fiM) mimicked the effect of TSH on GLUT1 and GLUT4 mRNA levels. The increase in GLUT1 mRNA by TSH was correlated with the increase in GLUT1 protein and the increase in 2-deoxyglucose transport activity. These observations suggest that in thyroid cells, TSH stimulates glucose transport at least in part by enhancing GLUT1 gene expression, and that the effect of TSH on GLUT1 and GLUT4 mRNA levels is mediated by a CAMP-dependent pathway. (Endocrinology 131: 159-165,1992)
P
Cell culture
OLYPEPTIDE hormones regulate a variety of intracellular processes by modulating the availability of nutrients. In thyroid cells, TSH induces a number of metabolic effects, which, in turn, influence virtually all aspects of thyroid cellular function (1). Glucose is an essential substrate for several thyroid cell functions (l-3). The presence of glucose in the incubation medium enhances both the organification process and TSH-induced thyroid hormone synthesis in thyroid slices (2, 3). Moreover, TSH has been shown to increase glucose transport in cultured thyroid cells (4). With the exception of the luminal sodium-glucose transport system of renal and intestinal epithelium (5), the uptake of glucose into cells occurs by facilitated diffusion mediated by glucose transport proteins, of which there are at least five distinct types with partial sequence homology and differing tissue distribution. However, little is known about glucose transporters in thyroid cells and the precise mechanisms by which glucose transport is regulated by TSH. The first question to be answered is which glucose transporters are expressed in thyroid cells? The second is does TSH affect their gene expressions? In this study we examined the glucose transporter mRNAs expressed in rat thyroid tissue and FRTL5 cells and investigated their regulation by TSH in FRTL5 cells. Materials Rat thyroid
FRTL5, a continuous line of differentiated rat thyroid cells whose characteristics have been extensively described (6, 7), was kindly provided by Dr. Leonard D. Kohn (NIH). Cells were maintained in monolayer culture in Ham’s F-12K medium supplemented with 5% calf serum (Gibco, Grand Island, NY) and a h-hormone mixture (6H medium) including 10 &ml insulin (Sigma Chemical Co., St. Louis, MO) and 10 mu/ml TSH (Sigma Chemical Co.). Cells were cultured in loo-mm petri dishes (Corning Medical, Medfield, MA) or 12.well tissue culture dishes (Costar, Cambridge, MA) at 37 C under 5% COZ in air in a watersaturated incubator. The medium was changed twice a week, and when confluence was reached, the cells were subcultured (1:lO split) using a 0.05% trypsin and 1 rnM EDTA mixture in Ca’+- and Mg*+-free Hanks’ solution. To investigate the effect of TSH, when cells reached confluence, TSH and insulin were removed, since insulin affects glucose transport in FRTL5 cells (8). The concentration of serum in the medium was gradually decreased to 0.2% in 8 days, The cells were then preincubated for varying periods with the additives indicated in the text. During preincubation, the medium was changed every 12 h to maintain the glucose concentration.
Oligonucleotides
and Methods
tissue
Rat thyroid tissue was obtained from 2-week-old killed by cardiac puncture under ether anesthesia.
male
Received October 23, 1991. Address all correspondence and requests for reprints masa Onaya, Third Department of Internal Medicine, Yamanashi Medical School, Tamaho, Yamanashi 409-38,
Wistar
used for amplification
Forward and reverse primers for GLUTI, GLUT2, GLUT3, GLUT4, and GLUT5 cDNA were designed from the cDNA sequences of rat brain (9), rat liver (lo), human fetal skeletal muscle (1 l), rat skeletal muscle (12), and human small intestine (13), respectively. Primers of @-actin cDNA were designed from the sequence of the rat p-actin gene (14). They were synthesized on a DNA synthesizer (Applied Biosystems, Tokyo, Japan). The primers are described in Table 1.
rats
Quantitative
analyses of glucose transporter
mRNAs
To measure the relative abundance of glucose transporter mRNA levels, we slightly modified the methods of Chelly et al. (15) and Wang et al. (16). After preincubation, FRTL5 cells were harvested by trypsinization and lysed with 4 M guanidine thiocyanate containing 0.5%
to: Dr. ToshiUniversity of Japan.
59
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
160
GLUCOSE
TABLE
1.
TRANSPORTER
primer
Location
GLUT2
5’ ACTCAACGAGCATCTTCGAG 5’ CTTACGTGTTCTTCCTTTTT
3’ 3’
GLUT3 GLUT4 GLUT5 &A&in
5’ 5’ 5’ 5’
3’ 3’ 3’ 3’
GLUT1
Endo. Voll31.
TCCAACTTCCTAGTCGGATT TTTCCAGTATGTTGCGGATG CAGCATCGTCTGTGTCATCT TGTTTGAGACCTTCAACACC
Western blot analysis of glucose transporter
1992 No 1
glucose transport
Location
5’ AAGAGCTGGTCACCTGTCTT 5’ GTGTAGTCCTACACTCATGA
3’ 3’
1636-1655 1638-1657
5’ 5’ 5’ 5’
3’ 3’ 3’ 3’
1681-1700 1616-1635 1531-1550 739-758
GATGCTGTTCATCTCCATGA TCAGTCATTCTCATCTGGCC TTCAGTTCCTCCTTTTCCGG CGCTCATTGCCGATAGTGAT
culture dishes. After preincubation, the cells were rinsed 3 times with 1 ml Dulbecco’s phosphate buffer and incubated in Krebs-Ringer-HEPES (20 mM), pH 7.4, at 22 C in the presence of the glucose analog. Glucose transport activity was measured by adding 0.1 mM [3H]2-deoxy-oglucose (1 &/ml). Nonfacilitated uptake was determined in the presence of 20 PM cytochalasin-B. To measure the initial uptake rate, a 5min incubation was used. The incubations were terminated by rapidly washing the cells 3 times with ice-cold PBS, pH 7.4, containing 100 mM D-glucose. The cells were then solubilized in 0.5 ml 0.1 N NaOH, and a 0.4-ml aliquot was diluted in 4 ml IWO-FLUOR 15 (Packard, Downers Grove, IL) and counted for radioactivity in a liquid scintillation @-counter (Aloka LSC-3600, Tokyo, Japan).
Results Glucose transporter cells
mRNAs
in rat thyroid
tissue and FRTL5
We first examined the glucose transporter mRNAs expressedin rat thyroid tissue. When amplifications were carried out for 35 cycles, as shown in Fig. lA, GLUTI, GLUT2, and GLUT4 mRNAs were recognized. The GLUT1 mRNA was strongly detected, the signal of GLUT4 mRNA was weak, and the GLUT2 mRNA was faintly detected. When
A.
rat thyroid tissue GLUT1
GLUT2
GLUT3
GLUT4
GLUTS
protein
After preincubation, the cells were homogenized with ice-cold buffer containing 250 mM sucrose, 10 mM Tris, and 2 mM EDTA, pH 7.4. The homogenates were centrifuged at 3,700 X g for 25 min at 4 C. The supernatant was centrifuged at 200,000 X g for 70 min at 4 C to obtain total postnuclear membranes. The membranes were resuspended in homogenization buffer by repeated passage through a 25-gauge needle. The samples (50 kg) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. Immunoblotting and staining were performed according to the method of Towbin et al. (18) and Hawkes et al. (19) with slight modification. For the determination of GLUT1 protein, the nitrocellulose membranes were incubated overnight at 4 C with rabbit anti-GLUT1 antiserum 281 (1:200) in Tris-buffered saline containing 5% skim milk. Rabbit antiGLUT1 antiserum 281 was raised in this laboratory against the peptide corresponding to amino acid sequence 463-492 of the carboxyl-terminal region of the rat brain glucose transporter (9). After washing in Trisbuffered saline containing 0.3% Tween-20, the membranes were further exposed for 1 h at room temperature to peroxidase-labeled antirabbit immunoglobulin G (Jackson Immunoresearch Laboratory, Bar Harbor, ME; 1:400). The membranes were washed as described above, and the peroxidase activity was demonstrated with diaminobenzidine-HzOz. of
Reverse primer
1085-1104 1382-1401 1475-1496 1416-1435 1200-1219 368-387
laurylsalcosin. Total RNA was extracted using a cesium chloride gradient centrifugation technique (17). Fifteen micrograms of total RNA were heated at 70 C for 10 min, cooled slowly to 42 C, and then reverse transcribed at 42 C for 120 min in a 20-~1 reaction mixture containing 50 mM Tris-HCl (pH 8.3), 100 mM KCI, 10 mM MgC12, 10 mM dithiothreitol, 0.25 mM deoxy-NTPs, 0.2 pg oligo(dT), 400 U RNasin (Takara Shuzo Co., Kyoto, Japan), and 11 U Rous-associated virus 2 (RAV-2) reverse transcriptase (Takara Shuzo Co., Kyoto, Japan). GLUTl, GLUT4, or fl-actin cDNA fragments were then amplified by polymerase chain reaction (PCR) in a 50-~1 reaction mixture containing 0.511 of the reverse transcription mixture as a template, 0.25 mM deoxy-NTPs, 2.5 U Thermus a9uaf1cs DNA polymerase (Takara Shuzo Co., Kyoto, Japan), and 0.5 fig forward and reverse primers. To monitor the reaction, the forward primer was 5’-end labeled with ?’ to a specific activity of 5 X 10’ cpm/ pg using T4 polynucleotide kinase (Takara Shuzo Co., Kyoto, Japan). The final concentration of PCR buffer was 50 mM Tris-HCl (pH 8.3), 1 mM MgQ, 30 mM KCI, and 10 mM dithiothreitol.The mixture was overlaid with 50 ~1 mineral oil. PCRs were carried out by 22-30 cycles with Atto thermal cycler (Atto Co., Tokyo, Japan). The cycle conditions were one cycle of 1 min at 93 C, 1.5 min at 60 C, and 1.5 min at 72 C. However, at the beginning of the first cycle, the reactions were held for 5 min at 93 C to ensure complete denaturation. Ten microliters of PCR product mixture were then electrophoresed in 2% agarose gels in Trisacetate-EDTA buffer containing ethidium bromide and visualized under UV rays. After electrophoresis, the appropriate bands were cut out from the gel, and radioactivity was determined by scintillation counting. To correct the tube to tube variation in PCR, duplicate determination was performed for each experiment. The relative ? radioactivity of each GLUT PCR product was divided by the relative ?’ radioactivity of fiactin PCR product and expressed as the relative abundance of GLUT mRNAs. Data are the mean f SEM of three independently performed experiments.
Hexose previously
IN THYROID
Oligonucleotides used for amplification Forward
Measurement
mRNAs
activity
transport assays in FRTW cells were performed as described by Flletti et nl. (4). The cells were plated in 12-well tissue
B.
FRTL 5 cells GLUT1
GLUT2
GLUT3
GLUT4
GLUT5
1. Glucose transporter mRNAs expressed in rat thyroid tissue and FRTL5 cells. A, The ethidium bromide-stained PCR products amplified from total RNA extracted from rat thyroid tissue. Fifteen micrograms of total RNA were reverse transcribed in a 20-~1 reaction into cDNA, using oligo(dT) as a primer; 0.5 ~1 of the reactions was used for PCR amplification. PCR was performed with 35 cycles of reactions using a pair of specific primers, as described in Materials and Methods. B, Ethidium bromide-stained PCR products amplified from total RNA extracted from FRTL5 cells. bp, Basepairs. FIG.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
TRANSPORTER
we used the RNA samples extracted from FRTL5 cells, as shown in Fig. lB, similar results were observed. With respect to GLUT3 and GLUT5 mRNAs, it is possible that we did not detect them because of the differences in cDNA sequences between humans and rats, as GLUT3 and GLUT5 cDNA sequences are so far available only for humans (11, 13). GLUTl, GLUT2, and GLUT4 cDNAs were sufficiently amplified when they were amplified from rat brain, liver, and skeletal muscle, respectively (data not shown). Effects of TSH on glucose transporter
mRNA
levels
Based on the results shown in Fig. 1, we next examined the effects of TSH on GLUT1 and GLUT4 mRNA levels using FRTL5 cells. In preliminary experiments we determined the number of PCR cycles that would be adequate for quantitative analysis. After observing the amount of PCR product after each cycle, we found the amplification to be exponential within 22-30 cycles for GLUT1 mRNA, 27-32 cycles for GLUT4 mRNA, and 18-25 cycles for p-actin mRNA (data not shown). Therefore, PCR was carried out by 25, 30, and 22 cycles for GLUTl, GLUT4, and @-actin mRNA, respectively. The GLUT2 mRNA levels were too low to analyze quantitatively. Interassay (tube to tube) variability in our PCR protocol was less than 5%. When FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum, were treated with 1 mu/ml TSH, the GLUT1 mRNA level showed a time-dependent increase (Fig. 2A). In contrast, GLUT4 mRNA levels were slightly decreased (Fig. 2B). The @-actin mRNA levels did not change during 36 h (Fig. 2C). The relative abundance of GLUT1 and GLUT4 mRNA levels corrected by @actin mRNA are shown in Fig. 2, D and E. The GLUT1 mRNA level significantly increased at 6 h, reached a maximum at 12 h, showing a 3-fold increase over the basal value, and thereafter decreased gradually (Fig. 2D). In contrast, the GLUT4 mRNA level was gradually decreased to 40% of the basal value at 36 h (Fig. 2E). We then investigated the TSH concentration dependency on GLUT1 and GLUT4 mRNA levels 12 h after exposure. As shown in Fig. 3A, the effect of TSH on the GLUT1 mRNA level was concentration dependent. A significant increase was observed at a concentration of 0.01 mu/ml TSH, and a maximal stimulation was observed at 1 mu/ml TSH, achieving a 3-fold increase. However, the GLUT4 mRNA level gradually decreased in response to the TSH concentration (Fig. 3B). Effects of CAMP on GLUT1
and GLUT4
mRNA
levels
The majority of the actions of TSH on thyroid cells are mediated by a CAMP-dependent pathway (20). To assess whether CAMP plays a role in the modulation of glucose transporter mRNA levels, we examined the effects of three agents, 8-bromo-CAMP, (Bu)~cAMP, and forskolin, which increase the intracellular CAMP level or mimic the action of CAMP in various types of cells. When the cells incubated in control medium were exposed for 12 h to 8-bromo-CAMP (1 mM), (Bu)*cAMP (1 mM), and forskolin (50 PM), the GLUT1
mRNAs
IN THYROID
161
mRNA level increased 2.6-, 2.8-, and 3.1-fold, respectively (Fig. 4A). In contrast, the GLUT4 mRNA level was decreased 40-60% by each of the three agents (Fig. 48). Effects of TSH and CAMP on GLUT1
protein
levels
To correlate the changes in glucose transporter mRNA levels with their protein levels, Western blot analysis was performed on total postnuclear membrane from the cells. Figure 5 shows that the rabbit anti-GLUT1 antiserum 281 recognized a protein with a molecular mass of 55 kilodaltons. The signal was increased by the addition of TSH (1 mu/ml) or (Bu),cAMP (1 mM) for 12 h. Thus, TSH is capable of increasing the amount of GLUT1 protein, and the effect of TSH is mimicked by CAMP. On the other hand, the GLUT4 isoform could not be detected in FRTL5 cells by a mouse anti-GLUT4 monoclonal antibody (Genzyme Co., Cambridge, MA) by Western blotting (data not shown). Effects of TSH and CAMP on glucose transport
activity
Previous studies have demonstrated that TSH increases glucose transport in thyroid cells (4, 21). Consistent with these studies, 2-deoxyglucose transport in FRTL5 cells was increased by TSH in a concentration-dependent manner within the range 0.01-1.0 mu/ml. (Bu),cAMP (1 mM) mimicked the effect of TSH (Table 2). Effects of actinomycin-D
on GLUT1
mRNA
levels
In the last of our experiments, we examined whether the TSH-stimulated increase in the expression of GLUT1 mRNA is due to a transcriptional or posttranscriptional mechanism. The cells were pretreated with 1 Fg/ml actinomycin-D for 30 min before the addition of TSH and then exposed to 1 mu/ ml TSH for 6 h. As shown in Fig. 6, the stimulatory effect of TSH on GLUT1 mRNA levels was completely suppressed.
Discussion Recent studies have established that the facilitative diffusion of glucose across the plasma membrane of mammalian cells is mediated by a family of structurally related glucose transport proteins (9-13, 22-24). These proteins have distinct tissue distributions, biochemical properties, and modes of regulation. This diversity presumably allows the uptake of glucose to be precisely controlled under different physiological conditions. RNA-blotting studies have revealed that most tissues express plural facilitative transporter isoforms, and that a single cell can express more than one transporter isoform. In this study we used the PCR to examine the expression of glucose transporter mRNAs. This technique is extremely sensitive, because of the amplification. It is also highly specific, because detection requires annealing of both the reverse and forward primers. Using this approach, we detected three types of glucose transporter (GLUTl, GLUT2, and GLUT4) mRNAs in rat thyroid tissue and FRTL5 cells. It may be misleading to conclude the relative abundance of GLUTI, GLUT2, and GLUT4 mRNAs only from the results
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
162
GLUCOSE TRANSPORTER
mRNAs IN THYROID
A. GLUT1
FIG. 2. Time course of GLUT1 and GLUT4 mRNA levels after the addition of 1 mu/ml TSH. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum, were treated with 1 mu/ml TSH. After preincubation for the indicated period, the cells were harvested. Fifteen micrograms of total RNA were prepared and reverse transcribed into cDNA in 20-~1 reactions; 0.5 ~1 of the reactions was used for PCR. GLUT1 (A), GLUT4 (B), and @-actin (C) cDNA fragments were amplified by PCR using “P end-labeled forward primer, as described in Materials and Methods. PCR was carried out by 25, 30, and 22 cycles for GLUTl, GLUT4, and /3-actin cDNA, respectively. The relative abundance of GLUT1 and GLUT4 mRNA normalized by p-actin mRNA is presented in D and E, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. 0 h). bp, Basepairs.
571
B. GLUT4
Endo. Vol131.
bp p*
0
3
6
122436
0
3
6
122436
0
3
6
122436
220 bp -
C. p-actin
Time (h) E.
6 Time FIG. 3. Concentration dependency of TSH on GLUT1 and GLUT4 mRNAs. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with the indicated concentration of TSH. After 12 h of preincubation, the cells were harvested and subjected to the analysis described in Fig. 2. The relative abundance of GLUT1 and GLUT4 mRNA normalized by (3-actin mRNA is presented in A and B, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. control).
1992 No 1
4
6
1;
(h)
2’4 Time
3’6
(h)
A.
”
OL
1
0
0.01
0.1 TSH
of Fig. 1, becauseit is possible that they simply reflect the different efficiencies of the primers used for PCR. However, in Western blot analysis using anti-GLUT4 antibody, we could not detect GLUT4 protein in FRTL5 cells. The same antibody recognized GLUT4 protein in rat skeletal muscle (data not shown). On the other hand, GLUT1 protein was observed by Western blot analysis in FRTW cells. These results strongly suggest that GLUT1 mainly plays a role in the transport of glucose in thyroid cells. Our results also suggestthe possibility that PCR can detect GLUT4 transcripts
(mu/ml)
1
10
0
0.01
0.1
TSH
1
10
(mu/ml)
in tissues that were previously thought not to express this gene. A variety of hormones, including growth factors (25, 26), insulin (27, 28), thyroid hormone (29), and glucocorticoids (30), have been reported to affect glucose transporter mRNA expression. However, further studies are needed to learn how plural transporter mRNAs expressedin a single cell are regulated. One reason for the difficulty is that the Northern blotting technique is not sufficiently sensitive to analyze the alterations of minor forms of transporter mRNAs. Some
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
TRANSPORTER
mRNAs
IN THYROID
A. FIG. 4. Effects of 8bromo-CAMP (8BC), (Bu& (DBC), and forskolin (FRK) on GLUT1 and GLUT4 mRNA levels. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with 1 mM 8-bromo-CAMP, 1 mM (Bu),cAMP, and 50 PM forskolin. After 12 h of preincubation, the cells were harvested and subjected to the analysis described in Fig. 2. The relative abundance of GLUT1 and GLUT4 mRNAs normalized by fl-actin mRNA is presented in A and B, respectively. Values are the mean + SEM of three independently performed experiments. *, P < 0.05; **, P < 0.01 (us. control).
B.
s t 553 & 2
C g 5 1 E F 2 0
2
’
L control
(lmU/ml)
TSH
8BC
(lmU/ml)
(1mM)
COIWOi
(1mM)
FRK (50@8)
TABLE 2. Effect of TSH and CAMP on 2-deoxyglucose uptake in FRTL5 cells
UW
2-DC uptake (pmol/ fig DNA.5 min)
Additives
94 KDa
None 1.1 f 0.08 TSH (0.01 mu/ml) 5.2 + 0.26 TSH (0.1 mu/ml) 1.5 + 0.22 TSH (1.0 mu/ml) 12.1 -+ 0.12 (Bu)~cAMP (1 mM) 10.3 3~ 0.18 FRTL5 cells were incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with the indicated concentration of TSH or 1 mM (Bu),cAMP for 12 h. 2Deoxyglucose (2-DG) transport was then measured, as described in Materials and Methods. Values are the mean +- SEM of three independently performed experiments.
67
43
DBC (1mM)
-c
2-
30
COntrOl
TSH DBC 1 mu/ml 1 mM
FIG. 5. Western blot analysis of the GLUT1 protein in FRTL5 cells. FRTL5 cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were treated with 1 mM TSH or 1 mM (Bu)~cAMP. After 12 h of preincubation, total postnuclear membranes were isolated and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membrane and reacted with anti-GLUT1 antiserum 281, as described in Materials and Methods. The result shown is the representative of four independently performed experiments. Mr, Mol wt.
investigators have recently reported that the PCR technique can be used to measure the abundance of mRNA (15, 16). Backus et al. (31) reported that the hybridization technique and PCR yield similar quantitation. The present study using the PCR technique demonstrated that in FRTL5 cells, TSH specifically increasesthe predominant form, GLUT1 mRNA
1 -
d
i
6
Time (h) FIG. 6. Effects of actinomycin-D on the accumulation of GLUT1 mRNA levels. FRTLB cells incubated in the control medium lacking TSH and insulin and containing 0.2% calf serum were pretreated with (0) or without (0) 1 rg/ml actinomycin-D. The cells were then exposed to 1 mu/ml TSH. After the indicated periods, the cells were harvested and subjected to the analysis described in Fig. 2. Values are the mean + SEM of three independently performed experiments.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
164
GLUCOSE
TRANSPORTER
levels, while GLUT4 mRNA levels were decreased. GLUT2 mRNA levels were too low to analyze quantitatively. Further, we demonstrated that TSH increased GLUT1 protein levels and 2-deoxyglucose uptake activities. Our observations suggest that the effect of TSH on glucose transport in thyroid cells is at least in part accompanied by increased expression of GLUT1 mRNA and protein. The physiological significance of the decrease in GLUT4 mRNA expression is unknown. Further study is needed to reveal the role of GLUT4 in thyroid cells. The agents 8-bromo-CAMP, (Bu&, and forskolin mimicked the effect of TSH on GLUT1 and GLUT4 mRNA levels. (Bu),cAMP mimicked the stimulatory effect of TSH on GLUT1 protein expression and 2-deoxyglucose uptake. Our results are consistent with previous reports of these agents on glucose transport in various types of cells. It has been reported that cholera toxin and 8-bromo-CAMP increase the uptake of 2-deoxyglucose in NIH 3T3 fibroblasts (32). Cholera toxin, (Bu)~cAMP, and 8-bromo-CAMP significantly increase the transport of glucose in primary cultures of canine thyroid cells (21). Kaestner et al. (33) recently reported that CAMP causes the transcriptional repression of the GLUT4 gene and the transcriptional stimulation of the GLUT1 gene in 3T3 adipocytes. Their data and ours suggest that these effects of CAMP on GLUT1 and GLUT4 mRNA expression are universal regardless of tissue or cell type. The present study suggests that TSH increases the amount of GLUT1 protein in thyroid cells. However, a disparity between the effect of TSH on the extent of GLUT1 mRNA levels (3-fold) and its effect on the extent of transport stimulation (12-fold) was observed. Therefore, an additional possibility exists, such as promoting the recruitment of glucose transporter from the intracellular pool to the cell surface or stimulating the intrinsic activity of glucose transporter. Insulin has been reported to increase the translocation of glucose transporter to the cell surface in adipose cells (34, 35). On the other hand, the enhancement of transporter intrinsic activity was also suggested by the disparity between the extent of transporter recruitment to the plasma membrane and the extent of transport stimulation (36, 37). It would be of considerable interest to learn whether TSH influences GLUT1 in these processes. Experiments to resolve these problems are currently in progress.
mRNAs
5
6
7
8
9
10
11
12 13
14
15
16
17
18
19 20
21
Acknowledgments The authors ami Nakamura,
express their appreciation to Tomoko and Yukiko Sato for their secretarial
Kawaguchi, assistance.
Man-
22
23
References 1. Dumont JE 1971 The action of thyrotropin on thyroid metabolism. Vitam Horm 29:287-412 2. Schussler GC, lngbar SH 1961 The role of intermediary carbohydrate metabolism in regulating organic iodinations in the thyroid gland. J Clin Invest 40:1394-1412 3. Ahn CS, Rosenberg IN 1980 Glucose dependence of thyrotropinstimulated thyroid hormone formation. Endocrinology 107:18611866 4. Filetti S, Damante G, Foti D 1987 Thyrotropin stimulates glucose
24
25
26.
IN THYROID
Endo - 1992 Vol131. No 1
transport in cultured rat thyroid cells. Endocrinology 120:25762581 Hedigar MA, Coady MJ, Ikeda TS, Wright EM 1987 Expression cloning and cDNA sequencing of the Na’/glucose co-transporter. Nature 330:379-381 Ambesi-Impiombato FS, Picone R, Tramontano D 1982 Influence of hormones and serum on growth and differentiation of the thyroid cell strain FRTL. In: Serbasku DA, Sato GH, Pardee A (eds) Cold Spring Harbor Symposia on Quantitative Biology. Cold Spring Harbor Laboratory, Cold Spring Harbor, vol 9:483 Ambesi-Impiombato FS, Parks LAM, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Nat1 Acad Sci USA 77:3455-3459 Trischitta V, Damante G, Foti D 1987 Insulin binding and biological activities in the FRTL-5 rat thyroid cell line. Metabolism 36:379383 Birnbaum MJ, Haspel HC, Rosen OM 1986 Cloning and characterization of a cDNA encoding the rat brain glucose transporterprotein. Proc Nat1 Acad Sci USA 83:5784-5788 Thorens B, Sarkar HK, Kaback HR, Lodish HF 1988 Cloning and functional expression in bacteria of a novel glucose transporter present in liver, intestine, kidney, and pancreatic islet cells. Cell 55:281-290 Kayano T, Fukumoto H, Eddy RL, Fan YS, Byers MG, Shows TB, Bell GI 1988 Evidence for a family of human glucose transporterlike proteins. Sequence and gene localization of a protein expressed in fetal skeletal muscle and other tissues, J Biol Chem 263:1524515248 Birnbaum MJ 1989 Identification of a novel gene encoding an insulin-responsive glucose transporter protein. Cell 57:305-315 Kayano T, Burant CF, Fukumoto H, Gould GW, Fan Y, Eddy RL, Byers MG, Shows TB, Seino S, Bell GI 1990 Human facilitative glucose transporters. J Biol Chem 265:13276-13282 Nude1 U, Zakut R, Shani M, Neuman S, Levy Z, Yaffe D 1983 The nucleotide sequence of the rat cytoplasmic p-actin gene. Nucleic Acids Res 11:1759-1771 Chelly J, Kaplan JC, Maire I’, Gautron S, Kahn A 1988 Transcription of the dystrophin gene in human muscle and non-muscle tissues. Nature 333:858-860 Wang AM, Doyle MV, Mark DF 1989 Quantitation of mRNA by the polymerase chain reaction. Proc Nat1 Acad Sci USA 86:97179721 Chirgwin M, Przybyla AE, MacDonald RJ, Rutter WJ 1979 lsolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299 Towbin H, Staehelin T, Gordon I 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and aoulications. Proc Nat1 Acad Sci USA 76:3450-4354 Hawke’s R, Niday E, Gordon J 1982 A dot-immunobinding assay for monoclonal and other antibodies. Anal Biochem 119:142-147 Dumont JE, Vassart G 1979 Thyroid gland metabolism and the action of TSH. In: DeGroot Lj (ed) Textbook of Endocrinology. Grune and Stratton, New York, pp 311-329 Haraguchi K, Rani CSS, Field JB 1988 Effects of thyrotropin, carbachol, and protein kinase-C stimulators on glucose transport and glucose oxidation bv primary cultures of dog- thyroid cells. _ Endo&inology 12331288:1295 _ Mueckler M, Caruso C, Baldwin SA, Panic0 M, Blench I, Morris HR, Allard ‘WJ, Lienhard GE, Lodish HF 1985 Sequence and structure of a human glucose transporter. Science 229:941-945 Fukumoto H, Seino S, Imura H, Seino Y, Eddy RL, Fukushima Y, Byers MG, Shows TB, Bell GI 1988 Sequence, tissue distribution, and chromosomal localization of mRNA encoding a human glucose transporter-like protein. Proc Nat1 Acad Sci USA 85:5434-5438 Fukumoto H, Kayano T, Buse JB, Edwards Y, Pilch PF, Bell GI, Seino S 1989 Cloning and characterization of the major insulinresponsive glucose transporter expressed in human skeletal muscle and other insulin-responsive tissues. J Biol Chem 264:7776-7779 Rollins BJ, Morrison ED, Usher P, Flier JS 1988 Platelet-derived growth factor regulates glucose transporter expression. J Biol Chem 263~16523-16526 Hiraki Y, Rosen OM, Birnbaum MJ 1988 Growth factors rapidly
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
GLUCOSE
27.
28.
29.
30.
31.
TRANSPORTER
induce expression of the glucose transporter gene. J Biol Chem 263:13655-13662 Kosaki A, Kuzuya H, Yoshimasa Y, Yamada K, Okamoto M, Nishimura H, Kakehi T, Takada J, Seino Y, Imura H 1988 Regulation of glucose-transporter gene expression by insulin in cultured human fibroblasts. Diabetes 37:1583-1586 Werner H, Raizada MK, Mudd IM, Foty HL, Simpson IA, Roberts CT, LeRoith D 1989 Regulation of rat brain/HepG2 glucose transporter gene expression by insulin and insulin-like growth factor-I in primary cultures of neural and glial cells. Endocrinology 125:314320 Weinstein SP, Watts J, Graves PN, Haber RS 1990 Stimulation of glucose transport by thyroid hormone in ARL 15 cells: increased abundance of glucose transporter protein and messenger ribonucleic acid. Endocrinology 126:1421-1429 Garvey WT, Huecksteadt TP, Lima FB, Birnbaum MJ 1989 Expression of a glucose transporter gene cloned from brain in cellular models of insulin resistance: dexamethasone decreases transporter mRNA in primary cultured adipocytes. Mol Endocrinol 3:11321141 Backus JW, Eagleton MJ, Harris SG, Sparks CE, Sparks JD, Smith
mRNAs
32.
33.
34.
35.
36.
37.
IN THYROID
165
HC 1990 Quantitation of endogenous liver apolipoprotein B mRNA editing. Biochem Biophys Res Commun 170:513-518 Hiraki Y, MacMorrow IM, Birnbaum MJ 1989 The regulation of glucose transporter gene expression by cyclic adenosine monophosphate in NIH 3T3 fibroblasts. Mol Endocrinol 3:1470-1476 Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot M, Lane MD 1991 Transcriptional repression of the mouse insulin-responsive glucose transporter (GLUT4) gene by CAMP. Proc Nat1 Acad Sci USA 88:1933-1937 Cushman SW, Wardzala LJ 1980 Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell. J Biol Chem 255:4758-4762 Kono T, Robinson FW, Blevins TL, Ezaki 0 1982 Evidence that translocation of the glucose transport activity is the major mechanism of insulin action on glucose transport in fat cells. J Biol Chem 257:10942-10947 Baly DI, Horuk R 1987 Dissociation of insulin-stimulated glucose transport from the translocation of glucose carriers in rat adipose cells. J Biol Chem 262:21-24 Jones TLZ, Cushman SW 1989 Acute effects of cycloheximide on the translocation of glucose transporters in rat adipose cells. J Biol Chem 264:7874-7877
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 October 2015. at 04:08 For personal use only. No other uses without permission. . All rights reserved.
