Journal of Applied Microbiology ISSN 1364-5072
ORIGINAL ARTICLE
The regulated synthesis of a Bacillus anthracis spore coat protein that affects spore surface properties A. Aronson, B. Goodman and Z. Smith Department of Biological Sciences, Purdue University, West Lafayette, IN, USA
Keywords bacillus, coat, gene, hydrophobicity, regulation, spores, structure. Correspondence Arthur Aronson, Department of Biological Sciences, Purdue university, Lilly Hall, West Lafayette, IN 47907, USA. E-mail: [email protected] 2013/2317: received 18 November 2013, revised 22 December 2013 and accepted 3 January 2014 doi:10.1111/jam.12452
Abstract Aims: Examine the regulation of a spore coat protein and the effects on spore properties. Methods and Results: A c. 23 kDa band in coat/exosporial extracts of Bacillus anthracis Sterne spores varied in amount depending upon the conditions of sporulation. It was identified by MALDI as a likely orthologue of ExsB of Bacillus cereus. Little if any was present in an exosporial preparation with a location to the inner coat/cortex region established by spore fractionation and immunogold labelling of electron micrograph sections. Because of its predominant location in the inner coat, it has been renamed Cotc. It was relatively deficient in spores produced at 37°C and when acidic fermentation products were produced a difference attributable to transcriptional regulation. The deficiency or absence of Cotc resulted in a less robust exosporium positioned more closely to the coat. These spores were less hydrophobic and germinated somewhat more rapidly. Hydrophobicity and appearance were rescued in the deletion strain by introduction of the cotc gene. Conclusions: The deficiency or lack of a protein largely found in the inner coat altered spore hydrophobicity and surface appearance. Significance and Impact of the Study: The regulated synthesis of Cotc may be a paradigm for other spore coat proteins with unknown functions that modulate spore properties in response to environmental conditions.
Introduction The outermost components of Bacillus anthracis spores are comprised of a multilayered coat consisting of about 60–70 different proteins (Henriques and Moran 2007; McKenney and Eichenberger 2012) and what appears to be a loose fitting exosporium (Gerhardt and Ribi 1964). This latter structure is very prominent in the Bacillus cereus group of spores but not in Bacillus subtilis (Henriques and Moran 2007) which lacks homologues of many of the genes encoding exosporial proteins. There is, however, a surface glycoprotein in B. subtilis (Henriques and Moran 2007) that may have some similar functions. Some of the spore coat proteins are required for assembly, some for protection and others have direct or indirect roles in germination (Henriques and Moran 2007). A substantial number, however, have no known functions
because deletions of their genes did not result in a detectable phenotype, that is, altered coat structure in electron micrograph sections, change in germination or sensitivity to lysozyme or solvents. The exosporium consists of a basal structure with a hair-like nap (Gerhardt and Ribi 1964). The latter is comprised primarily of the BclA protein (Sylvestre et al. 2002; Steichen et al. 2003). Deletion of the bclA gene resulted in spores with a defective exosporium altered in hydrophobicity but without a significant change in infectivity for mice (Bozue et al. 2007a; Brahmbhatt et al. 2007). BclA does enhance the selective binding of spores to macrophages (Bozue et al. 2007b; Brahmbhatt et al. 2007) and dendritic cells that contain a Mac-1 receptor (Oliva et al. 2008). This selectivity may reduce or delay spore inactivation and thus prolong the infection process that would enhance the eventual yield of spores (Sylvestre et al. 2002;
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1241
Regulation of a spore coat protein
A. Aronson et al.
Todd et al. 2003; Brahmbhatt et al. 2007; Oliva et al. 2008). A number of other exosporial proteins have been identified (Redmond et al. 2004; Bailey-Smith et al. 2005; Steichen et al. 2005; Sylvestre et al. 2005; Boydston et al. 2006; Thompson et al. 2007; Giorno et al. 2009) with more subtle functions in structure or assembly. It is intriguing that close homologues of some B. subtilis spore coat proteins such as CotY/Z, and perhaps CotB are found in the exosporium of B. anthracis spores (Redmond et al. 2004; Johnson et al. 2006). An exosporial protein designated ExsY may be present in both the coat and exosporium (Redmond et al. 2004). The functions of these coat/exosporium proteins are not known, but the potential dual location implies an assembly, structural or functional relationship between the exosporium and the coat. A more specific example is CotE, which is required for proper assembly of the B. subtilis spore coat (Zheng et al. 1988) and is also involved in B. anthracis in the positioning of the exosporium around the spore (Giorno et al. 2007, 2009). This dual role suggests coordination in the assembly of the two layers and perhaps in various functions such as spore hydrophobicity. The exosporium also contains enzymes that are important for regulating germination and for providing protection to the spore during infection (Henriques and Moran 2007). In the course of examining the properties of coat/exosporial proteins extracted from spores produced under various conditions, it was noticed that the amount of a band of c. 23 kDa was media-dependent. The localization of this protein, designated Cotc, within the spore has been determined, its transcription examined and the properties of spores produced under conditions where the amount of Cotc varied or was absent have been studied. These results indicate a close interaction between the spore coat and the exosporium with significant consequences for spore properties. The regulation of the synthesis of a spore coat protein in response to environmental and/or nutritional conditions implies a flexibility in spore surface structure and may serve as a paradigm for the role of other coat proteins.
also at 37°C with 5% (v/v) CO2. Spores were harvested, washed and purified as previously described (Kim et al. 2004). They were stored at 20°C. Coat/exosporial fractions were obtained by extracting purified spores with 6 mmol l 1 urea, 1% (v/v) sodium dodecyl sulphate (SDS), 5 mmol l 1 dithiothreitol, 2 mmol l 1 phenymethyl sulfonate (PMSF), pH 100 (UDS), by resuspending the pellets from 1 ml spore suspensions at OD580nm = 14 in 12 ll of UDS. The suspensions were heated at 95°C for 3 min and then incubated at 37°C for 20 min. Following centrifugation in a microcentrifuge for 8 min, the extraction of the spore pellet was repeated. The supernatants were pooled and stored at 70°C. For the removal of the exosporium, 3 ml of spores suspended in water to OD580nm of 18 was passed through a French press three times at 20 000 psi and then centrifuged in a microcentrifuge for 4 min. The supernatant (crude exosporial fraction) was retained, and the pellets were washed twice with 15 ml each of distilled water prior to extraction with UDS as described previously. The supernatant was concentrated in a Speed Vac so that an amount equivalent to the spore extract could be analysed in SDS-PAGE. These extracts were fractionated in 12% SDS-PAGE for staining with Gelcode Blue (Pierce; Thermo-Fisher Scientific, Rockford, IL, USA), for immunoblotting with a monoclonal antibody to the major exosporial protein, BclA (Sylvestre et al. 2002) and/or rabbit antiserum to a peptide from the Cotc protein. The Cotc antiserum was produced by ProSci using as antigen a peptide from the carboxyl end of the protein (CKNKKFDHFWYKKR) coupled to bovine serum albumen. The rabbit antisera were purified by ammonium sulfate fractionation and elution from a protein A sepharose column (Zhang et al. 1993). In some cases, nitrocellulose blots were first treated with the anti-BclA monoclonal antibody, stripped by incubation in 6 mmol l 1 Tris, 20 g l 1 SDS, 100 mmol l 1 b-mercaptoethanol, pH 68 at 70°C for 30 min and then incubated with the anti-Cotc antiserum. For detection, a second antibody coupled to alkaline phosphatase (Promega, Madison, WI, USA) was used.
Materials and methods
Spore hydrophobicity
Spore production and fractionation Bacillus anthracis Sterne (34F2) was grown in LB, nutrient sporulation medium (NSM) (Schaeffer et al. 1963) or G (Aronson et al. 1971) media with the latter two used for sporulation. In some cases, the G medium was buffered more effectively with 50 mmol l 1 Tris, pH80 and is referred to as G/80. Cells were grown in either liquid with shaking (250 rpm in a New Brunswick G-24 incubator shaker) or on solid media at either 30 or 37°C and 1242
The hydrophobic property of spores was measured by partition into hexadecane (Koshikawa et al. 1989). One and one half millilitre of spores was suspended in water to OD580nm of 10. Then, 03 ml of hexadecane (SigmaAldrich, St. Louis, MO, USA) was added and the suspension vortexed twice for 30 s each. The vortexing was repeated after 30 min and when the phases had resolved, the OD580nm value of the aqueous phase determined. The % decrease in this value is reported as a measure of the hydrophobicity of the spores.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
Construction of lacZ fusions A region of 214 bp upstream of the cotc coding sequence was amplified by PCR with pfu polymerase using primers: 5′CCACTGCAGACATTGGATG containing a PstI site (in bold) and 5′GGAAAGGGATCCTTTTTCC containing a BamHI site (in bold). A shorter upstream fragment of 139 bp was amplified with the primer 5′GCACTTC TCCTTCTGCAGACATCCGC with a PstI site (in bold) plus the second primer listed above. An even shorter oligonucleotide of 91 bp was obtained with primer 5′GCA CTTCTCCTTCTGCAGACATCCGC also with a PstI site (in bold) plus the second primer as above. PCR fragments were purified with a Qiagen kit (Frederick, MD, USA), digested with the indicated restriction enzymes and then cloned into vector pHT304-18Z (Agaisse and Lereclus 1994) to construct transcriptional fusions to the lacZ gene. The final plasmids prepared in an E. coli dam strain (BW8695) were electroporated into the Sterne strain (Kim et al. 2004) with selection for resistance to 20 lg ml 1 erythromycin. Transformants were streaked onto LB plates containing 10 lg ml 1 4-methylumbelliferyl b-D-galactoside (MUG; Sigma-Aldrich) and the plasmids from fluorescent colonies screened by PCR with the above primers for confirmation of the fusions of the cotc promoter regions to the lacZ gene. As there was no fluorescence with the 90 bp fusion, this construct was confirmed by sequencing of the plasmid isolated from a Sterne transformant. For b-galactosidase assays, cells were inoculated into various media and grown as indicated previously for the times specified. Expression of the cotc gene with a promoter region (as shown in Fig. S1), which is identical to the confirmed sigma K promoter in Bacillus thuringiensis (Qu et al. 2013), was late so cultures were monitored for spore formation. When more than 90% of the cells contained phase white to phase bright endospores, samples were taken at hourly intervals until free spores had been released. The OD580nm values were determined, the cells pelleted at 10 000 g in a Sorvall SS34 rotor and stored at 70°C. Assays were as previously described and OD420nm/ OD580nm values for the original 1 ml cell suspensions determined (Gao et al. 2002). All experiments were repeated at least three times and values reported are one standard deviation. Deletion of the cotc gene A c. 245 kb fragment embracing the cotc gene was amplified with 5′ GTCGCATCATAAGCTTACGGTATCA CTTC containing a HindIII site in bold plus 5′ GGTTG TCGACTGGATACACGCAAGTGC with a SalI site in bold. The PCR product was first cloned into pUTE29 (Koehler et al. 1994) and recombinant plasmid isolated
Regulation of a spore coat protein
from E. coli DH5a. An internal fragment of c. 14 kb was then excised with Eag1 and SnaBIand the neomycinR cassette from pBEST501 (Itaya et al. 1989) as a Not1/Sma 113 kb fragment inserted. Following cloning in E. coli DH5a and subsequently in the dam- strain, the plasmid was introduced into B. anthracis Sterne by electroporation and selection on LB/tetracycline (10 lg ml 1) plates with confirmation on LB/neomycin (10 lg ml 1). Deletion of the cotc gene was confirmed in an immunoblot. For Cotc expression, the coding region plus the promoter (240 bp upstream) was amplified with primers 5′CCACTACGTACATTGGATG with a SnaBI site in bold and 5′GGCCGCAAAAAGGCCTTTTTTGTAGGG with a Stu1 site in bold. The PCR product of c. 830 bp was cloned into Escherichia coli PET100/D-TOPO, and then, a 780 bp fragment excised with Nhe1 and Stu1for cloning into the Xba1 and Sma1 sites of the shuttle vector, pHT315 (Arantes and Lereclus 1991). The insert sequence was confirmed and then introduced into the deletion strain as described above. Electron microscopy Spores of the Sterne strain produced in liquid or on plates of G and NSM at 30°C were fixed, sectioned, stained or incubated with gold labelled anti-Cotc antibody and examined in a FEI/Philips CM-10 Biotwin transmission electron microscope as previously described (Kim et al. 2004). Results Characterization of Cotc and conditions for variation In a comparison of the stained profiles of UDS extracts of spores produced in NSM versus G medium at 30°C, a band between 20 and 30 kDa was found to be weaker in extracts in the latter medium (Fig. 1). The band from the stained gel was eluted and identified by MALDI/TOFF as an orthologue of ExsB from B. cereus (Todd et al. 2003). They have the same genetic context and differ primarily in the presence of a seven amino acid deletion in the B. anthracis protein. ExsB/Cotc has also been indirectly identified in a B. anthracis exosporial fraction and was reported to contain a number of phosphorylated threonine residues (McPherson et al. 2010). The gene encoding Cotc contains 10% C codons and the protein extracted from spores lacks the first 17 amino acids expected from the gene sequence (protein sequence from B. anthracis Ames ancestor, AAT31159) as previously reported for the close homologue in B. cereus (Todd et al. 2003). The difference in staining intensity was confirmed in an immunoblot using antibody produced
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1243
Regulation of a spore coat protein
1
A. Aronson et al.
2
a strong signal for BclA antigen. These results imply a primary location for Cotc in the spore coat, and this was confirmed by examination of electron microscope sections of spores treated with immunogold labelled antiCotc antibody (Fig. 4). The vast majority of the labelling was over the inner coat/cortex region.
3
90
80
Transcription of the cotc gene 60
30
20
Figure 1 Stained SDS-PAGE of extracts from spores produced on plates at 30°C of either G medium (lane 2) or nutrient sporulation medium (NSM) (lane 3). Lane 1 is standards. Arrow points to a band in lane 3 between 20–30 kDa that was excised for sequencing.
against a Cotc peptide (Fig. 2), There was also a temperature effect with spores produced at 30°C containing relatively more Cotc antigen than those produced at 37°C. Predominant coat location for Cotc In extracts of spores produced in liquid NSM at 30°C, Cotc was not found in an immunoblot of a crude exosporial fraction produced by passage of spores through a French press (Fig. 3). While removal of the exosporium is incomplete by this procedure, this fraction did contain
To further investigate conditions influencing production of Cotc, regions of the gene 91, 139 and 214 bp upstream of the ATG codon were fused to the lacZ gene (see Fig. S1 for the sequence). Within these sequences, there was a possible promoter similar to the SigmaK consensus from B. subtilis, i.e., TTCA-16 bp-CATATCCC (highlighted in Fig. S1) versus the B. subtilis consensus of AC-16-18-CATAnnnT (Helmann and Moran 2002) and as mentioned above, is identical to the confirmed SigmaK promoter in B. thuringiensis (Qu et al. 2013). There was no expression of b-galactosidase from the fusion to 91 bp, whereas it was the same for fusions of 139 and 219 bp indicating that sequences between 91 and 139 bp upstream of the presumptive promoter are involved in the regulation of expression of the cotc gene (underlined in Fig. S1). The specific activity of the enzyme did not increase until very late in sporulation (B. Goodman, unpublished results) and was highest in cells sporulated in NSM liquid medium at 30°C (Fig. 5). The temperature effect was as shown in the immunoblot (Fig. 2). G and NSM are both complex media, but only the former contains glucose (usually 02%). There is a significant decrease in pH in media of cells grown in G (from 74 to 55 at the end of growth subsequently rising to 60) due to the production of acidic fermentation products. Further buffering of G medium with Tris, pH80, (G/80) or lowering the glucose concentration to 005% (pH 1
2
3
A
B 1
2
3
4
Figure 2 Immunoblot of extracts from spores produced on solid media treated with anti-Cotϒ antiserum. Lane 1, nutrient sporulation medium (NSM)/37°C; lane 2, G/37°C; lane 3, NSM/30°C; lane 4, G/30°C. Band in left lane is a standard of 30 kDa.
1244
Figure 3 Immunoblot of spore extracts treated initially with anti-BclA monoclonal antibody and then with anti-Cotc rabbit antiserum. Only the portions of the immunoblot containing the stained areas are shown (see Fig. S4 for a complete blot). Lane 1: extract from spores produced on nutrient sporulation medium (NSM) plates at 30°C; lane 2: extract from spores as in lane 1 but subjected three times to French press at 20 000 psi; lane 3: French press supernatant from spores in lane 2 (exosporial fraction). Band A is BclA and band B is Cotc. Two arrows on the left indicate positions of standards of 20 kDa (lower) and 30 kDa (upper) in the portion of the blot containing Cotc.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
Regulation of a spore coat protein
(a)
(b)
Figure 4 Localization of Cotc in spore sections by immunogold labelling with antiCotc antiserum. (a) spores produced on nutrient sporulation medium (NSM) plates at 30°C; (b) spores produced on G plates at 30°C. Two arrows on the left in (a) point to grains localized to inner coat/cortex region; the other arrow in A and the two arrows in B point to stained outer spore coat. The average difference in grain number per section (50 sections) was twofold. The micron bar applies to both A and B. There were no grains when preimmune serum was used.
1 µm
Table 1 Effect of glucose and pH on the maximum levels of expression of a cotc-lacZ fusion
0·300
Growth condition
Maximum b-galactosidasespecific activity*
G/30°C/liquid (02% glucose) G (no glucose)/30°C/liquid G (005% glucose)/30°C/liquid G/80/30°C/liquid (02% glucose)
0025 0107 0125 0090
B-Gal specific activity
0·250 0·200 0·150
0005 0020 0025 0021
0·100 *Fusion of 214 bp. Sampling as described in Materials and methods. Values are averages of three separate experiments 1 SD.
0·050 0·000 PI/30C
Liq/30C
PI/37C
Liq/37C
Figure 5 Maximum b-galactosidase-specific activities for a fusion of 214 bp upstream of cotc to lacZ in cells grown and sporulated in either liquid nutrient sporulation medium (NSM) or G medium (Liq) or on plates (Pl) at 30 and 37°C. Red is NSM; blue is G medium. Values plotted one SD for three independent experiments.
decreased only to 74 during sporulation) resulted in a greater amount of Cotc antigen in spore extracts (Fig. S2) as well as enhanced expression of a lacZ fusion (Table 1) indicating that it was the lower pH resulting from the fermentation of glucose that was critical for regulation. Spore morphology and hydrophobicity Spores produced in liquid G or NSM media at 30°C differed considerably in surface appearance (Fig. 6). The exosporium appeared to be more organized in NSM spores and well separated from the coat, whereas those in G medium had a closer interaction between the coat and exosporium. Some of these G medium spores either lacked an exosporium or it may be incomplete and are similar in appearance to a deletion mutant from NSM plates at 30°C (Fig. S3). These appear very similar or
identical to the exsB mutant reported by McPherson et al. (2010). Spores from G medium also differed from NSM spores in their partition into hexadecane; a range of 50–68% for the former versus 90–98% for the latter (Table 2). Mutant spores produced on NSM plates at 30°C also had a low hydrophobicity that was reversed by insertion of the cotc gene on a low copy number plasmid (Table 2). This difference implies that the more complete or ordered coat/exosporial structure (as in Fig. 6a) was important for hydrophobicity. Spores from a mutant lacking a major outer spore coat protein Kim et al. 2004) behaved in the partition assay as did the wild-type spores (A. Aronson, unpublished results) indicating that this protein was unlikely to have a significant role in any functional interaction between the coat and exosporium. Discussion Cotc is located primarily within the inner spore coat layers of the Sterne strain. There appears to be some overlap with the cortex, although this layer is considered to be exclusively peptidoglycan. Cotc is present in extracts of spores of a strain deficient in exosporia (Boydston et al. 2006) as well as one lacking a major outer spore coat
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1245
Regulation of a spore coat protein
(a)
A. Aronson et al.
(b)
1 µm
Table 2 Partition into hexadecane of spores prepared under various conditions
Spore preparation
% Partition into hexadecane*
Sterne/G plate/30°C Sterne/G liquid/30°C Sterne/G plate/37°C Sterne/G liquid/37°C Sterne/G/80/liquid/30°C Sterne/NSM plate/30°C Sterne/NSM liquid/30°C Sterne/NSM plate/37°C Sterne/NSM liquid/37°C D cotc spores/NSM liquid/37°C Dcotc/pHT315-cotc spores/NSM liquid/37°C
68 50 66 50 75 92 98 90 95 57 93
*As described in Materials and methods. Values are averages of three experiments (5%) employing different batches of spores for each assay.
protein, Cota (Kim et al. 2004; A. Aronson, unpublished results) so it is most likely to be one of the innermost components of the coat. An orthologue designated ExsB was found as a minor band in extracts of purified exosporia from B. cereus (Todd et al. 2003). It was also indirectly identified in exosporia from B. anthracis Sterne (McPherson et al. 2010). In the latter study, peptides corresponding to those in Cotc were present in a preparations from two mutants but not in the wild type unless special wash conditions were used. There was no indication whether this was a major or minor component of the exosporium. Many of the peptides within the ‘repeat region’ were phosphorylated at threonine residues. Neither of these reports was spores directly examined for this protein. It was also present in both an exosporial and coat fraction from B. cereus ATCC14579 spores (called coat protein G) but was much more prevalent in the latter (Abhyankar et al. 2013). A GFP fusion to the B. anthracis ExsB was 1246
Figure 6 Appearance of the spore coat and exosporium in electron micrograph sections of spores. (a) nutrient sporulation medium (NSM) liquid at 30°C and (b) G liquid at 30°C. In each case, about 100 spores were examined and these are representative.
found in the exosporium (McPherson et al. 2010) when overexpressed on a multicopy plasmid, but a signal from an inner coat location may not have been detected. In our immunological analysis, little if any Cotc was found in the exosporia (Fig. 3), but there was a strong signal from spore extracts (Figs 2 and 3) as well as localization to the inner coat by immunogold staining (Fig. 4). A BLAST search revealed no cross homology of Cotc to other B. anthracis spore coat proteins and thus no likely cross reacting antigen. Cotc/ExsB may be present in either small amounts or as a contaminant of the exosporium, but it is clearly prevalent in the inner spore coat. Interestingly, another presumptive exosporial protein, BxpA, was found by immunogold labelling of spore sections to be primarily in the inner coat/cortex region (Moody et al. 2010). In addition to the effects of Cotc on hydrophobicity and morphology, spores produced at 37°C in G medium germinated at 27°C without heat activation about twice as fast as those from NSM as judged by a decrease in OD580nm and examination in the phase microscope for phase dark spores. The difference for heat-activated spores was about 50% faster for the G medium spores (A. Aronson, unpublished). Given these correlations, it would appear that Cotc contributes to a structural/functional interdependence between the coat and exosporium. Other proteins, such as ExsK, that may be present in part in the space between the coat and exosporium (Severson et al. 2009) could also contribute to this interaction. If there were a functional interaction, it is unlikely to involve the major outer coat protein, Cota, as mentioned above, spores lacking this protein have the same hydrophobic properties when produced in G or NSM media as wild-type spores. The difference in appearance of the exosporium in G versus NSM media with the former very similar to those with a deletion in the cotc/exsB gene could also have a role in the accessibility of enzymes known to be present in the exosporium. At least one
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
enzyme was absent in B. anthracis spores lacking ExsB (McPherson et al. 2010), and this could affect properties such as germination and infectivity. Cotc is synthesized late in sporulation and the expression of the gene appears to require 79 bp to 139 bp upstream of a sigmaK promoter (Qu et al. 2013; Fig. S1). GerE may also be involved in regulation as it is in B. thuringiensis (Qu et al. 2013). The very late synthesis of an inner spore coat protein, at about the same time as that of a major outer coat protein, Cota (A. Aronson, unpublished), and somewhat later than the major exosporial protein, BclA (Fig. S4) indicates that progression of assembly of the multiple layers of the coat proceed simultaneously consistent with results reported for B. subtilis (McKenney and Eichenberger 2012). Extensive disulfide bond formation for Cotc is likely given the oxidizing conditions present in late sporulating cells and the high content of C residues (10%). Such cross-linking and the extensive phosphorylation of threonine residues (McPherson et al. 2010) imply an unusually compact negatively charged protein that may contribute to a unique role in regulating the interaction of the coat and exosporium. There are other examples of either media or temperature affecting the expression of a coat gene or coat protein composition. Transcription of a cotC-lacZ fusion in B. subtilis varied with the medium, but no correlation to spore structure was presented (Zheng and Losick 1990). Bacillus subtilis spore coat composition varies with the temperature of sporulation (Melly et al. 2002) but again, no correlation with spore properties was reported. In the present study, the regulated synthesis or absence of Cotc correlates with the morphology and hydrophobic properties of spores (Table 2; Fig. 6). These phenotypic properties were corrected by introducing the cotc gene into the mutant on a low copy number plasmid. The proposed function for Cotc in the localization and perhaps intactness of the exosporium is consistent with its absence in B. subtilis which lacks a well defined exosporium. It is intriguing that the transcription of a spore protein synthesized very late in the sporulation process, i.e., essentially at the time of dehydration of the spore core and completion of the spore coat layers, is regulated by external factors such as liquid/solid media, temperature and pH. Each of these could contribute to the same metabolic changes within the sporulating cell which serve either directly or indirectly as the signal for repression of the cotc gene. The pH decrease is due to the exhaustion of glucose in the medium with accumulation of acidic fermentation products such as acetic and lactic acids. These fermentation products are utilized slowly during sporulation so the exact nature of the carbon compounds still present very late in sporulation is not known.
Regulation of a spore coat protein
Addition during sporulation of sodium acetate and sodium lactate each to a final concentration of 1% did result in a twofold inhibition of expression of the cotclacZ fusion and of spores with reduced hydrophobicity (A. Aronson, unpublished results). One possible explanation for this regulated synthesis is that the less hydrophobic spores resulting from the absence of Cotc could not be easily dispersed nor readily attach to the substratum. If the metabolic signal for repression were organic acids in the immediate environment, then these would be available for germination and growth. Exhaustion of the organic acids would result in derepression of the cotc gene in newly sporulating cells and the formation of spores with a more ordered exosporium/coat and thus a greater hydrophobicity. The ability to more readily disperse or attach could enhance spore deposition in nutrient-rich environments or even a higher probability of uptake by a host. If the latter, these spores would have the complete array of exosporial enzymes available to contribute to spore survival following infection. It is known that Bacillus spore coats are complex and contain between sixty to seventy different species of proteins (Henriques and Moran 2007). Some of these are involved in coat assembly and others contribute to protection (Giorno et al. 2007; McKenney and Eichenberger 2012). Some are involved in the germination response perhaps by allowing germinants to reach critical sites in the inner spore membrane or in the positioning of spore cortex lytic enzymes. Many, however, with no established functions, could be involved in the adaptation of spores to environmental conditions. If so, a further examination of the regulation of synthesis of these spore coat proteins may help to establish the basis for the complexity of this structure. Acknowledgements Dr. J. Kearney generously provided the monoclonal antibody to the BclA protein. D. Sherman and C.-P. Huang, Purdue Life Science microscopy Facility, performed the electron microscope experiments. Conflicts of interest There are no conflicts of interest. References Abhyankar, W., Hossain, A.H., Djajasaputra, A., Permpoonpattana, P., Ter Beek, A., Dekker, H.L., Cutting, S.M., Brul, S. et al. (2013) In pursuit of protein targets: Proteomic characterization of bacterial spore outer layers. J Proteome Res 12, 4507–4521.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1247
Regulation of a spore coat protein
A. Aronson et al.
Agaisse, H. and Lereclus, D. (1994) Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Mol Microbiol 13, 97–107. Arantes, O. and Lereclus, D. (1991) Construction of cloning vectors for Bacillus thuringiensis. Gene 108, 115–119. Aronson, A.I., Angelo, N. and Holt, S.C. (1971) Regulation of extracellular protease production in Bacillus cereus T: characterization of mutants producing altered amounts of protease. J Bacteriol 106, 1016–1025. Bailey-Smith, K., Todd, S.J., Southworth, T.W., Proctor, J. and Moir, A. (2005) The ExsA protein of Bacillus cereus is required for assembly of coat and exosporium onto the spore surface. J Bacteriol 187, 3800–3806. Boydston, J.A., Yue, L., Kearney, J.F. and Turnbough, C.L. Jr (2006) The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. J Bacteriol 188, 7440–7448. Bozue, J., Cote, C.K., Moody, K.L. and Welkos, S.L. (2007a) Fully virulent Bacillus anthracis does not require the immunodominant protein BclA for pathogenesis. Infect Immun 75, 508–511. Bozue, J., Moody, K.L., Cote, C.K., Stiles, B.G., Friedlander, A.M., Welkos, S.L. and Hale, M.L. (2007b) Bacillus anthracis spores of the bclA mutant exhibit increased adherence to epithelial cells, fibroblasts and endothelial cells but not to macrophages. Infect Immun 75, 4498–4505. Brahmbhatt, T.N., Janes, B.K., Stibitz, E.S., Darnell, S.C., Sanz, P., Rasmussen, S.B. and O’Brien, A.D. (2007) Bacillus anthracis exosporium protein BclA affects spore germination, interaction with extracellular matrix proteins, and hydrophobicity. Infect Immun 75, 5233–5239. Gao, H., Jiang, X., Pogliano, K. and Aronson, A.I. (2002) The E1b and E2 subunits of the Bacillus subtilis pyruvate dehydrogenase complex are involved in regulation of sporulation. J Bacteriol 184, 2780–2788. Gerhardt, P. and Ribi, E. (1964) Ultrastructure of the exosporium enveloping spores of Bacillus cereus. J Bacteriol 88, 1174–1189. Giorno, R., Bozue, R., Cote, J., Wenzel, C., Moody, T., Mallozzi, K.S., Ryan, M., Wang, R. et al. (2007) Morphogenesis of the Bacillus anthracis spore. J Bacteriol 189, 691–705. Giorno, R., Mallozzi, M., Bozue, J., Moody, K.-S., slack, A., Qui, D., Wang, R., Friedlander, A. et al. (2009) Localization and assembly of proteins comprising the outer structures of the Bacillus anthracis spore. Microbiology 155, 1133–1145. Helmann, J.D. and Moran, C.P. Jr (2002). RNA polymerase and sigma factors. In A Bacillus subtilis and its closest relatives: from genes to cells ed. Sonenshein, A.L., Hoch, J.A. and Losick, R. pp. 289–312. Washington, DC; ASM Press. Henriques, A.O. and Moran, C.P. Jr (2007) Structure, assembly, and function of the spore surface layers. Ann Rev Microbiol 61, 555–588.
1248
Itaya, M., Kondo, K. and Tanaka, T. (1989) A neomycin resistance gene cassette selectable in a single copy state in the Bacillus subtilis chromosome. Nucleic Acid Res 17, 4410. Johnson, M.J., Todd, S.J., Ball, D.A., Shepherd, A.M., Sylvestre, P. and Moir, A. (2006) ExsY and CotY are required for the correct assembly of the exosporium and spore coat of Bacillus cereus. J Bacteriol 188, 7905–7913. Kim, H.-S., Sherman, D., Johnson, F. and Aronson, A.I. (2004) Characterization of a major Bacillus anthracis spore coat protein and its role in spore inactivation. J Bacteriol 186, 2413–2417. Koehler, T.M., Dai, Z. and Yarbray, M.K. (1994) Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription form one of two promoters. J Bacteriol 176, 586–595. Koshikawa, T., Yamazaki, M., Yoshimi, M., Ogawa, S., Yamada, A., Watabe, K. and Torii, M. (1989) Surface hydrophobicity of the spores of Bacillus spp. J Gen Microbiol 135, 2717–2722. McKenney, P.T. and Eichenberger, P. (2012) Dynamics of spore coat morphogenesis in Bacillus subtilis. Mol Microbiol 83, 245–260. McPherson, S.A., Li, M., Kearney, J.F. and Turnbough, C.L. Jr (2010) ExsB, an unusually highly phosphorylated protein required for the stable attachment of the exosporium of Bacillus anthracis. Mol Microbiol 76, 1527–1538. Melly, E., Genest, P.C., Gilmore, M.E., Little, S., Popham, D., Driks, A. and Setlow, P. (2002) Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. J Appl Microbiol 92, 1105–1115. Moody, K.L., Driks, A., Rother, G.L., Cote, C.K., Brueggemann, E.E., Hines, H.B., Friedlander, A.M. and Bozue, J. (2010) Processing, assembly and localization of a Bacillus anthracis spore protein. Microbiology 156, 174–183. Oliva, C.R., Swiecki, M.K., Griguer, C.E., Lisanby, M.W., Bullard, D.C., Turnbough, C.L. Jr and Kearney, J.F. (2008) The integrin Mac-1 (CR3) mediated internalization and directs Bacillus anthracis spores into professional phagocytes. Proc Natl Acad Sci USA 105, 1261–1266. Qu, N., Peng, Q., Qui, L., Liu, C., Chen, Z., Zhang, J., Song, F. and Li, j. (2013) Transcriptional regulation of exosporium basal layer structural gene exsB in Bacillus thuringiensis by SigmaK and GerE. Abstract PMID 23678570 Redmond, C., Baillie, L.W.J., Hibbs, S., Moir, A.J.G. and Moir, A. (2004) Identification of proteins in the exosporium of Bacillus anthracis. Microbiology 150, 355–363. Schaeffer, P., Ionesco, H., Ryter, A. and Balassa, G. (1963) La sporulation de Bacillus subtilis: etude genetique et physiologique. Colloq Int CNRS 124, 553–563. Severson, K.M., Mallozzi, M., Bozue, J., Welkos, S.L., Cote, C.K., Knight, K.L. and Driks, A. (2009) Roles of the Bacillus anthracis spore protein ExsK in exosporium maturation and germination. J Bacteriol 191, 7587–7596. Steichen, C., Chen, P., Kearney, J.F. and Turnbough, C.L. Jr (2003) Identification of the immunodominant protein
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
and other proteins of the Bacillus anthracis exosporium. J Bacteriol 185, 1903–1910. Steichen, C.T., Kearney, J.F. and Turnbough, C.L. Jr (2005) Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. J Bacteriol 187, 5868–5876. Sylvestre, P., Couture-Tosi, E. and Mock, M. (2002) A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol Microbiol 45, 69–178. Sylvestre, P., Couture-Tosi, E. and Mock, M. (2005) Contribution of ExsFA and ExsFB proteins to the localization of BclA on the spore surface and to the stability of the Bacillus anthracis exosporium. J Bacteriol 187, 5122–5128. Thompson, B.M., Waller, L.N., Fox, K.F., Fox, A. and Stewart, G.C. (2007) The BclB glycoprotein of Bacillus anthracis is involved in exosporium integrity. J Bacteriol 189, 6704–6713. Todd, S.J., Moir, J.G., Johnson, M.J. and Moir, A. (2003) Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J Bacteriol 185, 3373–3378. Zhang, J., Fitz-James, P.C. and Aronson, A.I. (1993) Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. J Bacteriol 175, 3757–3766. Zheng, L. and Losick, R. (1990) Cascade regulation of spore coat gene expression in Bacillus subtilis. J Mol Biol 212, 645–660. Zheng, L., Donovan, W.P., Fitz-James, P.C. and Losick, R. (1988) Gene encoding a morphogenetic protein required in the assembly of the outer coat of the Bacillus subtilis endospore. Genes Dev 2, 1047–1054.
Regulation of a spore coat protein
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Sequence upstream of the monocistronic cotc gene. Sequences in bold are the presumptive sigmaK promoter. Underlined region is essential for expression of the gene. The upstream region is from the Bacillus anthracis Ames ancestor sequence, NC_007530.2; the coding region for the Cotc protein may be obtained in AAT31159 Figure S2 Immunoblot of extracts of spores produced in liquid media: G/8 at 30°C (lane 1); G at 30°C (lane 2); nutrient sporulation medium (NSM) at 37°C (lane 3); and NSM at 30°C (lane 4). STD are standards of 20 and 30 kDa. Figure S3 EM sections of spores produced on nutrient sporulation medium (NSM) plates at 30°C. Left frame is wild type; right frame is Dcotc strain. Compare to Fig. 6. Figure S4 Immunoblot with anti-BclA antibody and then with anti-Cotc antibody of sporulating cell extracts harvested when atleast 50% of the cells contained phase white endospores (lane 1) and then 60 and 120 min later (lanes 2 & 3). STD are standards of 220, 120, 100, 80, 60, 50 40, 30, 20 kDa from top to bottom. Arrow A points to BclA antigen; arrow B to Cotc antigen.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1249
ORIGINAL ARTICLE
The regulated synthesis of a Bacillus anthracis spore coat protein that affects spore surface properties A. Aronson, B. Goodman and Z. Smith Department of Biological Sciences, Purdue University, West Lafayette, IN, USA
Keywords bacillus, coat, gene, hydrophobicity, regulation, spores, structure. Correspondence Arthur Aronson, Department of Biological Sciences, Purdue university, Lilly Hall, West Lafayette, IN 47907, USA. E-mail: [email protected] 2013/2317: received 18 November 2013, revised 22 December 2013 and accepted 3 January 2014 doi:10.1111/jam.12452
Abstract Aims: Examine the regulation of a spore coat protein and the effects on spore properties. Methods and Results: A c. 23 kDa band in coat/exosporial extracts of Bacillus anthracis Sterne spores varied in amount depending upon the conditions of sporulation. It was identified by MALDI as a likely orthologue of ExsB of Bacillus cereus. Little if any was present in an exosporial preparation with a location to the inner coat/cortex region established by spore fractionation and immunogold labelling of electron micrograph sections. Because of its predominant location in the inner coat, it has been renamed Cotc. It was relatively deficient in spores produced at 37°C and when acidic fermentation products were produced a difference attributable to transcriptional regulation. The deficiency or absence of Cotc resulted in a less robust exosporium positioned more closely to the coat. These spores were less hydrophobic and germinated somewhat more rapidly. Hydrophobicity and appearance were rescued in the deletion strain by introduction of the cotc gene. Conclusions: The deficiency or lack of a protein largely found in the inner coat altered spore hydrophobicity and surface appearance. Significance and Impact of the Study: The regulated synthesis of Cotc may be a paradigm for other spore coat proteins with unknown functions that modulate spore properties in response to environmental conditions.
Introduction The outermost components of Bacillus anthracis spores are comprised of a multilayered coat consisting of about 60–70 different proteins (Henriques and Moran 2007; McKenney and Eichenberger 2012) and what appears to be a loose fitting exosporium (Gerhardt and Ribi 1964). This latter structure is very prominent in the Bacillus cereus group of spores but not in Bacillus subtilis (Henriques and Moran 2007) which lacks homologues of many of the genes encoding exosporial proteins. There is, however, a surface glycoprotein in B. subtilis (Henriques and Moran 2007) that may have some similar functions. Some of the spore coat proteins are required for assembly, some for protection and others have direct or indirect roles in germination (Henriques and Moran 2007). A substantial number, however, have no known functions
because deletions of their genes did not result in a detectable phenotype, that is, altered coat structure in electron micrograph sections, change in germination or sensitivity to lysozyme or solvents. The exosporium consists of a basal structure with a hair-like nap (Gerhardt and Ribi 1964). The latter is comprised primarily of the BclA protein (Sylvestre et al. 2002; Steichen et al. 2003). Deletion of the bclA gene resulted in spores with a defective exosporium altered in hydrophobicity but without a significant change in infectivity for mice (Bozue et al. 2007a; Brahmbhatt et al. 2007). BclA does enhance the selective binding of spores to macrophages (Bozue et al. 2007b; Brahmbhatt et al. 2007) and dendritic cells that contain a Mac-1 receptor (Oliva et al. 2008). This selectivity may reduce or delay spore inactivation and thus prolong the infection process that would enhance the eventual yield of spores (Sylvestre et al. 2002;
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1241
Regulation of a spore coat protein
A. Aronson et al.
Todd et al. 2003; Brahmbhatt et al. 2007; Oliva et al. 2008). A number of other exosporial proteins have been identified (Redmond et al. 2004; Bailey-Smith et al. 2005; Steichen et al. 2005; Sylvestre et al. 2005; Boydston et al. 2006; Thompson et al. 2007; Giorno et al. 2009) with more subtle functions in structure or assembly. It is intriguing that close homologues of some B. subtilis spore coat proteins such as CotY/Z, and perhaps CotB are found in the exosporium of B. anthracis spores (Redmond et al. 2004; Johnson et al. 2006). An exosporial protein designated ExsY may be present in both the coat and exosporium (Redmond et al. 2004). The functions of these coat/exosporium proteins are not known, but the potential dual location implies an assembly, structural or functional relationship between the exosporium and the coat. A more specific example is CotE, which is required for proper assembly of the B. subtilis spore coat (Zheng et al. 1988) and is also involved in B. anthracis in the positioning of the exosporium around the spore (Giorno et al. 2007, 2009). This dual role suggests coordination in the assembly of the two layers and perhaps in various functions such as spore hydrophobicity. The exosporium also contains enzymes that are important for regulating germination and for providing protection to the spore during infection (Henriques and Moran 2007). In the course of examining the properties of coat/exosporial proteins extracted from spores produced under various conditions, it was noticed that the amount of a band of c. 23 kDa was media-dependent. The localization of this protein, designated Cotc, within the spore has been determined, its transcription examined and the properties of spores produced under conditions where the amount of Cotc varied or was absent have been studied. These results indicate a close interaction between the spore coat and the exosporium with significant consequences for spore properties. The regulation of the synthesis of a spore coat protein in response to environmental and/or nutritional conditions implies a flexibility in spore surface structure and may serve as a paradigm for the role of other coat proteins.
also at 37°C with 5% (v/v) CO2. Spores were harvested, washed and purified as previously described (Kim et al. 2004). They were stored at 20°C. Coat/exosporial fractions were obtained by extracting purified spores with 6 mmol l 1 urea, 1% (v/v) sodium dodecyl sulphate (SDS), 5 mmol l 1 dithiothreitol, 2 mmol l 1 phenymethyl sulfonate (PMSF), pH 100 (UDS), by resuspending the pellets from 1 ml spore suspensions at OD580nm = 14 in 12 ll of UDS. The suspensions were heated at 95°C for 3 min and then incubated at 37°C for 20 min. Following centrifugation in a microcentrifuge for 8 min, the extraction of the spore pellet was repeated. The supernatants were pooled and stored at 70°C. For the removal of the exosporium, 3 ml of spores suspended in water to OD580nm of 18 was passed through a French press three times at 20 000 psi and then centrifuged in a microcentrifuge for 4 min. The supernatant (crude exosporial fraction) was retained, and the pellets were washed twice with 15 ml each of distilled water prior to extraction with UDS as described previously. The supernatant was concentrated in a Speed Vac so that an amount equivalent to the spore extract could be analysed in SDS-PAGE. These extracts were fractionated in 12% SDS-PAGE for staining with Gelcode Blue (Pierce; Thermo-Fisher Scientific, Rockford, IL, USA), for immunoblotting with a monoclonal antibody to the major exosporial protein, BclA (Sylvestre et al. 2002) and/or rabbit antiserum to a peptide from the Cotc protein. The Cotc antiserum was produced by ProSci using as antigen a peptide from the carboxyl end of the protein (CKNKKFDHFWYKKR) coupled to bovine serum albumen. The rabbit antisera were purified by ammonium sulfate fractionation and elution from a protein A sepharose column (Zhang et al. 1993). In some cases, nitrocellulose blots were first treated with the anti-BclA monoclonal antibody, stripped by incubation in 6 mmol l 1 Tris, 20 g l 1 SDS, 100 mmol l 1 b-mercaptoethanol, pH 68 at 70°C for 30 min and then incubated with the anti-Cotc antiserum. For detection, a second antibody coupled to alkaline phosphatase (Promega, Madison, WI, USA) was used.
Materials and methods
Spore hydrophobicity
Spore production and fractionation Bacillus anthracis Sterne (34F2) was grown in LB, nutrient sporulation medium (NSM) (Schaeffer et al. 1963) or G (Aronson et al. 1971) media with the latter two used for sporulation. In some cases, the G medium was buffered more effectively with 50 mmol l 1 Tris, pH80 and is referred to as G/80. Cells were grown in either liquid with shaking (250 rpm in a New Brunswick G-24 incubator shaker) or on solid media at either 30 or 37°C and 1242
The hydrophobic property of spores was measured by partition into hexadecane (Koshikawa et al. 1989). One and one half millilitre of spores was suspended in water to OD580nm of 10. Then, 03 ml of hexadecane (SigmaAldrich, St. Louis, MO, USA) was added and the suspension vortexed twice for 30 s each. The vortexing was repeated after 30 min and when the phases had resolved, the OD580nm value of the aqueous phase determined. The % decrease in this value is reported as a measure of the hydrophobicity of the spores.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
Construction of lacZ fusions A region of 214 bp upstream of the cotc coding sequence was amplified by PCR with pfu polymerase using primers: 5′CCACTGCAGACATTGGATG containing a PstI site (in bold) and 5′GGAAAGGGATCCTTTTTCC containing a BamHI site (in bold). A shorter upstream fragment of 139 bp was amplified with the primer 5′GCACTTC TCCTTCTGCAGACATCCGC with a PstI site (in bold) plus the second primer listed above. An even shorter oligonucleotide of 91 bp was obtained with primer 5′GCA CTTCTCCTTCTGCAGACATCCGC also with a PstI site (in bold) plus the second primer as above. PCR fragments were purified with a Qiagen kit (Frederick, MD, USA), digested with the indicated restriction enzymes and then cloned into vector pHT304-18Z (Agaisse and Lereclus 1994) to construct transcriptional fusions to the lacZ gene. The final plasmids prepared in an E. coli dam strain (BW8695) were electroporated into the Sterne strain (Kim et al. 2004) with selection for resistance to 20 lg ml 1 erythromycin. Transformants were streaked onto LB plates containing 10 lg ml 1 4-methylumbelliferyl b-D-galactoside (MUG; Sigma-Aldrich) and the plasmids from fluorescent colonies screened by PCR with the above primers for confirmation of the fusions of the cotc promoter regions to the lacZ gene. As there was no fluorescence with the 90 bp fusion, this construct was confirmed by sequencing of the plasmid isolated from a Sterne transformant. For b-galactosidase assays, cells were inoculated into various media and grown as indicated previously for the times specified. Expression of the cotc gene with a promoter region (as shown in Fig. S1), which is identical to the confirmed sigma K promoter in Bacillus thuringiensis (Qu et al. 2013), was late so cultures were monitored for spore formation. When more than 90% of the cells contained phase white to phase bright endospores, samples were taken at hourly intervals until free spores had been released. The OD580nm values were determined, the cells pelleted at 10 000 g in a Sorvall SS34 rotor and stored at 70°C. Assays were as previously described and OD420nm/ OD580nm values for the original 1 ml cell suspensions determined (Gao et al. 2002). All experiments were repeated at least three times and values reported are one standard deviation. Deletion of the cotc gene A c. 245 kb fragment embracing the cotc gene was amplified with 5′ GTCGCATCATAAGCTTACGGTATCA CTTC containing a HindIII site in bold plus 5′ GGTTG TCGACTGGATACACGCAAGTGC with a SalI site in bold. The PCR product was first cloned into pUTE29 (Koehler et al. 1994) and recombinant plasmid isolated
Regulation of a spore coat protein
from E. coli DH5a. An internal fragment of c. 14 kb was then excised with Eag1 and SnaBIand the neomycinR cassette from pBEST501 (Itaya et al. 1989) as a Not1/Sma 113 kb fragment inserted. Following cloning in E. coli DH5a and subsequently in the dam- strain, the plasmid was introduced into B. anthracis Sterne by electroporation and selection on LB/tetracycline (10 lg ml 1) plates with confirmation on LB/neomycin (10 lg ml 1). Deletion of the cotc gene was confirmed in an immunoblot. For Cotc expression, the coding region plus the promoter (240 bp upstream) was amplified with primers 5′CCACTACGTACATTGGATG with a SnaBI site in bold and 5′GGCCGCAAAAAGGCCTTTTTTGTAGGG with a Stu1 site in bold. The PCR product of c. 830 bp was cloned into Escherichia coli PET100/D-TOPO, and then, a 780 bp fragment excised with Nhe1 and Stu1for cloning into the Xba1 and Sma1 sites of the shuttle vector, pHT315 (Arantes and Lereclus 1991). The insert sequence was confirmed and then introduced into the deletion strain as described above. Electron microscopy Spores of the Sterne strain produced in liquid or on plates of G and NSM at 30°C were fixed, sectioned, stained or incubated with gold labelled anti-Cotc antibody and examined in a FEI/Philips CM-10 Biotwin transmission electron microscope as previously described (Kim et al. 2004). Results Characterization of Cotc and conditions for variation In a comparison of the stained profiles of UDS extracts of spores produced in NSM versus G medium at 30°C, a band between 20 and 30 kDa was found to be weaker in extracts in the latter medium (Fig. 1). The band from the stained gel was eluted and identified by MALDI/TOFF as an orthologue of ExsB from B. cereus (Todd et al. 2003). They have the same genetic context and differ primarily in the presence of a seven amino acid deletion in the B. anthracis protein. ExsB/Cotc has also been indirectly identified in a B. anthracis exosporial fraction and was reported to contain a number of phosphorylated threonine residues (McPherson et al. 2010). The gene encoding Cotc contains 10% C codons and the protein extracted from spores lacks the first 17 amino acids expected from the gene sequence (protein sequence from B. anthracis Ames ancestor, AAT31159) as previously reported for the close homologue in B. cereus (Todd et al. 2003). The difference in staining intensity was confirmed in an immunoblot using antibody produced
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1243
Regulation of a spore coat protein
1
A. Aronson et al.
2
a strong signal for BclA antigen. These results imply a primary location for Cotc in the spore coat, and this was confirmed by examination of electron microscope sections of spores treated with immunogold labelled antiCotc antibody (Fig. 4). The vast majority of the labelling was over the inner coat/cortex region.
3
90
80
Transcription of the cotc gene 60
30
20
Figure 1 Stained SDS-PAGE of extracts from spores produced on plates at 30°C of either G medium (lane 2) or nutrient sporulation medium (NSM) (lane 3). Lane 1 is standards. Arrow points to a band in lane 3 between 20–30 kDa that was excised for sequencing.
against a Cotc peptide (Fig. 2), There was also a temperature effect with spores produced at 30°C containing relatively more Cotc antigen than those produced at 37°C. Predominant coat location for Cotc In extracts of spores produced in liquid NSM at 30°C, Cotc was not found in an immunoblot of a crude exosporial fraction produced by passage of spores through a French press (Fig. 3). While removal of the exosporium is incomplete by this procedure, this fraction did contain
To further investigate conditions influencing production of Cotc, regions of the gene 91, 139 and 214 bp upstream of the ATG codon were fused to the lacZ gene (see Fig. S1 for the sequence). Within these sequences, there was a possible promoter similar to the SigmaK consensus from B. subtilis, i.e., TTCA-16 bp-CATATCCC (highlighted in Fig. S1) versus the B. subtilis consensus of AC-16-18-CATAnnnT (Helmann and Moran 2002) and as mentioned above, is identical to the confirmed SigmaK promoter in B. thuringiensis (Qu et al. 2013). There was no expression of b-galactosidase from the fusion to 91 bp, whereas it was the same for fusions of 139 and 219 bp indicating that sequences between 91 and 139 bp upstream of the presumptive promoter are involved in the regulation of expression of the cotc gene (underlined in Fig. S1). The specific activity of the enzyme did not increase until very late in sporulation (B. Goodman, unpublished results) and was highest in cells sporulated in NSM liquid medium at 30°C (Fig. 5). The temperature effect was as shown in the immunoblot (Fig. 2). G and NSM are both complex media, but only the former contains glucose (usually 02%). There is a significant decrease in pH in media of cells grown in G (from 74 to 55 at the end of growth subsequently rising to 60) due to the production of acidic fermentation products. Further buffering of G medium with Tris, pH80, (G/80) or lowering the glucose concentration to 005% (pH 1
2
3
A
B 1
2
3
4
Figure 2 Immunoblot of extracts from spores produced on solid media treated with anti-Cotϒ antiserum. Lane 1, nutrient sporulation medium (NSM)/37°C; lane 2, G/37°C; lane 3, NSM/30°C; lane 4, G/30°C. Band in left lane is a standard of 30 kDa.
1244
Figure 3 Immunoblot of spore extracts treated initially with anti-BclA monoclonal antibody and then with anti-Cotc rabbit antiserum. Only the portions of the immunoblot containing the stained areas are shown (see Fig. S4 for a complete blot). Lane 1: extract from spores produced on nutrient sporulation medium (NSM) plates at 30°C; lane 2: extract from spores as in lane 1 but subjected three times to French press at 20 000 psi; lane 3: French press supernatant from spores in lane 2 (exosporial fraction). Band A is BclA and band B is Cotc. Two arrows on the left indicate positions of standards of 20 kDa (lower) and 30 kDa (upper) in the portion of the blot containing Cotc.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
Regulation of a spore coat protein
(a)
(b)
Figure 4 Localization of Cotc in spore sections by immunogold labelling with antiCotc antiserum. (a) spores produced on nutrient sporulation medium (NSM) plates at 30°C; (b) spores produced on G plates at 30°C. Two arrows on the left in (a) point to grains localized to inner coat/cortex region; the other arrow in A and the two arrows in B point to stained outer spore coat. The average difference in grain number per section (50 sections) was twofold. The micron bar applies to both A and B. There were no grains when preimmune serum was used.
1 µm
Table 1 Effect of glucose and pH on the maximum levels of expression of a cotc-lacZ fusion
0·300
Growth condition
Maximum b-galactosidasespecific activity*
G/30°C/liquid (02% glucose) G (no glucose)/30°C/liquid G (005% glucose)/30°C/liquid G/80/30°C/liquid (02% glucose)
0025 0107 0125 0090
B-Gal specific activity
0·250 0·200 0·150
0005 0020 0025 0021
0·100 *Fusion of 214 bp. Sampling as described in Materials and methods. Values are averages of three separate experiments 1 SD.
0·050 0·000 PI/30C
Liq/30C
PI/37C
Liq/37C
Figure 5 Maximum b-galactosidase-specific activities for a fusion of 214 bp upstream of cotc to lacZ in cells grown and sporulated in either liquid nutrient sporulation medium (NSM) or G medium (Liq) or on plates (Pl) at 30 and 37°C. Red is NSM; blue is G medium. Values plotted one SD for three independent experiments.
decreased only to 74 during sporulation) resulted in a greater amount of Cotc antigen in spore extracts (Fig. S2) as well as enhanced expression of a lacZ fusion (Table 1) indicating that it was the lower pH resulting from the fermentation of glucose that was critical for regulation. Spore morphology and hydrophobicity Spores produced in liquid G or NSM media at 30°C differed considerably in surface appearance (Fig. 6). The exosporium appeared to be more organized in NSM spores and well separated from the coat, whereas those in G medium had a closer interaction between the coat and exosporium. Some of these G medium spores either lacked an exosporium or it may be incomplete and are similar in appearance to a deletion mutant from NSM plates at 30°C (Fig. S3). These appear very similar or
identical to the exsB mutant reported by McPherson et al. (2010). Spores from G medium also differed from NSM spores in their partition into hexadecane; a range of 50–68% for the former versus 90–98% for the latter (Table 2). Mutant spores produced on NSM plates at 30°C also had a low hydrophobicity that was reversed by insertion of the cotc gene on a low copy number plasmid (Table 2). This difference implies that the more complete or ordered coat/exosporial structure (as in Fig. 6a) was important for hydrophobicity. Spores from a mutant lacking a major outer spore coat protein Kim et al. 2004) behaved in the partition assay as did the wild-type spores (A. Aronson, unpublished results) indicating that this protein was unlikely to have a significant role in any functional interaction between the coat and exosporium. Discussion Cotc is located primarily within the inner spore coat layers of the Sterne strain. There appears to be some overlap with the cortex, although this layer is considered to be exclusively peptidoglycan. Cotc is present in extracts of spores of a strain deficient in exosporia (Boydston et al. 2006) as well as one lacking a major outer spore coat
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1245
Regulation of a spore coat protein
(a)
A. Aronson et al.
(b)
1 µm
Table 2 Partition into hexadecane of spores prepared under various conditions
Spore preparation
% Partition into hexadecane*
Sterne/G plate/30°C Sterne/G liquid/30°C Sterne/G plate/37°C Sterne/G liquid/37°C Sterne/G/80/liquid/30°C Sterne/NSM plate/30°C Sterne/NSM liquid/30°C Sterne/NSM plate/37°C Sterne/NSM liquid/37°C D cotc spores/NSM liquid/37°C Dcotc/pHT315-cotc spores/NSM liquid/37°C
68 50 66 50 75 92 98 90 95 57 93
*As described in Materials and methods. Values are averages of three experiments (5%) employing different batches of spores for each assay.
protein, Cota (Kim et al. 2004; A. Aronson, unpublished results) so it is most likely to be one of the innermost components of the coat. An orthologue designated ExsB was found as a minor band in extracts of purified exosporia from B. cereus (Todd et al. 2003). It was also indirectly identified in exosporia from B. anthracis Sterne (McPherson et al. 2010). In the latter study, peptides corresponding to those in Cotc were present in a preparations from two mutants but not in the wild type unless special wash conditions were used. There was no indication whether this was a major or minor component of the exosporium. Many of the peptides within the ‘repeat region’ were phosphorylated at threonine residues. Neither of these reports was spores directly examined for this protein. It was also present in both an exosporial and coat fraction from B. cereus ATCC14579 spores (called coat protein G) but was much more prevalent in the latter (Abhyankar et al. 2013). A GFP fusion to the B. anthracis ExsB was 1246
Figure 6 Appearance of the spore coat and exosporium in electron micrograph sections of spores. (a) nutrient sporulation medium (NSM) liquid at 30°C and (b) G liquid at 30°C. In each case, about 100 spores were examined and these are representative.
found in the exosporium (McPherson et al. 2010) when overexpressed on a multicopy plasmid, but a signal from an inner coat location may not have been detected. In our immunological analysis, little if any Cotc was found in the exosporia (Fig. 3), but there was a strong signal from spore extracts (Figs 2 and 3) as well as localization to the inner coat by immunogold staining (Fig. 4). A BLAST search revealed no cross homology of Cotc to other B. anthracis spore coat proteins and thus no likely cross reacting antigen. Cotc/ExsB may be present in either small amounts or as a contaminant of the exosporium, but it is clearly prevalent in the inner spore coat. Interestingly, another presumptive exosporial protein, BxpA, was found by immunogold labelling of spore sections to be primarily in the inner coat/cortex region (Moody et al. 2010). In addition to the effects of Cotc on hydrophobicity and morphology, spores produced at 37°C in G medium germinated at 27°C without heat activation about twice as fast as those from NSM as judged by a decrease in OD580nm and examination in the phase microscope for phase dark spores. The difference for heat-activated spores was about 50% faster for the G medium spores (A. Aronson, unpublished). Given these correlations, it would appear that Cotc contributes to a structural/functional interdependence between the coat and exosporium. Other proteins, such as ExsK, that may be present in part in the space between the coat and exosporium (Severson et al. 2009) could also contribute to this interaction. If there were a functional interaction, it is unlikely to involve the major outer coat protein, Cota, as mentioned above, spores lacking this protein have the same hydrophobic properties when produced in G or NSM media as wild-type spores. The difference in appearance of the exosporium in G versus NSM media with the former very similar to those with a deletion in the cotc/exsB gene could also have a role in the accessibility of enzymes known to be present in the exosporium. At least one
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
enzyme was absent in B. anthracis spores lacking ExsB (McPherson et al. 2010), and this could affect properties such as germination and infectivity. Cotc is synthesized late in sporulation and the expression of the gene appears to require 79 bp to 139 bp upstream of a sigmaK promoter (Qu et al. 2013; Fig. S1). GerE may also be involved in regulation as it is in B. thuringiensis (Qu et al. 2013). The very late synthesis of an inner spore coat protein, at about the same time as that of a major outer coat protein, Cota (A. Aronson, unpublished), and somewhat later than the major exosporial protein, BclA (Fig. S4) indicates that progression of assembly of the multiple layers of the coat proceed simultaneously consistent with results reported for B. subtilis (McKenney and Eichenberger 2012). Extensive disulfide bond formation for Cotc is likely given the oxidizing conditions present in late sporulating cells and the high content of C residues (10%). Such cross-linking and the extensive phosphorylation of threonine residues (McPherson et al. 2010) imply an unusually compact negatively charged protein that may contribute to a unique role in regulating the interaction of the coat and exosporium. There are other examples of either media or temperature affecting the expression of a coat gene or coat protein composition. Transcription of a cotC-lacZ fusion in B. subtilis varied with the medium, but no correlation to spore structure was presented (Zheng and Losick 1990). Bacillus subtilis spore coat composition varies with the temperature of sporulation (Melly et al. 2002) but again, no correlation with spore properties was reported. In the present study, the regulated synthesis or absence of Cotc correlates with the morphology and hydrophobic properties of spores (Table 2; Fig. 6). These phenotypic properties were corrected by introducing the cotc gene into the mutant on a low copy number plasmid. The proposed function for Cotc in the localization and perhaps intactness of the exosporium is consistent with its absence in B. subtilis which lacks a well defined exosporium. It is intriguing that the transcription of a spore protein synthesized very late in the sporulation process, i.e., essentially at the time of dehydration of the spore core and completion of the spore coat layers, is regulated by external factors such as liquid/solid media, temperature and pH. Each of these could contribute to the same metabolic changes within the sporulating cell which serve either directly or indirectly as the signal for repression of the cotc gene. The pH decrease is due to the exhaustion of glucose in the medium with accumulation of acidic fermentation products such as acetic and lactic acids. These fermentation products are utilized slowly during sporulation so the exact nature of the carbon compounds still present very late in sporulation is not known.
Regulation of a spore coat protein
Addition during sporulation of sodium acetate and sodium lactate each to a final concentration of 1% did result in a twofold inhibition of expression of the cotclacZ fusion and of spores with reduced hydrophobicity (A. Aronson, unpublished results). One possible explanation for this regulated synthesis is that the less hydrophobic spores resulting from the absence of Cotc could not be easily dispersed nor readily attach to the substratum. If the metabolic signal for repression were organic acids in the immediate environment, then these would be available for germination and growth. Exhaustion of the organic acids would result in derepression of the cotc gene in newly sporulating cells and the formation of spores with a more ordered exosporium/coat and thus a greater hydrophobicity. The ability to more readily disperse or attach could enhance spore deposition in nutrient-rich environments or even a higher probability of uptake by a host. If the latter, these spores would have the complete array of exosporial enzymes available to contribute to spore survival following infection. It is known that Bacillus spore coats are complex and contain between sixty to seventy different species of proteins (Henriques and Moran 2007). Some of these are involved in coat assembly and others contribute to protection (Giorno et al. 2007; McKenney and Eichenberger 2012). Some are involved in the germination response perhaps by allowing germinants to reach critical sites in the inner spore membrane or in the positioning of spore cortex lytic enzymes. Many, however, with no established functions, could be involved in the adaptation of spores to environmental conditions. If so, a further examination of the regulation of synthesis of these spore coat proteins may help to establish the basis for the complexity of this structure. Acknowledgements Dr. J. Kearney generously provided the monoclonal antibody to the BclA protein. D. Sherman and C.-P. Huang, Purdue Life Science microscopy Facility, performed the electron microscope experiments. Conflicts of interest There are no conflicts of interest. References Abhyankar, W., Hossain, A.H., Djajasaputra, A., Permpoonpattana, P., Ter Beek, A., Dekker, H.L., Cutting, S.M., Brul, S. et al. (2013) In pursuit of protein targets: Proteomic characterization of bacterial spore outer layers. J Proteome Res 12, 4507–4521.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1247
Regulation of a spore coat protein
A. Aronson et al.
Agaisse, H. and Lereclus, D. (1994) Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Mol Microbiol 13, 97–107. Arantes, O. and Lereclus, D. (1991) Construction of cloning vectors for Bacillus thuringiensis. Gene 108, 115–119. Aronson, A.I., Angelo, N. and Holt, S.C. (1971) Regulation of extracellular protease production in Bacillus cereus T: characterization of mutants producing altered amounts of protease. J Bacteriol 106, 1016–1025. Bailey-Smith, K., Todd, S.J., Southworth, T.W., Proctor, J. and Moir, A. (2005) The ExsA protein of Bacillus cereus is required for assembly of coat and exosporium onto the spore surface. J Bacteriol 187, 3800–3806. Boydston, J.A., Yue, L., Kearney, J.F. and Turnbough, C.L. Jr (2006) The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. J Bacteriol 188, 7440–7448. Bozue, J., Cote, C.K., Moody, K.L. and Welkos, S.L. (2007a) Fully virulent Bacillus anthracis does not require the immunodominant protein BclA for pathogenesis. Infect Immun 75, 508–511. Bozue, J., Moody, K.L., Cote, C.K., Stiles, B.G., Friedlander, A.M., Welkos, S.L. and Hale, M.L. (2007b) Bacillus anthracis spores of the bclA mutant exhibit increased adherence to epithelial cells, fibroblasts and endothelial cells but not to macrophages. Infect Immun 75, 4498–4505. Brahmbhatt, T.N., Janes, B.K., Stibitz, E.S., Darnell, S.C., Sanz, P., Rasmussen, S.B. and O’Brien, A.D. (2007) Bacillus anthracis exosporium protein BclA affects spore germination, interaction with extracellular matrix proteins, and hydrophobicity. Infect Immun 75, 5233–5239. Gao, H., Jiang, X., Pogliano, K. and Aronson, A.I. (2002) The E1b and E2 subunits of the Bacillus subtilis pyruvate dehydrogenase complex are involved in regulation of sporulation. J Bacteriol 184, 2780–2788. Gerhardt, P. and Ribi, E. (1964) Ultrastructure of the exosporium enveloping spores of Bacillus cereus. J Bacteriol 88, 1174–1189. Giorno, R., Bozue, R., Cote, J., Wenzel, C., Moody, T., Mallozzi, K.S., Ryan, M., Wang, R. et al. (2007) Morphogenesis of the Bacillus anthracis spore. J Bacteriol 189, 691–705. Giorno, R., Mallozzi, M., Bozue, J., Moody, K.-S., slack, A., Qui, D., Wang, R., Friedlander, A. et al. (2009) Localization and assembly of proteins comprising the outer structures of the Bacillus anthracis spore. Microbiology 155, 1133–1145. Helmann, J.D. and Moran, C.P. Jr (2002). RNA polymerase and sigma factors. In A Bacillus subtilis and its closest relatives: from genes to cells ed. Sonenshein, A.L., Hoch, J.A. and Losick, R. pp. 289–312. Washington, DC; ASM Press. Henriques, A.O. and Moran, C.P. Jr (2007) Structure, assembly, and function of the spore surface layers. Ann Rev Microbiol 61, 555–588.
1248
Itaya, M., Kondo, K. and Tanaka, T. (1989) A neomycin resistance gene cassette selectable in a single copy state in the Bacillus subtilis chromosome. Nucleic Acid Res 17, 4410. Johnson, M.J., Todd, S.J., Ball, D.A., Shepherd, A.M., Sylvestre, P. and Moir, A. (2006) ExsY and CotY are required for the correct assembly of the exosporium and spore coat of Bacillus cereus. J Bacteriol 188, 7905–7913. Kim, H.-S., Sherman, D., Johnson, F. and Aronson, A.I. (2004) Characterization of a major Bacillus anthracis spore coat protein and its role in spore inactivation. J Bacteriol 186, 2413–2417. Koehler, T.M., Dai, Z. and Yarbray, M.K. (1994) Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription form one of two promoters. J Bacteriol 176, 586–595. Koshikawa, T., Yamazaki, M., Yoshimi, M., Ogawa, S., Yamada, A., Watabe, K. and Torii, M. (1989) Surface hydrophobicity of the spores of Bacillus spp. J Gen Microbiol 135, 2717–2722. McKenney, P.T. and Eichenberger, P. (2012) Dynamics of spore coat morphogenesis in Bacillus subtilis. Mol Microbiol 83, 245–260. McPherson, S.A., Li, M., Kearney, J.F. and Turnbough, C.L. Jr (2010) ExsB, an unusually highly phosphorylated protein required for the stable attachment of the exosporium of Bacillus anthracis. Mol Microbiol 76, 1527–1538. Melly, E., Genest, P.C., Gilmore, M.E., Little, S., Popham, D., Driks, A. and Setlow, P. (2002) Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. J Appl Microbiol 92, 1105–1115. Moody, K.L., Driks, A., Rother, G.L., Cote, C.K., Brueggemann, E.E., Hines, H.B., Friedlander, A.M. and Bozue, J. (2010) Processing, assembly and localization of a Bacillus anthracis spore protein. Microbiology 156, 174–183. Oliva, C.R., Swiecki, M.K., Griguer, C.E., Lisanby, M.W., Bullard, D.C., Turnbough, C.L. Jr and Kearney, J.F. (2008) The integrin Mac-1 (CR3) mediated internalization and directs Bacillus anthracis spores into professional phagocytes. Proc Natl Acad Sci USA 105, 1261–1266. Qu, N., Peng, Q., Qui, L., Liu, C., Chen, Z., Zhang, J., Song, F. and Li, j. (2013) Transcriptional regulation of exosporium basal layer structural gene exsB in Bacillus thuringiensis by SigmaK and GerE. Abstract PMID 23678570 Redmond, C., Baillie, L.W.J., Hibbs, S., Moir, A.J.G. and Moir, A. (2004) Identification of proteins in the exosporium of Bacillus anthracis. Microbiology 150, 355–363. Schaeffer, P., Ionesco, H., Ryter, A. and Balassa, G. (1963) La sporulation de Bacillus subtilis: etude genetique et physiologique. Colloq Int CNRS 124, 553–563. Severson, K.M., Mallozzi, M., Bozue, J., Welkos, S.L., Cote, C.K., Knight, K.L. and Driks, A. (2009) Roles of the Bacillus anthracis spore protein ExsK in exosporium maturation and germination. J Bacteriol 191, 7587–7596. Steichen, C., Chen, P., Kearney, J.F. and Turnbough, C.L. Jr (2003) Identification of the immunodominant protein
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
A. Aronson et al.
and other proteins of the Bacillus anthracis exosporium. J Bacteriol 185, 1903–1910. Steichen, C.T., Kearney, J.F. and Turnbough, C.L. Jr (2005) Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. J Bacteriol 187, 5868–5876. Sylvestre, P., Couture-Tosi, E. and Mock, M. (2002) A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol Microbiol 45, 69–178. Sylvestre, P., Couture-Tosi, E. and Mock, M. (2005) Contribution of ExsFA and ExsFB proteins to the localization of BclA on the spore surface and to the stability of the Bacillus anthracis exosporium. J Bacteriol 187, 5122–5128. Thompson, B.M., Waller, L.N., Fox, K.F., Fox, A. and Stewart, G.C. (2007) The BclB glycoprotein of Bacillus anthracis is involved in exosporium integrity. J Bacteriol 189, 6704–6713. Todd, S.J., Moir, J.G., Johnson, M.J. and Moir, A. (2003) Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J Bacteriol 185, 3373–3378. Zhang, J., Fitz-James, P.C. and Aronson, A.I. (1993) Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. J Bacteriol 175, 3757–3766. Zheng, L. and Losick, R. (1990) Cascade regulation of spore coat gene expression in Bacillus subtilis. J Mol Biol 212, 645–660. Zheng, L., Donovan, W.P., Fitz-James, P.C. and Losick, R. (1988) Gene encoding a morphogenetic protein required in the assembly of the outer coat of the Bacillus subtilis endospore. Genes Dev 2, 1047–1054.
Regulation of a spore coat protein
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Sequence upstream of the monocistronic cotc gene. Sequences in bold are the presumptive sigmaK promoter. Underlined region is essential for expression of the gene. The upstream region is from the Bacillus anthracis Ames ancestor sequence, NC_007530.2; the coding region for the Cotc protein may be obtained in AAT31159 Figure S2 Immunoblot of extracts of spores produced in liquid media: G/8 at 30°C (lane 1); G at 30°C (lane 2); nutrient sporulation medium (NSM) at 37°C (lane 3); and NSM at 30°C (lane 4). STD are standards of 20 and 30 kDa. Figure S3 EM sections of spores produced on nutrient sporulation medium (NSM) plates at 30°C. Left frame is wild type; right frame is Dcotc strain. Compare to Fig. 6. Figure S4 Immunoblot with anti-BclA antibody and then with anti-Cotc antibody of sporulating cell extracts harvested when atleast 50% of the cells contained phase white endospores (lane 1) and then 60 and 120 min later (lanes 2 & 3). STD are standards of 220, 120, 100, 80, 60, 50 40, 30, 20 kDa from top to bottom. Arrow A points to BclA antigen; arrow B to Cotc antigen.
Journal of Applied Microbiology 116, 1241--1249 © 2014 The Society for Applied Microbiology
1249
