Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

The physiological performance and immune response of juvenile turbot (Scophthalmus maximus) to nitrite exposure Rui Jia a,b,1, Bao-Liang Liu b,1, Cen Han c, Bin Huang b, Ji-Lin Lei a,b,⁎ a b c

Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China College of Fisheries and Life Science, Dalian Ocean University, Dalian 116023, China

a r t i c l e

i n f o

Article history: Received 12 October 2015 Received in revised form 2 January 2016 Accepted 18 January 2016 Available online 21 January 2016 Keywords: Nitrite Immune response Cytokine Scophthalmus maximus

a b s t r a c t Nitrite (NO2−) is the most common toxic nitrogenous compound in aquatic environment. The aim of the present study was to investigate the effects of nitrite physiological performance and immune response of turbot. Fish were exposed to 0, 0.02, 0.08, 0.4 and 0.8 mM nitrite for 96 h. After 0, 24, 48 and 96 h of exposure, blood were collected to measure the levels of glutamate pyruvate transaminase (GPT), glutamate oxalate transaminase (GOT), alkaline phosphatase (ALP), total protein (TP), albumin (Alb), complement C3 (C3), complement C4 (C4), immunoglobulin M (IgM) and lysozyme (LYS); gill samples were taken to analyze mRNA levels of LYS, heat shock protein 70 (HSP 70), heat shock protein 90 (HSP 90), metallothionein (MT), toll-like receptor 3 (TLR-3), tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) and insulin-like growth factor I (IGF-I). The results showed that nitrite (0.4 and/or 0.8 mM) significantly increased the levels of GPT, GOT, ALP, C3 and C4, reduced the levels of IgM and LYS, up-regulated the gene expressions of HSP 70, HSP 90, MT, TLR-3, TNF-α and IL-1β, and down-regulated the gene expressions of LYS and IGF-1 after 48 and 96 h of exposure. Based on the results, it can be concluded that high level nitrite exposure results in dysfunction of the blood physiology and immunity in turbot. Further, this study will be helpful to understand the mechanism of aquatic toxicology induced by nitrite in marine fish. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Nitrite, an intermediate product in the nitrogen cycle, is one of the most common pollutants in aquatic environment (Martinez and Souza, 2002). It can build up in intensive aquaculture due to excessive use of proteinaceous feed, higher stocking densities or imbalance between bacterial nitrification and denitrification (Mazik et al., 1991; Romano and Zeng, 2009). Elevated concentration of nitrite is toxic to aquatic animals, and the toxic mechanisms have been investigated in various freshwater species (Park et al., 2007; Tomasso, 2012). In seawater fish, potential routes for nitrite uptake have been shown to occur across the intestinal and gill epithelium (Grosell and Jensen, 2000; Jensen, 2003). Several investigations also found that nitrite exposure decreased growth, disturbed ion balance, and caused hypoxia stress in marine fish (Deane and Woo, 2007; Grosell and Jensen, 2000; Xie-fa et al., 2012), but the molecular mechanism of nitrite toxicity was not yet fully understand.

⁎ Corresponding author at: Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, China. E-mail addresses: [email protected] (R. Jia), [email protected] (B.-L. Liu), [email protected] (J.-L. Lei). 1 Both authors contributed equally to this work.

http://dx.doi.org/10.1016/j.cbpc.2016.01.002 1532-0456/© 2016 Elsevier Inc. All rights reserved.

Nitrite has been reported to bio-accumulate not only in blood but also in gills, liver, brain, and muscle tissues (Cheng and Chen, 2000; Margiocco et al., 1983). The gills of teleost fish represent a multifunctional organ which carry out ion transport activities, gas exchange, acid–base regulation and waste excretion (Maetz, 1971). It is the major target organ for environmental pollutants and is considered as the dominant uptake site of pollutants such as nitrite, Cu and Zn in fish (Alvarado et al., 2006; Luzio et al., 2013; Romano and Zeng, 2009). Consequently, fish gills are more vulnerable to toxicants than other organs. To date, available data suggested that nitrite exposure induced hypertrophy, hyperplasia, epithelial cell necrosis and osmoregulatory dysfunction in gills (Deane and Woo, 2007; Park et al., 2007; Patrick Saoud et al., 2014; Romano and Zeng, 2009). However, the molecular effects of elevated nitrite levels on gills of fish, especially marine fish, have little been studied. Like higher vertebrates, the immune system of teleost fish is composed of non-specific and specific immune system (Zapata et al., 2006). Non-specific defences are the most important defence mechanisms in fish. Many reports have shown the links of stress, depression of immune system, and disease (Magnadóttir, 2006). Environmental stress from pollutants seems to be an important factor for determining reduction of immunocompetence (Cheng et al., 2015b). Previous studies showed that high concentration of nitrite caused repression of

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

immune function and alteration of immune-related enzymes, proteins or genes in fish (Ciji et al., 2015; Hanson and Grizzle, 1985; Zhang et al., 2014). Turbot is widely cultured in Europe and China because of its considerable commercial value. The species is mainly produced in land-based farms including recirculation and flow-through systems where seawater is often reused in order to save energy (Jilin et al., 2005). It is necessary to obtain strict water quality control, which may be one of the most important contributors to fish health and stress level (Foss et al., 2009). The changes of water quality such as dissolved oxygen, ammonia and nitrite may cause physiological stress (Xie-fa et al., 2012). In turbot, the acute toxicity of nitrite has been reported and the 96-h median lethal concentration (LC50) was 1.88 mM (Keming et al., 2007), but the subsequent effects such as in molecular and physiological levels were not described. Therefore, in the present study the effects of nitrite exposure physiological performance and immune response of turbot were investigated. 2. Materials and methods 2.1. Animals and experimental design Juvenile turbot (initial weight 90.3 ± 8.2 g) were obtained from Shandong Oriental Ocean Sci-Tech Co., Ltd. (Shandong, China). Prior to the experiment, fish were acclimated to experimental conditions (salinity 27–29 ppt; temperature 17–18 °C; dissolved oxygen 7–8 mg/L; pH 7.8–8.1; total ammonia b 0.05 mg/L; nitrite b0.001 mM) for 2 weeks in 500 L tanks with flow-through of aerated seawater. During the acclimation period, they were fed with a basal diet (52% crude protein, 12% crude lipids, 16.0% crude ash, 3.0% crude fiber, 12% water, 5% Ca, 0.5% P, ≥2.3% lysine, and ≤3.8% sodium chloride) at 2% of their body weight twice a day. Nitrite test solution was prepared by dissolving NaNO2 in 1 L distilled water to make a stock solution and then diluted by sea water based on the procedure described before (Chen and Cheng, 1995). In order to test the effects of short term exposure to nitrite, groups of fish were assigned at random to five treatments: 0 (control), 0.02, 0.08, 0.4 and 0.8 mM. Each treatment contained 300 animals and was tested in triplicate. The actual nitrite concentration was estimated using the Griess method (Federation and Association, 2005) and adjusted by adding NaNO2 solution every 12 h. The fish were not fed during the period of experimental trial in order to minimize nitrogen excretion and to maintain water quality. After exposure for 0, 24, 48, and 96 h, 24, 24 fish were randomly sampled after anesthesia in 0.05% tricaine methane sulfonate (MS-222, Sigma Diagnostics INS, St. Louis, MO). Blood and gill samples were collected for assaying biochemical parameters and expression of immune-related genes. This study followed Good Laboratory Practices (GLP) and the use of fish was approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing Agricultural University. 2.2. Biochemical parameter analysis in plasma The levels glutamate pyruvate transaminase (GPT), glutamate oxalate transaminase (GOT), alkaline phosphatase (ALP), total protein (TP) and albumin (Alb) were measured in an automatic biochemical analyzer Roche CobasC311 (Roche Cobas, Switzerland) using colorimetric test kits purchased from Nanjing Jiancheng Biological Engineering Research Institute of China (Jun et al., 2015). The complement C3 (C3) and complement C4 (C4) levels were assayed using a C3 and C4 kits (Elikan, Wenzhou, Zhejiang, China) as previously described methods (Sun et al., 2010). IgM was measured using a commercially available ELISA kit (mlbio, Shanghai, China) according to Sun et al. (2010). Lysozyme (LYS) activity was determined using a turbidimetric assay according to the method described by Dussauze et al. (2015).

41

2.3. Total RNA extraction, cDNA synthesis and quantitative real-time PCR RNA isolation, reverse transcription and quantitative real-time PCR were performed as previously described in our study (Jia et al., 2014b). Briefly, total RNA was extracted from gills using a fast pure RNA kit (Dalian Takara, China) according to the manufacturer's instruction. The RNA concentration was determined using GeneQuant 1300 (GE Healthcare Biosciences, Piscataway, NJ), and normalized to a common concentration with DEPC treated water (Invitrogen, China) before proceeding with cDNA synthesis. The purity of each sample was determined by calculating the 260/280 ratio. Reverse transcription reaction (20 μL) consists of the following: 2 μg of total RNA, 2 μL of Oligo dT (50 μM), 4 μL of 5 × M-MLV buffer, 4 μL of dNTP Mixture (10 mM), 0.5 μL of RNase inhibitor (40 U/μL), 1 μL of Moloney murine leukemia virus reverse transcriptase (200 U/μL), and RNase free dH2O up to a final volume of 20 μL. The procedure of the reverse transcription was according to the instruction of the manufacturer (Takara, Dalian, China) and the products (cDNA) were then stored at −20 °C for quantitative real-time PCR (qRT-PCR). The primers used for amplification and genes expression analysis are presented in Table 1. QRT-PCR was performed to detect the expression of genes in gills using SYBR Premix Ex Taq (Dalian Takara, China), and the reaction was performed on an ABI PRISM 7500 Detection System (Applied Biosystems, USA). The program was set to run for one cycle at 95 °C for 30 s, 40 cycles at 95 °C for 5 s and at 60 °C for 34 s. All qRT-PCRs were performed at least in triplicate. Data analysis was conducted using the 2−ΔΔ CT method (Livak and Schmittgen, 2001), and β-actin was included as an internal reference for normalization of gene expression.

2.4. Statistical analysis The data was expressed as mean ± standard deviation (SD). Isolated and interactive effects of nitrite concentration and exposure time were analyzed using two-way ANOVA. If significant differences were found in factors, Tukey's multiple range tests was used to determine the differences between means. P b 0.05 was taken as statistically significant. Statistical analyses were carried out using SPSS version 18.0 software.

3. Results 3.1. Effects of nitrite on plasma biochemical parameters The changes of plasma biochemical parameters were shown in Fig. 1. The GPT activity showed a significantly higher value in fish exposed to 0.8 mM nitrite for 48 and 96 h than the control group (P b 0.05). The GOT activity clearly increased in groups treated with 0.8 mM nitrite for 24 h and thereafter compared with control group (P b 0.05), the similar increases were also seen in groups treated with 0.4 mM nitrite for 48 and 96 h. The ALP activity showed small change, but the differences between control and higher nitrite exposure (0.4 and 0.8 mM) for 96 h was statistically significant (P b 0.05). The TP and Alb levels did not show any differences between nitrite treated-groups and control group.

3.2. Effects of nitrite on humoral immune responses Compared with the control groups, exposure to 0.8 mM nitrite for 48 and 96 h caused marked increase in C3 and C4 levels, and decrease in IgM level (P b 0.05; Fig. 2A, B and C), similar changes of these parameters were detected in treatments with 0.4 mM nitrite for 96 h (P b 0.05). In contrast, the level of LYS considerably decreased in fish exposed to 0.4 and 0.8 mM nitrite for 48 and 96 h compared to the control group (P b 0.05; Fig. 2D).

42

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

Table 1 Primer utilized for gene expression analysis by for qRT-PCR. Genes

Primer sequence (5′-3′)

Amplicon size (pb)

Gen Bank

Reference

ß-actin

F: TGAACCCCAAAGCCAACAGG R: AGAGGCATACAGGGACAGCAC F: CTCTCAACGTTCCCACTGGTTCTA R: GGGGTCATGAAGTGTCTGTAGAT F: CTGTCCCTGGGTATTGAGAC R: GAACACCACGAGGAGCA F: CCGCCTACCTCGTTGC R: TAGCCGATGAACTGCGAGT F: TGCTCCAAGAGTGGAACCTG R: CGCATGTCTTCCCTTTGCAC F: GGGCTGGTACAACACCATCTATC R: TTCAATTAGTGCCACGACAAAGA F: ACCAGACCTTCAGCATCCAGCGT R: TTCAGTGCCCCATTCCACCTTCCA F: TGTACTGTGCGCCTGCCAAGACTA R: TGCTGTGCTGTCCTACGCTCTGT F: GACGTGCTGATCCTGGTCTTTCTGG R: AGCTCAGGTAGGTCCGCTTGTTCA

107

EU686692.1

Wang et al. (2008)

191

AJ250732.1

Muñoz-Atienza et al. (2014)

220

EF191027.1

Reiser et al. (2011)

229

EU099575.1

Reiser et al. (2011)

148

EF406132.1

This study

165

FJ654645.1

Muñoz-Atienza et al. (2014)

81

AJ295836.2

Hermann et al. (2015)

139

FJ160587.1

Hermann et al. (2015)

100

FJ009111.1

Hermann et al. (2015)

LYS HSP 70 HSP 90 MT TNF-α IL-1β IGF-Ι TLR-3

3.3. Effects of nitrite on expression of stress related-genes in gills Compared with control groups, heat shock protein 70 (HSP 70) and heat shock protein 90 (HSP 90) mRNA levels nitrite showed significant

A

increase when fish exposed to 0.4 and 0.8 mM for 48 and 96 h (P b 0.05; Fig. 3A and B). Similarly, the mRNA levels of metallothionein (MT) apparently elevated in treatments with 0.4 mM nitrite for 96 h and 0.8 mM nitrite for 48 and 96 h (P b 0.05; Fig. 3C).

B 12

20 Alb (g/L)

TP (g/L)

10 15 10 5

GPT (U/mL)

20

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

Two-Way ANOVA: Nitrite concentration NS Exposure time * b Interaction NS b a ab ab ab a a a ab a a a a a a aa a a

10

0 0 mM

ALP (K.Am.U/100mL)

30 25

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

0.8 mM

c bc

c

b

20 15

c

96

a a a aa

a

a a

a

10

a a

a

a a a

0

0

4

D

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

5

5

5

0 mM

0.8 mM

15

E

0

96

GOT (U/mL)

0 mM

25

4

0 0

30

6

2

0

C

8

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

0 0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Two-Way ANOVA: Nitrite concentration NS Exposure time * Interaction * c b a a a a a a a a a a a a aa a a a a

3 2

1 0 0 0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 1. The changes of plasma biochemical parameters in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P b 0.05) among treatments. NS, non-significant at p N 0.05; *P b 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each treatment).

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * a a a a a

IgM (μg/mL)

a aa a

200 a a

ab

150 100

0

0 mM

18 16 14 12 10 8 6 4 2 0

b

Two-Way ANOVA: Nitrite concentration * Exposure time * b b Interaction * b a a a a a a a a aa a a a a a a a

50

0

C

a a a a a

B c c

C4 (μg/mL)

500 450 400 350 300 250 200 150 100 50 0

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

0

96

D

b

c

0 0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

0 mM

0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * a a a a a a a a a a a a a ab a a ab

c

96 0.8 mM

LYS (μg/L)

C3 (μg/mL)

A

43

18 16 14 12 10 8 6 4 2 0

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction NS a a a a a a a a a a ab a ab a ab b b b b b

0 0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 2. The changes of humoral immune parameters in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P b 0.05) among treatments. NS, non-significant at p N 0.05; *p b 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each treatment).

3.4. Effects of nitrite on LYS and toll-like receptor 3 mRNA levels in gills Treatments with 0.4 and 0.8 mM nitrite after 96 h of exposure caused strong reduction of LYS mRNA level when compared to the control group (P b 0.05; Fig. 4A). Conversely, nitrite exposure resulted in obvious up-regulation of toll-like receptor 3 (TLR-3) mRNA level in treatments with 0.4 and 0.8 mM after 24 and thereafter (P b 0.05; Fig. 4B). 3.5. Effects of nitrite on cytokines mRNA levels in gills Quantification of expression showed that tumor necrosis factor α (TNF-α) mRNA level was evidently up-regulated in fish exposed to 0.08, 0.4 and 0.8 mM nitrite for 96 h when compared with the control group (P b 0.05; Fig. 5A). Similar results were observed in fish treated with 0.8 mM nitrite for 48 h. There was a detectable induction of interleukin-1β (IL-1β) after 24 h of exposure to 0.8 mM nitrite and thereafter increased rapidly, reaching a maximum value after 96 h of exposure (P b 0.05; Fig. 5B). The detectable induction of IL-1β was also found in fish exposed to 0.4 mM for 48 and 96 h. Following exposure to 0.8 mM nitrite after 48 and 96 h, there was a significant downregulation in insulin-like growth factor I (IGF-I) mRNA level when compared with the control (P b 0.05; Fig. 5C). 4. Discussion It is widely accepted that nitrite is toxic to aquatic organisms and disturbs various physiological functions (Jensen, 2003). Our results showed that there was an increase in plasma GPT, GOT and ALP activities of nitrite-treated fish after longer-term exposure, which supported earlier findings and served as indicator of tissue damage (Das et al., 2004; Hassan et al., 2009; Jiang et al., 2014; Michael et al., 1987). The elevated enzyme activities in the plasma of fish exposed to nitrite could be attributed to the toxic effect of nitroso-compounds which caused some sort of hepatic necrosis (Jensen and Hansen, 2011; Sun et al., 2014a). Moreover, previous reports showed that nitrite decreased plasma TP and Alb, increased rate of free amino acids, and inhibited protein

turnover (Ciji et al., 2015; Eremin and Tocharina, 1981; Zhang et al., 2015). However, in the present study, nitrite exposure did not affect TP and Alb levels of turbot. Any adverse environmental variations are often stressful for fish, resulting in the depression of immunity (Tort, 2011). Teleost fish have various important defense molecules, such as lysozyme, complements and IgM, which participate in protection against potentially harmful conditions (Tort et al., 2003). LYS is a cationic enzyme which plays a key role in preventing fish from the infection of Gram-positive bacteria and Gram-negative bacteria (Saurabh and Sahoo, 2008). It has been reported that nitrite exposure caused reduction of LYS activity in Labeo rohita (Ciji et al., 2015). In line with previous studies, the plasma LYS activity clearly decreased in treatments with higher concentration of nitrite (0.4 and/or 0.8 mM) for 48 and 96 h in our study. Meanwhile, the expression of LYS gene showed a similar change in gills. C3 and C4 are the key components of both classical and lectin pathways responsible for various immune effector functions (Holland and Lambris, 2002). However, persistent activation of complement could lead to adverse effects and immunosuppression to the host (Peakman et al., 1989; Yin et al., 2014). Several studies showed that environmental contaminants caused up-regulation of C3 and C4 genes or proteins in fish (de Souza et al., 2014; Dupuy et al., 2014; Ma and Li, 2015). Also, our study found that C3 and C4 levels obviously increased in plasma of fish exposed to nitrite (0.4 and/or 0.8 mM) for 48 and 96 h, indicating that the complement system was activated by the chemicals exposure. IgM, an immunoglobulin, is a major component of the humoral immune system present in fish, and is a compulsory index in evaluating fish immunotoxicity (Watts et al., 2001). In fish, several investigations reported that environmental pollutants, such as copper sulphate, ammonia and CO2, suppressed the IgM protein or mRNA level (Carballo et al., 1992; Zhang et al., 2015). Similarly, the results from the present experiment found a dramatic decrease in IgM content in plasma of fish exposed to nitrite (0.4 and/or 0.8 mM) for 48 and 96 h. These results suggested that nitrite caused immunotoxicity and inhibition of humoral immunity in turbot. The analysis of gene expression patterns would help to understand environmental stress responses upon exposure to various stressors at the molecular level (Cheng et al., 2015b; Dan et al., 2013; Gagné et al.,

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

A

4.0

HSP 70 mRNA levels (arbitary units)

3.5 3.0 2.5

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

d

bc c

2.0 1.5 1.0

c

a a a a aa

a a a a a

a a

a

A LYS mRNA levels (arbitary units)

44

a ab

0.5 0.0

0 mM

B

3.0

0.02 mM

0.08 mM

2.0

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

1.5

a a

2.5 HSP 90 mRNA levels (arbitary units)

24 48 Time of exposure

1.0

a a a aa

a a a

0.4 mM

c

a

ab

b b

b ab aa

a

0.5 0.0 0 0 mM

MT mRNA levels (arbitary units)

C

4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

24 48 Time of exposure 0.02 mM

0.08 mM

0 mM

B 10.0 9.0 8.0 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0

d

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

24 48 Time of exposure 0.02 mM

c

0.08 mM

96

0.4 mM

0.8 mM

d

c

b a a a aa

a a a a

0

0.8 mM

ab

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

96

0.4 mM

a a c

0

0.8 mM

NS * *

b

96

TLR-3 mRNA levels (arbitary units)

0

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

Two-Way ANOVA: Nitrite concentration Exposure time Interaction a a a a a a a a a a a aa a a

0 mM

a

a ab

b

24 48 Time of exposure 0.02 mM

0.08 mM

0.4 mM

b a a ab

96 0.8 mM

Fig. 4. The changes of LYS and TLR-3 mRNA levels in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P b 0.05) among treatments. NS, non-significant at p N 0.05; *p b 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each treatment).

b a a a a a

a a a a a

0

0 mM

a a a a

24 48 Time of exposure

0.02 mM

0.08 mM

0.4 mM

aa a

96

0.8 mM

Fig. 3. The changes of HSP70, HSP90 and MT mRNA levels in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P b 0.05) among treatments. NS, non-significant at p N 0.05; *p b 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each treatment).

2013), and provide a reliable molecular biomarker to estimate the status of the organism (Kim et al., 2013). It is well known that the mRNA serves as a template for protein synthesis, thus the mRNA levels could indirectly imply relevant protein levels. Among several molecules involved, the heat shock protein (HSP) and the metallothionein (MT) genes have been used to evaluate the effects of various stress on fish (Jun et al., 2015; Kim et al., 2013; Lee et al., 2012; Ni et al., 2014). HSPs are molecular chaperones that play a key role in folding newly synthesized proteins and refolding denatured proteins (Iwama et al., 1999). In fish, the two main HSP families are HSP70 and HSP90 which are induced by various stressors including chemical stress, heat stress and crowding, and participated in the immune response (Kim et al., 2013; Viant et al., 2003; Zhang et al., 2015). Enhanced levels of HSP70 and HSP90 in fish may reflect the protein damage or increased tolerance to subsequent stress (Iwama et al., 1998). Results of the present study showed that the gene expression of HSP70 and HSP90 in gills increased with increase of nitrite concentration and exposure time. This results were consistent with previous studies in Sparus sarba and Megalobrama amblycephala Yih (Deane and Woo, 2007; Sun et al., 2014b). MT is a nonenzymatic protein with a high binding capacity for metals (Hamilton and Mehrle, 1986). One of the functions of MT is to regulate

redox homeostasis and protect against superoxide and hydroxyl radical (Nzengue et al., 2012; Wu et al., 2015). Moreover, MT serves as biomarker of stress exposure and is induced by metals and other stress (Gagné et al., 2013; Ricketts et al., 2009). In the present work, MT mRNA was highly expressed in gills of turbot exposed to 0.4 and/or 0.8 mM nitrite for 48 and 96 h, implying the presence of stress stimulus responsive elements that respond to high nitrite exposure in the promoter of the MT gene. Increase of MT could enhance the antioxidative effectiveness in the stress response and also was an adaptive response to high nitrite exposure (Wu et al., 2015). TLR-3 is one type of innate immunity-related pattern recognition receptor which can recognize multiple endogenous and exogenous stress signals (Tsan and Gao, 2004). In the present study, TLR-3 gene expression significantly increased in treatment with higher nitrite (0.4 and/ or 0.8 mM) after 24, 48 and 96 of exposure, reflecting that high nitrite exposure induced the TLR-3 transcription and activation. The activation of TLR-3 induced expression and secretion of cytokines TNF-α, IL-1β and IL-8 to regulate inflammation (Lee et al., 2014). Inflammation is considered an important part of the immune response and mediated by cytokines (Magnadóttir, 2006). The expression levels of inflammationrelated genes could be induced or inhibited by environmental chemicals, bacteria or viruses (Cheng et al., 2015b; Jia et al., 2014a; Meloni et al., 2015). IL-1β and TNF-1α are the two crucial pro-inflammatory cytokines that can lead to the activation of the inflammatory response by regulating the expression of other cytokines (Dan et al., 2013). In our study, the expression of IL-1β and TNF-1α genes increased in the gills with the increased nitrite concentration and exposure time, and the highest expression was found in fish exposed to 0.8 mM nitrite for 96 h. These findings indicted high nitrite exposure caused an inflammatory response in gills of turbot. IGF-1, a single chain polypeptides hormone, participates in various ways in immune response through regulation the endocrine system (Reinecke et al., 2005). Suppression of IGF-I synthesis and gene expression by many stressors have been reported in fish (Cheng et al., 2015a; Salas-Leiton et al., 2010). In this study, the mRNA levels of IGF-I in gills of

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

TNF-1α mRNA levels (arbitary units)

A

4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

a a a aa

a a a a a

0 mM

IL-1β mRNA levels (arbitary units)

5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

b

b a a

a

24 48 Time of exposure 0.02 mM

0.08 mM

96

0.4 mM

0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

a a a aa

a

0 0 mM

C IGF-1 mRNA levels (arbitary units)

a ab

c

b

ab b abab

b

a ab a

a ab

0.08 mM

96

0.4 mM

Two-Way ANOVA: Nitrite concentration Exposure time Interaction a a a a a a aa a a a a a ab

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

b a

24 48 Time of exposure 0.02 mM

0.8 mM

* * NS a a

a

ab

b

0 0 mM

24 48 Time of exposure 0.02 mM

0.08 mM

Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31402315 and 31240012), the Modern Agriculture Industry System Construction of Special Funds (CARS-50-G10), Key R & D Program of Jiangsu Province (BE2015328), Natural Science Foundation of Shandong Province (No. BS2015SW018) and the Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture, P.R. China.

c ab

0

B

d

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

45

0.4 mM

b

96 0.8 mM

Fig. 5. The changes of cytokines TNF-1α, IL-1β and IGF-1 mRNA levels in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P b 0.05) among treatments. NS, non-significant at p N 0.05; *p b 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each treatment).

fish exposed to 0.8 mM nitrite for 48 and 96 h, indicating high nitrite levels may interfere with the endocrine system and thus affecting the immune response in fish. The suppression of this hormone may be related to up-regulation of IL-1β and TNF-1α (Heemskerk et al., 1999; Nakano et al., 2013; Thissen and Verniers, 1997).

5. Conclusions In summary, we demonstrated the effects of nitrite exposure on physiological performance and immune response of juvenile turbot. Our results indicated that nitrite exposure increased the activities of GPT GOT and ALP, and depressed immunity in plasma. In gills, nitrite exposure caused cellular stress response such as the up-regulation of HSP 70, HSP 90 and MT genes. Meanwhile, nitrite exposure induced TLR-3, leading to cellular inflammation and immunotoxicity.

Conflict of interest The authors declare that there are no conflicts of interest.

References Alvarado, N.E., Quesada, I., Hylland, K., Marigómez, I., Soto, M., 2006. Quantitative changes in metallothionein expression in target cell-types in the gills of turbot (Scophthalmus maximus) exposed to Cd, Cu, Zn and after a depuration treatment. Aquat. Toxicol. 77, 64–77. Carballo, M., Torroba, M., Muoz, M., Sanchez, C., Tarazona, J., Dominguez, J., 1992. Effect of copper and cyanide on some immunological parameters and stress in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2, 121–129. Chen, J., Cheng, S., 1995. Hemolymph oxygen content, oxyhemocyanin, protein levels and ammonia excretion in the shrimp Penaeus monodon exposed to ambient nitrite. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 164, 530–535. Cheng, C.-H., Yang, F.-F., Liao, S.-A., Miao, Y.-T., Ye, C.-X., Wang, A.-L., 2015a. Effect of acute ammonia exposure on expression of GH/IGF axis genes GHR1, GHR2 and IGF-1 in pufferfish (Takifugu obscurus). Fish Physiol. Biochem. 41, 495–507. Cheng, C.-H., Yang, F.-F., Ling, R.-Z., Liao, S.-A., Miao, Y.-T., Ye, C.-X., Wang, A.-L., 2015b. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 164, 61–71. Cheng, S.-Y., Chen, J.-C., 2000. Accumulation of nitrite in the tissues of Penaeus monodon exposed to elevated ambient nitrite after different time periods. Arch. Environ. Contam. Toxicol. 39, 183–192. Ciji, A., Sahu, N.P., Pal, A.K., Akhtar, M.S., 2015. Dietary L-tryptophan modulates growth and immuno-metabolic status of Labeo rohitajuveniles exposed to nitrite. Aquac. Res. 46, 2013–2024. Dan, X.-M., Zhang, T.-W., Li, Y.-W., Li, A.-X., 2013. Immune responses and immune-related gene expression profile in orange-spotted grouper after immunization with cryptocaryon irritans vaccine. Fish Shellfish Immunol. 34, 885–891. Das, P., Ayyappan, S., Das, B., Jena, J., 2004. Nitrite toxicity in Indian major carps: sublethal effect on selected enzymes in fingerlings of Catla catla, Labeo rohita and Cirrhinus mrigala. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 138, 3–10. de Souza, K.B., Jutfelt, F., Kling, P., Förlin, L., Sturve, J., 2014. Effects of increased CO2 on fish gill and plasma proteome. PLoS One 9, 1–9. Deane, E.E., Woo, N.Y., 2007. Impact of nitrite exposure on endocrine, osmoregulatory and cytoprotective functions in the marine teleost sparus sarba. Aquat. Toxicol. 82, 85–93. Dupuy, C., Galland, C., Devaux, A., Bony, S., Loizeau, V., Danion, M., Pichereau, V., Fournier, M., Laroche, J., 2014. Responses of the European flounder (Platichthys flesus) to a mixture of PAHs and PCBs in experimental conditions. Environ. Sci. Pollut. Res. 21, 13789–13803. Dussauze, M., Danion, M., Le Floch, S., Lemaire, P., Pichavant-Rafini, K., Theron, M., 2015. Innate immunity and antioxidant systems in different tissues of sea bass (Dicentrarchus labrax) exposed to crude oil dispersed mechanically or chemically with corexit 9500. Ecotoxicol. Environ. Saf. 120, 270–278. Eremin, I., Tocharina, M., 1981. Effect of nitrites on the state of thyroid gland in iodine deficiency and different diets. Vopr. Pitan. 60-62. Federation, W.E., Association, A.P.H., 2005. Standard Methods for the Examination of Water and Wastewater. American Public Health Association (APHA), Washington, DC, USA. Foss, A., Imsland, A.K., Roth, B., Schram, E., Stefansson, S.O., 2009. Effects of chronic and periodic exposure to ammonia on growth and blood physiology in juvenile turbot (Scophthalmus maximus). Aquaculture 296, 45–50. Gagné, F., Smyth, S., André, C., Douville, M., Gélinas, M., Barclay, K., 2013. Stress-related gene expression changes in rainbow trout hepatocytes exposed to various municipal wastewater treatment influents and effluents. Environ. Sci. Pollut. Res. 20, 1706–1718. Grosell, M., Jensen, F.B., 2000. Uptake and effects of nitrite in the marine teleost fish Platichthys flesus. Aquat. Toxicol. 50, 97–107. Hamilton, S.J., Mehrle, P.M., 1986. Metallothionein in fish: review of its importance in assessing stress from metal contaminants. Trans. Am. Fish. Soc. 115, 596–609. Hanson, L.A., Grizzle, J.M., 1985. Nitrite-induced predisposition of channel catfish to bacterial diseases. Prog. Fish Cult. 47, 98–101. Hassan, H.A., El-Agmy, S.M., Gaur, R.L., Fernando, A., Raj, M., Ouhtit, A., 2009. In vivo evidence of hepato-and reno-protective effect of garlic oil against sodium nitriteinduced oxidative stress. Int. J. Biol. Sci. 5, 249–255. Heemskerk, V.H., Daemen, M.A., Buurman, W.A., 1999. Insulin-like growth factor-1 (IGF-1) and growth hormone (GH) in immunity and inflammation. Cytokine Growth Factor Rev. 10, 5–14. Hermann, B., Reusch, T., Hanel, R., 2015. Effects of dietary purified rapeseed protein concentrate on hepatic gene expression in juvenile turbot (Psetta maxima). Aquacult. Nutr. Holland, M.C.H., Lambris, J.D., 2002. The complement system in teleosts. Fish Shellfish Immunol. 12, 399–420. Iwama, G.K., Thomas, P.T., Forsyth, R.B., Vijayan, M.M., 1998. Heat shock protein expression in fish. Rev. Fish Biol. Fish. 8, 35–56.

46

R. Jia et al. / Comparative Biochemistry and Physiology, Part C 181–182 (2016) 40–46

Iwama, G.K., Vijayan, M.M., Forsyth, R.B., Ackerman, P.A., 1999. Heat shock proteins and physiological stress in fish. Am. Zool. 39, 901–909. Jensen, F.B., 2003. Nitrite disrupts multiple physiological functions in aquatic animals. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 135, 9–24. Jensen, F.B., Hansen, M.N., 2011. Differential uptake and metabolism of nitrite in normoxic and hypoxic goldfish. Aquat. Toxicol. 101, 318–325. Jia, R., Cao, L.-P., Du, J.-L., Liu, Y.-J., Wang, J.-H., Jeney, G., Yin, G.-J., 2014a. Grass carp reovirus induces apoptosis and oxidative stress in grass carp (ctenopharyngodon idellus) kidney cell line. Virus Res. 185, 77–81. Jia, R., Cao, L.-P., Du, J.-L., Wang, J.-H., Liu, Y.-J., Jeney, G., Xu, P., Yin, G.-J., 2014b. Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyte apoptosis in common carp (Cyprinus carpio). Aquat. Toxicol. 152, 11–19. Jiang, Q., Dilixiati, A., Zhang, W., Li, W., Wang, Q., Zhao, Y., Yang, J., Li, Z., 2014. Effect of nitrite exposure on metabolic response in the freshwater prawn Macrobrachium nipponense. Cent. Eur. J. Biol. 9, 86–91. Jilin, L., Aijun, M., Chao, C., Zhimeng, Z., 2005. The present status and sustainable development of turbot (Scophthalmus maximus L.) culture in China [J]. Eng. Sci. 5, 004. Jun, Q., Hong, Y., Hui, W., Didlyn, K.M., Jie, H., Pao, X., 2015. Physiological responses and HSP70 mRNA expression in GIFT tilapia juveniles, Oreochromis niloticus under short-term crowding. Aquac. Res. 46, 335–345. Keming, Q., Yong, X., Shaosai, M., 2007. Acute toxic effects of nitrite and non-ion ammonia on turbot (Scophthalmus maximus) at different DO levels. Mar. Fish. Res. 28, 84–89. Kim, J.H., Dahms, H.U., Han, K.N., 2013. Biomonitoring of the river pufferfish, Takifugu obscurus in aquaculture at different rearing densities using stress-related genes. Aquac. Res. 44, 1835–1846. Lee, K., Kim, S.-J., Kim, D., Jo, S.-H., Lee, S.J., Choi, S.-Y., 2014. Prostaglandin modulates TLR3-induced cytokine expression in human astroglioma cells. Brain Res. 1589, 54–60. Lee, K.-W., Rhee, J.-S., Han, J., Park, H.G., Lee, J.-S., 2012. Effect of culture density and antioxidants on naupliar production and gene expression of the cyclopoid copepod, paracyclopina nana. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 161, 145–152. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Luzio, A., Monteiro, S.M., Fontaínhas-Fernandes, A.A., Pinto-Carnide, O., Matos, M., Coimbra, A.M., 2013. Copper induced upregulation of apoptosis related genes in zebrafish (Danio rerio) gill. Aquat. Toxicol. 128, 183–189. Ma, J., Li, X., 2015. Transcription alteration of immunologic parameters and histopathological damage in common carp (Cyprinus carpio L.) caused by paraquat. J. Biochem. Mol. Toxicol. 29, 21–28. Maetz, J., 1971. Fish gills: mechanisms of salt transfer in fresh water and sea water. Philos. Trans. R. Soc. B Biol. Sci. 262, 209–249. Magnadóttir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–151. Margiocco, C., Arillo, A., Mensi, P., Schenone, G., 1983. Nitrite bioaccumulation in salmo gairdneri rich and hematological consequences. Aquat. Toxicol. 3, 261–270. Martinez, C.B., Souza, M.M., 2002. Acute effects of nitrite on ion regulation in two neotropical fish species. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 133, 151–160. Mazik, P.M., Hinman, M.L., Winkelmann, D.A., Klaine, S.J., Simco, B.A., Parker, N.C., 1991. Influence of nitrite and chloride concentrations on survival and hematological profiles of striped bass. Trans. Am. Fish. Soc. 120, 247–254. Meloni, M., Candusso, S., Galeotti, M., Volpatti, D., 2015. Preliminary study on expression of antimicrobial peptides in European sea bass (Dicentrarchus labrax) following in vivo infection with vibrio anguillarum. A time course experiment. Fish Shellfish Immunol. 43, 82–90. Michael, M., Hilmy, A., El-Domiaty, N., Wershana, K., 1987. Serum transaminases activity and histopathological changes in Clarias lazera chronically exposed to nitrite. Comp. Biochem. Physiol. C Comp. Pharmacol. 86, 255–262. Muñoz-Atienza, E., Araújo, C., Magadán, S., Hernández, P.E., Herranz, C., Santos, Y., Cintas, L.M., 2014. In vitro and in vivo evaluation of lactic acid bacteria of aquatic origin as probiotics for turbot (Scophthalmus maximus L.) farming. Fish Shellfish Immunol. 41, 570–580. Nakano, T., Afonso, L.O., Beckman, B.R., Iwama, G.K., Devlin, R.H., 2013. Acute physiological stress down-regulates mRNA expressions of growth-related genes in coho salmon. PLoS One 8, e71421. Ni, M., Wen, H., Li, J., Chi, M., Ren, Y., Song, Z., Ding, H., 2014. Two HSPs gene from juvenile Amur sturgeon (Acipenser schrenckii): cloning, characterization and expression pattern to crowding and hypoxia stress. Fish Physiol. Biochem. 40, 1801–1816. Nzengue, Y., Steiman, R., Rachidi, W., Favier, A., Guiraud, P., 2012. Oxidative stress induced by cadmium in the C6 cell line: role of copper and zinc. Biol. Trace Elem. Res. 146, 410–419. Park, I.S., Lee, J., Hur, J.W., Song, Y.C., Na, H.C., Noh, C.H., 2007. Acute toxicity and sublethal effects of nitrite on selected hematological parameters and tissues in dark-banded rockfish, Sebastes inermis. J. World Aquacult. Soc. 38, 188–199.

Patrick Saoud, I., Naamani, S., Ghanawi, J., Nasser, N., 2014. Effects of acute and chronic nitrite exposure on rabbitfish Siganus rivulatus growth, hematological parameters, and gill histology. J. Aquac. Res. Dev. 5, 2. Peakman, M., Senaldi, G., Vergani, D., 1989. Review: assessment of complement activation in clinical immunology laboratories: time for reappraisal? J. Clin. Pathol. 42, 1018–1025. Reinecke, M., Björnsson, B.T., Dickhoff, W.W., McCormick, S.D., Navarro, I., Power, D.M., Gutiérrez, J., 2005. Growth hormone and insulin-like growth factors in fish: where we are and where to go. Gen. Comp. Endocrinol. 142, 20–24. Reiser, S., Wuertz, S., Schroeder, J., Kloas, W., Hanel, R., 2011. Risks of seawater ozonation in recirculation aquaculture—effects of oxidative stress on animal welfare of juvenile turbot (Psetta maxima, L.). Aquat. Toxicol. 105, 508–517. Ricketts, C.D., Bates, W.R., Reid, S.D., 2009. The Effects of Acute Waterborne Exposure to sub-Lethal Concentrations of Molybdenum on the Stress Response in Rainbow Trout (Oncorhynchus mykiss) (MSc thesis). Romano, N., Zeng, C., 2009. Subchronic exposure to nitrite, potassium and their combination on survival, growth, total haemocyte count and gill structure of juvenile blue swimmer crabs, Portunus pelagicus. Ecotoxicol. Environ. Saf. 72, 1287–1295. Salas-Leiton, E., Anguis, V., Martín-Antonio, B., Crespo, D., Planas, J.V., Infante, C., Cañavate, J.P., Manchado, M., 2010. Effects of stocking density and feed ration on growth and gene expression in the senegalese sole (Solea senegalensis): potential effects on the immune response. Fish Shellfish Immunol. 28, 296–302. Saurabh, S., Sahoo, P., 2008. Lysozyme: an important defence molecule of fish innate immune system. Aquac. Res. 39, 223–239. Sun, S., Ge, X., Xuan, F., Zhu, J., Yu, N., 2014a. Nitrite-induced hepatotoxicity in bluntsnout bream (Megalobrama amblycephala): the mechanistic insight from transcriptome to physiology analysis. Environ. Toxicol. Pharmacol. 37, 55–65. Sun, S., Zhu, J., Ge, X., Zhang, C., Miao, L., Jiang, X., 2014b. Cloning and expression analysis of a heat shock protein 90 β isoform gene from the gills of wuchang bream (Megalobrama amblycephala Yih) subjected to nitrite stress. Genet. Mol. Res. 14, 3036–3051. Sun, Y.-Z., Yang, H.-L., Ma, R.-L., Lin, W.-Y., 2010. Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish Shellfish Immunol. 29, 803–809. Thissen, J.-P., Verniers, J., 1997. Inhibition by interleukin-1β and tumor necrosis factor-α of the insulin-like growth factor I messenger ribonucleic acid response to growth hormone in rat hepatocyte primary culture 1. Endocrinology 138, 1078–1084. Tomasso, J., 2012. Environmental nitrite and aquaculture: a perspective. Aquac. Int. 20, 1107–1116. Tort, L., 2011. Stress and immune modulation in fish. Dev. Comp. Immunol. 35, 1366–1375. Tort, L., Balasch, J., Mackenzie, S., 2003. Fish immune system. A crossroads between innate and adaptive responses. Inmunología 22, 277–286. Tsan, M.-F., Gao, B., 2004. Endogenous ligands of toll-like receptors. J. Leukoc. Biol. 76, 514–519. Viant, M., Werner, I., Rosenblum, E., Gantner, A., Tjeerdema, R., Johnson, M., 2003. Correlation between heat-shock protein induction and reduced metabolic condition in juvenile steelhead trout (Oncorhynchus mykiss) chronically exposed to elevated temperature. Fish Physiol. Biochem. 29, 159–171. Wang, C., Zhang, X.H., Jia, A., Chen, J., Austin, B., 2008. Identification of immune-related genes from kidney and spleen of turbot, Psetta maxima (L.), by suppression subtractive hybridization following challenge with vibrio harveyi. J. Fish Dis. 31, 505–514. Watts, M., Munday, B., Burke, C., 2001. Immune responses of teleost fish. Aust. Vet. J. 79, 570–574. Wu, S.M., Liu, J.-H., Shu, L.-H., Chen, C.H., 2015. Anti-oxidative responses of zebrafish (Danio rerio) gill, liver and brain tissue upon acute cold shock. Comp. Biochem. Physiol. A Mol. Integr. Physiol. Xie-fa, S., Yi-ming, C., Lei, P., Qiang, L., Deng-pan, D., 2012. Effects of DO, ammonia and nitrite on growth and metabolism of juvenile turbot. Fish. Modernization 6, 1–9. Yin, G., Li, W., Lin, Q., Lin, X., Lin, J., Zhu, Q., Jiang, H., Huang, Z., 2014. Dietary administration of laminarin improves the growth performance and immune responses in Epinephelus coioides. Fish Shellfish Immunol. 41, 402–406. Zapata, A., Diez, B., Cejalvo, T., Gutierrez-de Frias, C., Cortes, A., 2006. Ontogeny of the immune system of fish. Fish Shellfish Immunol. 20, 126–136. Zhang, C.N., Li, X.F., Tian, H.Y., Zhang, D.D., Jiang, G.Z., Lu, K.L., Liu, G.X., Liu, W.B., 2015. Effects of fructooligosaccharide on immune response, antioxidant capability and HSP70 and HSP90 expressions of blunt snout bream (Megalobrama amblycephala) under high ammonia stress. Fish Physiol. Biochem. 41, 203–217. Zhang, J., Chen, L., Wei, X., Xu, M., Huang, C., Wang, W., Wang, H., 2014. Characterization of a novel CC chemokine CCL4 in immune response induced by nitrite and its expression differences among three populations of Megalobrama amblycephala. Fish Shellfish Immunol. 38, 88–95.