Molec. gen. Genet. 171,287 293 (1979) © by Springer-Verlag 1979
The Nucleotide Sequence of the Region Surrounding the Replication Origin of an R100 Resistance Factor Derivative Jonathan Rosen, Hisako Ohtsubo, and Eiichi Ohtsubo Department of Microbiology, State University of New York at Stony Brook, Stony Brook, New York, 11794 USA
Summary. The replication origin of a group of small plasmids derived from R100 was previously determined by electron microscopy (Ohtsubo et al., 1977). This region was subjected to extensive restriction enzyme analysis and the nucleotide sequence of the region containing the replication origin was determined using the Maxam and Gilbert sequencing technique. Various characteristics of this sequence, including a very interesting secondary structure are described and discussed.
Introduction The resistance plasmid R100 is a closed circular DNA molecule 89.3 kilobases (Kb), in length which confers resistance against antibiotics such as streptomycin, chloramphenicol, sulfonamide and tetracycline. R100 utilizes host activities for most replication processes. However, this replication is, in part, controlled by the R-factor itself (Nishimura et al., 1971; Morris et al., 1974). R12, a copy number mutant of R100 has been isolated (Morris et al., 1974) and was found to generate small plasmids known as pSM plasmids capable of autonomous replication (Mickel and Bauer, 1976). Electron microscope heteroduplex analysis of the pSM plasmids demonstrated that the region necessary for replication can be restricted to a small area from 83.0 to 87.2 on the kilobase map of R100 (Mickel et al., 1977). Analysis of replicative molecules of the pSM plasmids pSM1, pSM2 and pSM3 demonstrated that they replicate unidirectionally from a unique origin, defined as the end of the replicative eye seen in electron microscopy. This has been mapped at 85,5 on the R100 map (Ohtsubo For offprints contact: J. Rosen
et al., 1977). The mode of replication of these plasraids appears to be the same as that of the parental R100 plasmid which replicates unidirectionally from the same origin as that found on the pSM plasmids (Silver et al., 1977). Although little is known about the control of replication, it is likely that the controlling mechanism in the replication of R100 is exerted at the initiation stage of replication at its unique replication origin. Another resistance plasmid, R1, is closely related to R100 and confers resistance to streptomycin, chloramphenicol, sulfonamide, kanamycin and ampicillin. It has been shown by heteroduplex analysis that R1, and R100 are homologous except for some small mismatched regions (Sharp et al., 1973) and large DNA insertion sequences, some of which have recently been identified as transposable DNA elements containing various resistance genes (see Kleckner, 1977 for a recent review). Yhe region at the origin of replication in both plasmids is completely homologous, indicating that R1 also replicates unidirectionally from the same unique origin utilized by R100 (Ohtsubo et al., 1978). A class of deletion mutants called Rsc plasmids have been isolated (Goebel and Bonewald, 1975) from a copy mutant of R1, Rldrdl9B2 (Nordstrom et al., 1972; Uhlin and Nordstrom, 1975). The heteroduplex analysis of these plasmids demonstrated that the region necessary for autonomous replication can be further narrowed to an area 2.5 Kb in length which, on the R100 map, is located between 83.2 and 85.7 (Ohtsubo et al., 1978). In this paper we describe the nucleotide sequence surrounding the replication origin of a small replicon derived from R100 and discuss various characteristics of this sequence including its similarities with other replication systems. Oertel et al. in an accompanying paper describes the sequence of a region from the
0026-8925/79/0171/0287/$01.40
288
related plasmid R1 which they find is required for replication in cis. As will be discussed later, their sequence, is almost identical to ours and is found in a Very interesting region of our sequence. Materials and Methods Bacterial Plasmids. The plasmids used in these experiments are pSM1, pSM2, pSM15, and Rscl3. Bacteria harboring a plasmid were grown overnight in L-broth to stationary phase. Cleared lysate containing D N A was prepared by the method of Clewell and Helinski (1969). Covalently closed circular D N A was purified according to Ohtsubo et al. (1978) and the pure D N A was dialyzed against TE buffer containing 0.01 M Tris and 0.001 M EDTA.
Enzymes. EcoR1 and HpalI were purchased from Miles Laboratory and PstI, AluI and HaeII were obtained from Bio Lab, Inc. These enzymes were assayed as recommended by the laboratory from which they were obtained. HinfI and HhaI were kindly supplied by H. Ohmori. HaeIII was isolated according to Roberts et al. (1975). The reaction mixtures for these endonucleases contained 6 m M MgClz, 6 m M 2-mercaptoethanol, 6 mM Tris-HC1 ( p H = 7.9) and bovine serum albumin (500 gg/ml). Polynucleotlde kinase (PL Biochemicals Co.) was used to phosphorylate the 5' ends of the restriction fragments used in sequencing with (gamma-32P) ATP (Amersham). The reaction mixture contained 50 m M Tris1-IC1 (pH=7.5), 10 m M MgC12, and 5 nrM dithiothreitol. Bacterial alkaline phosphatase (36 unitslml), obtained from Worthington Biochemicals, was used in 0.1 M Tris-HC1 (pH=8.0), 10 m M MgCl2.
Gel Electrophoresis. Native D N A fragments were separated by gel electrophoresis on a 13 × 15 x 0.2 cm mixed 0.7% agarose/2.2% polyacrylamide gel or on 4, 7, or 10% polyacrylamide slab gels (acrylamide : bisacrylamide = 20 : 1), D N A bands were visualized by staining with ethidium bromide (4 ~g/ml) under short wavelength UV light. They were then cut out, eluted electrophoretically into dialysis tubing, treated with phenol to remove the ethidium bromide, ethanol precipitated and washed.
Determinatton of Nucleotide Sequences. 5' 32p-labelled D N A fragments were obtained by strand separation or by further cleavage of double stranded D N A labelled at both 5' ends with another restriction endonuclease (Maxam and Gilbert, 1977). The nucleotide sequence of the 5' labelled fragments was determined as described by Maxam and Gilbert (1977) with two modifications (A. Maxam personal communication). A G-specific reaction was used in place of the G > A reaction and an A > C reaction was used in addition to the A > G reaction. Also, in the separation of the chemically modified and degraded products of the five base specific reactions, thin gels 0.04 x 20 x 40 cm (Sanger and Coulson, 1978) were used in addition to those described by Gilbert and Maxam (i977).
Computer Analysis. Computer analysis of the nucleotide sequences which we determined was performed on a Univac 1100 at the State University of New York at Stony Brook. The program was kindly provided by Laurence Jay Korn from the Carnegie Institute of Washington. We generally used the program to determine AC and GT rich regions on one strand in addition to AT and GC rich regions; (Nucleotide richness is defined such that six out of eight consecutive nucleotide bases are those requested); search for inverted and direct repeats ; and examine the possible peptide chains encoded by our sequence.
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin
Results and Discussion
Determination of the Fragments Containing the Origin of Replication A preliminary cleavage map of the pSM plasmids, pSM1, pSM2 and pSM15, constructed with the endonucleases HaeII and HinfI was described previously (Ohtsubo and Ohtsubo, 1978). Figure 1A presents a linear representation of the structures of the circular plasmids, pSM1, pSM2 and pSM15, which contain a common origin of replication. This origin has been located 1.746+0.173 Kbto the left of the EcoRl site (see Fig. 1A). This corresponds to 85.5 in the coordinate system of the pSM plasmids (see the legend to Fig. 1 for further explanation of the coordinate system). Replication of these plasmids proceeds unidirectionally from this origin as indicated in Fig. 1A. The construction of a cleavage map (Fig. 1B) was simplified due to the difference between the structures of these small plasmids. The final construction of this map was performed by elution of the DNA fragments generated by a restriction endonuclease and further digestion of these fragments with a second restriction endonuclease. It was determined that the HaeII-C fragment contained the origin since it spans the distance between 1.1 and 2.0 Kb to the left of the EcoR1 site which is within the range previously determined for the origin, i.e. 1.746 ± 0.173. HaeIl-C and nearby regions were fine mapped with other restriction endonucleases such as HpaII, AluI and HhaI to define fragments that were useful in sequencing this region. Very small fragments (less than 15 nucleotides) were localized as shown in Fig. 1 after sequencing these regions. The sequencing results also confirmed many parts of the cleavage map presented here.
Nucleotide Sequence Analysis of the Origin Region The nucleotide sequence of the HaeII-C and HaeII-D fragments was analyzed according to Maxam and Gilbert (1977). The DNA fragments and strands which were used for the sequence analysis are shown in Fig. 2. The final nucleotide sequence of the HaeII-C and part of the HaeII-D fragments is shown in Fig. 3. The sequence is arranged such that the first nucleotide appears at the left end of the HaeII-C fragment and proceeds rightward (positive) and leftward (negative) from that nucleotide. Results obtained with electron microscopy demonstrated that the origin was 1.746_+0.173 Kb from the EcoR1 site (Ohtsubo et al., 1977). Restriction analysis shows that the HaeII-C
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin
83.2 82.7 83420 J.~Ueleted in I( " ~ - - I pSMi5 pSM2 iI
A. •
i
H/'n f I
HoeTIT Psi T Hpa~
B.
t
t
t
t
~,, B /,~of, t t ,,7o:952o3o 9s~6"
t
t~11
1.11t tt tt il't'
t
t,,Got ! ',
t
/-/hot
p
i
c
t ft t
89.3/0 IS/
~\86.0
it
11ft T
89.6
~-Deleted in pSMI---)
I
i' p tt tt ft
/EcoRl site 8Z2 87.4
1.74s -+0.173 kb ~-2-1.22 _+0.12 kb
I
Homologous to Rscl5
A
Hoe IT }
85.5 I< Orl'~
289
ttl'f t
TTf t
t
i TIT t!t
1/11 11 t t 1'
?F T
,
1' ,
T i
Fig. 1. A Linear representation of the circular plasmids used. pSM2, pSM1 and pSM15 are deletion derivatives of R100. pSM1 and p S M l 5 have different deletions with respect to pSM2 (Mickel et al., 1977). All coordinates are in kilobases from a selected point at an end of an insertion sequence, IS1 present on R100 (Mickel et al., 1977). ori denotes the origin of replication, which proceeds toward the right, as is shown by the arrow. This origin was mapped 1.746+0.173 K b from the EcoR1 site by electron microscopy as shown in the figure (Ohtsubo et al., I977) by averaging the results obtained from three pSM plasmids. Rscl3, which is a plasmid related to pSM plasmids, is homologous with the pSM plasmids in the origin region of replication as shown. In addition, it contains the ampicillin resistance transposon, Tn3, which is not shown in the figure. One end of the homologous region to pSM plasmids has been mapped in relation to the EcoR1 site by electron microscopy as indicated. B The cleavage map of these plasmids with various restriction endonucleases. Only portions of the cleavage map for HpaII, HhaI and AluI are shown. The numbers indicate the number of nucleotides estimated by gel electrophoresis analysis. At the bottom of the figure, the length in bases from the EcoR1 site to the HaeII-C fragment is shown.
84.8
8(3.2
i
i
Hoe IT
HaeIT
I
I
I
I
I
I
El ~
~
IHI
II
~
}
~l
I
Fig. 2. Fragments used in the sequence determination of the origin region. in the 5 ' ~ 3 ' direction. Most strands were obtained by secondary cleavage of complementary strands of a particular region were sequenced. In all cases, polarity were sequenced. We can read approximately 200 bases from the 5' end
fragment begins 1116 bases from the EcoR1 site (see bottom of Fig. 1). The origin was thus mapped in the region contained between nucleotides 194 and 540 as shown by the box in Fig. 3. This region spans one standard deviation from the origin in each direction and thus includes the origin with a confidence level of 68%. If two standard deviations are included in each direction, we can predict with a confidence level greater than 95% that the origin is between nucleotides 21 and 713. Figure 4 shows an autoradiograph used in determining the sequence of part of the critical region appearing at the origin (positions 216 319).
HoeTI
~~
I
;
1
I
The arrows indicate the 5'-32p-labelled strands aligned a fragment labelled at both 5' ends. Whenever possible, however, at least two different fragments of the same of a fragment with high confidence
Relation between Measurements Obtained by the Electron Microscope and those Obtained by Restriction Analysis As described above, the origin of replication was derived from the results of length measurements obtained by electron microscopy. It is therefore important to know the relationship between electron microscopic measurements and measurements obtained from restriction analysis and sequencing results. An Rsc plasmid, Rscl3, carries a transposon Tn3 but is homologous to the pSM plasmids in the region 83.2 86.0 (see Fig. 1A). This is evident from both
290
J. Rosen et al. : Nucleotide Sequence of the RI00 Replication Origin
Nae_I I I
- I O0
GGVCCCCCCCTGTTr CCGGGGGGGACAAA TaqI
-80
V
.
-60 .
.
.
-40 .
.
-20
Hho,I Ha~_II VV
.
TCGATACAAAACACGCCTCACAGACGGGGAATTI-rGCTTATC CACATrAAACTGCAAGGGACI'CCCCATAAGGTrACAACCGTrCATGACATAAAGCGC T AGCTATGTTITGTGCGGAGTGTCTGCCCCTTAAAACGAATAGGTGTAATrTGAC GTTCCCTGAAGGGGTATTCCAATGTr GGCAAGTACTGTATTr CGCG 1
2~
40
60
80
100
i-ATCCGCCAGCGTrACAGG~tTGCAATGTA~-CTTrTAAAC~CCTGTTTAT~TCTC " CTTrA~ACTACTTAA~.TACATr CATI-TAAAAAGN~ACCTATTCA ~ ATAGGCGGT~G~AATGT~A~GTTA~ATAGAAAAl-FFGTGGA~AAATATAGAGGAAAl-FTGATGAATTAATGTAAGTAAATTTTT~Tl-I~TGGA~AAGTG 120
140
Ha.eII I
180
CpaII
I
~
TGCCTGTCCTGTGGACAGAEAGAI~AECTCCCACCGEAAGCGGCGGGtCCC C TACICGGAGCCGCTTTAGTTACAACAETCAGACACAACUtCCAGAAA ACGGACAGGACACCTGTCTGTCTATACGTGGAGGGTGGCGI-rCGCCGCCCGGGGATGGCCTCGGCGAAATCAATGTTGTGAGTCTGTGI-FGGIlGGTCTTT Hloal I / ~p~II H~al 22.0 . 24.0 . HaeIII ~Ip~II v Ha.elIl NcelII _ R,Z~fl 300 AACCCCGGTCCAGCGCAGAACTGAAACCACAAAGCCCCTC CCTCATAACTGAAAAGCGGVccccGCCCCGGC ' CCGAAGGG~;GGAACAGA ' GTCGC1-FTTAA TTGGGGCCAGGTCGCGTCTTGACTI-I'GGTG'I-FTCGGGGAGGGAGTAI-FGACTI-FTC GCCGGGGCGGGGCCGGGCF ' IC ' CCGGCCTTGTCTCAGCGAAAA'I-F 320 400 . . .340 . . 360 • Rae_I . I I • Ho,el I• I l ~ A T G A A T G T T G T A A C T A C T T C A T C A T C GCTGTCAGTCTrCTCGCTGGAAGTTCTCAGTACACGCTCGTAAGCGGCCCTGACGGCCCGCTAACGCGGAGA AATACTTACAACATTGATGAAGTAGTAGCGACAGTCAGAAGAGCGACCI-FCAAGAGTCATGTGCGAGCATTCGC CGGGACTGCCGGGCGA1-FGCGCCTCT 420 440 Hh~I A..f_u.I 460 480 500 TACGCCCCGACTTCGGGTAAACCCTCGT GGGACCACTCC " GACCGCG • CA"CAGAAG • CTCTC . TCATGGC . TGAAAGC.GGGTATGG . TCTGGCAG . GGCTGGGGAT ATGCGGGGCTGAAGCCCATTTGGGAGCAGCCCTGGTGAGGCTGGCGCGTGTC1-FCGAGAGAGTACCGACTI-r CGCCCATACCAGACCGTCCCGACCCCTA i
520
~.z
[
.~..iI
.
s.60
.
5.80
6.00
.
GGGTAAGG~ATCTAT~AATCAGTAc~GG~TrAcG~c~G~TT~GG~GGTT~TAcT~cTGTATcATATGAAACAA~AGAGTGC~GC~TT~ATG~Gc CCCA1-FCCACTTTAGATAGTTAGTCATGGCCGAATGCG G(ICCGAAGCCGCCAAAATGAGGACATAGTATAC1TI'GTTGTCTCACGGCGGAAGGTACGGCG Ee.oRI1" 640 660 680 700
TGATGCGGCATATCCTGGTAA•GATAT•TGAATTGTTATA•ATGTGTATATA•GTGGTAATGA•AAAAATAGGA•AAGTrAAAAATTTA•AGGCGATG•A ACTACG•CGTATAGGA••ATTG•TATAGAcTTAA•AATATGTACA•ATATATG•A••ATTA•TG•rTTTA•••TGTT•AATTTTTAAATGT••GcTACGT H/.~fl 720 Pail 740 760 780 Ha~,Ill ATG~TTCAAACA( ]TAATCAATATCTGCAGTl " ~ -I~ATGCTGGTTATGCTGG~TGCATGGGGCAl . . . -I~AGl-FGGGGAGCCAGATl . . -FGTCATGGAGcAGGCC~.F~ v " TACTAAGTTI'GT( ;ATTAGTTATAGACGTCAAATACGACCAATACGACCGACGTAccCCGTAATcAACCCCTCGGTCTAAACAGTACCTCGTCCGGCAAG 820 840 860 EeoRII . A.P.u.I . . . . . . . • . V • • • TGcTTTATGGATCAGGAAAAAACTATl-rGTTCl-FCAGTCATGGTACTGl-FCTGATGTACCTGCTGTGTGTTTTC~TGGTATACCGCCGTTGGATAGCTCc ACGAAATACCTAGTCCl-Fl-FTTGATAAAcAAGAAGTCAGTACCATGACAAGACTACATGGACGACACACAAAAGGACCATATGGCGGCAACCTATCGAGG HpaII •
"
920 Hh~I ' •
"
940 "
"
NetIII .
•
.
.
.
980
Hh~IV w Na~_II
G~TAcCGGTCGTTGGTCGCTGCGCAA~GTTGGCGTACCGTGGCTGGTCGGTGCGATGGCcGTGGTGTATGTCGGTGTATTTCTGCTCGGTAAGGCG~ CGATGGCCAGCAACCAGCGACGCGl-•GCAACCGCATGGCACCGACCAGCCACGCTACCGGcAcCAcATACAGCCACATAAAGACGAGCCA•I-FCCGCGR
3. Nucleotide sequence of HaeII-C and part of the HaeII-D fragments containing the origin region of pSM1. The sequence is arranged such that the number 1 nucleotide appears at the HaeII-C/D junction. Wedges indicate restriction enzyme cleavage sites on one strand which is aligned in the 5'-~3' direction. The upper strand appears in the 5'--.3" direction and the lower strand in the 3 ' ~ 5 ' orientation. The nucleotides enclosed within the smaller box (194-540) include one standard deviation from the origin; the larger box (21-713) includes two standard deviations. The two boxed triplets are the start (ATG) and stop (TGA) codons of a hypothetical polypeptide. The arrows at nucleotide 882 indicates the Rscl3 junction with Tn3. Nucleotides between 882 and Tn3 are all deleted. * shows the positions of 5-methylcytosine. Note that replication proceeds from the origin toward the right Fig.
endonuclease cleavage fragments from this region produced by various endonucleases and by heteroduplex analysis (Ohtsubo et al., 1977). Results from electron microscopic analysis mapped one end of this homologous region 1.22_+0.12 Kb from the EcoR1 site as shown at the top of Fig. 1A (Ohtsubo et al., 1978). Based on the measurements of the D N A fragments (1.116 Kb) as given in the bottom of Fig. 1B, the junction site must be on the HaeII-C fragment which we have sequenced. Sequencing data shows that the site is at nucleotide 884 on the HaeII-C fragment (Ohtsubo et al., 1979). This point is (1116 + (997 -- 884)) or 1229 bases from the EcoR1 site. This is consistent with the measurement (1.22_+0.12Kb) obtained in the electron microscope. These results indicate that mapping a site by electron microscopy and mapping by calculation of fragment lengths match well.
Essential Regions for Origin Function As described earlier, we have determined the nucleotide sequences of the region containing the origin of replication. Obviously the sequence 885-997, is not necessary for autonomous replication of these plasmids, since Rscl3 deletes this sequence but still replicates. It is also clear that the sequence 730-997 in Fig. 3 is not essential for replication since two PstI fragments obtained from the region to the left of nucleotide 729 are sufficient for normal replication of the plasmid (Kollek et al., 1978). On the other hand, at least part of the sequence 281-528, which is entirely within one standard deviation of the replication origin mapped by electron microscopy is vital for replication of the plasmid, since Oertel et al. in the accompanying paper show that the region is required in cis for replication.
J. Rosen et al. : Nucleotide Sequence of the RI00 Replication Origin
291
Fig. 4. Autoradiographs showing the sequence of the region from 216-319
Characteristic Sequences in the Origin Region Most striking in this sequence are the regions that are extremely rich in A - T or G - C base pairs which appear in large clusters. It can be seen in Fig. 3 that the regions between nucleotides 127-160; 257-286; 372-448 and 481 508 are extremely GC rich while AT rich regions can be found between nucleotides 24-101 ; 167 202; 243 256 and 294 327. Furthermore there is a region showing assymmetry of A's and C's on one strand and T's and G's on the other
strand. Between nucleotides 185 and 255, 56 of 70 residues on one strand are A's and C's. Numerous repeated sequences and dyad symmetries can be found in this region. One of the many possible stem and loop structures that can be drawn is shown in Fig. 5. The most striking feature of this construction is that the large loop occurs in the region at which the origin has been mapped, and also contains the extremely AC rich region on one strand as mentioned above. Since the origin of replication has been defined
292
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin A G
^ACCACAA^ 220..~ACTGA'~
A
C,G C.G C-G G-C--280 G.C C.G C.G C A C A G,C C A C.G C A 260--C-G G T G-C C-G G.C A,T Ao T
~GCCCcT
GAA:~A
G A C G C G A
240~Cc T C C A--300 TA'T ~.A,T A\T-A r./A" T
c
# c ~T-A
C.G
GA
T
G TGG AC / A ' T T T C _A / C.G C-G C-G A A CCCAA" ^cACc 18~) A'T 140--C-G 'AAAGA'-, A-T T,A G-C G.C 200t C.G T-A C.G A.T C,G T.A C-G A C T-A C A C,G G,C l G-C--120 O0~T, l C,G r60 A-T 320 C-G C-G i T,A / 5"-.-AAAACCTAT T CA ATATGCACCT CCCCTACCGGAGCCGCTT CTTCATCATC. . . . . . . . .
Fig.
5.
380 \
C
c'GC'G C C
G-C G-C C.G G.C A-T A A
T-A :360 G-C 400 I C,G I ACACGCT CGGAGATA. . . . . 3'
Possible secondary structure at the pSMI origin of replication
as the beginning of the replicative eye seen in electron microscopy, it is likely that this is the point at which D N A synthesis begins on an R N A primer. Bird and Tomizawa (1978) find at least one ribonucleotide attached to an early replicative fragment 20 40% of the time. Thus it is reasonable that the region to the left of the origin contains the sites used for primer synthesis. Particularly intriguing is the possibility that the large palindromic structure seen in Figure 5 is involved in the initiation of D N A synthesis. Some of the features mentioned above can also be seen in the origin regions of other replicons, such as E. coti (Sugimoto et al., 1978), lambda (DennistonThompson etal., 1977), ColE1 (Tomizawa et al., 1977), G4 (Fiddes et al., 1977) and fd (Geider et al., 1978). Although the sequences are not identical, some similarities can be found when our sequence is compared with other replication systems. This indicates that although control may differ many replicative processes are probably similar. Since the replication systems utilized by the other well characterized systems are rather different than R100 it is not surprising that only general similarities can be found. Many phage systems are known to contain their replication origin within a gene coding for a polypeptide involved in the replication of the phage. In dpX174 the origin of viral strand synthesis is found within the A gene (Baas et al., 1976). In phage lambda the
origin appears within the gene coding for the 0 protein (Furth et al., 1977). pSM1 may also contain its origin within a polypeptide involved in replication. In our sequence there is a reading frame beginning at the A T G start codon at position 125 and terminating at the T G A codon at position 509 (see Fig. 3) which can make a hypothetical protein containing 128 amino acid residues. Preceding the start codon are regions containing possible ribosome binding sequences (Shine and Dalgarno, 1974) as well as regions very rich in A - T base pairs which may contain D N A dependent R N A polymerase recognition and binding sites (see Gilbert, 1976). At present, there is no evidence to support this possibility, but it is interesting because of its similarity with other genetic systems mentioned above. Since we feel that the replication origin presented here contains several functional sites or regions which are involved in the initiation of the replication process in this plasmid, further biochemical and genetic studies are planned to elucidate the mechanism of control of replication by mapping such sites or regions in this small model system.
Acknowledgements. The authors wish to thank W. Goebel for sharing his data before publication, L. L Korn for sending us a copy of his computer program and B. Green and J. Milazzo for their help in making the program operational. Excellent technical assistance was provided by J. Feingold and F. Bartoli. This work was supported by the United States Public Health Service by research
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin grants to E.O. (no. GM22007) and H.O. (IF-32 GM06908-01) and by support to J.R. and H.O. under an NIH training grant (no. CA-09176).
References Baas, P.D., Jansz, H.S., Sinsheimer, R.L.: Bacteriophage ~X174 DNA synthesis in a replication deficient host: Determination of the origin of ~X replication. J. Mol. Biol. 102, 633 656 (1976) Bird, R.E., Tomlzawa, J.: Ribonucleotide-deoxyribonucleotide linkages at the origin of DNA replication of Colicm E1 plasmid. J. Mol. Biol. 120, 137-143 (1978) Clewell, D.B., Helinski, D R.: Supercoiled circular DNA-protein complex in Escherichia coli: purification and induced conversion to an open circular DNA form. Proc. Natl. Acad. Sci. U.S.A. 62, 1159 (1969) Denniston-Thompson, K., Moore, D.D., Krieger, K.E., Furth, M.E., Blattner, F.R. : Physical structure of the replication origin of bacteriophage lambda. Science 198, 1051-1056 (1977) Fiddes, J.C., Barrell, B G., Godson, N.G.: Nucleotide sequences of the separate origins of synthesis of bacteriophage G4 viral and complementary DNA strands. Proc. Natl. Acad. Sci. U.S.A. 75, 1081-1085 (1978) Furth, M.E., Blattner, F.R., McLeester, C., Dove, W.F. : Genetic structure of the replication origin of the bacteriophage lambda. Science 198, 1046 1051 (1977) Geider, K., Beck, E., Schaller, H.: An RNA transcribed from DNA at the origin of phage fd single strand to replicative form conversion. Proc. Natl. Acad. Sci. U.S.A. 75, 645-649 (1978) Gilbert, W.: Starting and stopping sequences for the RNA polymerase. In: RNA polymerase (R. Losick and M. Chamberlin, eds.), pp. 193-205. New York: Cold Spring Harbor Laboratory 1976 Goebel, W., Bonewald, E. : Class of small multicopy plasmids originating from the mutant antibiotic resistance factor R 1drd- 19B2. J. Bacteriol. 123, 658 665 (1975) Kleckner, N.: Translocatable elements in prokaryotes. Cell 11, 11-23 (1977) Kollek, R., Oertel, W., Goebel, W. : Isolation and characterization of the minimal fragment required for autonomous replication ("basic replicon") of a copy mutant (pKN102) of the antibiotic resistance factor R1. Mol. Gen. Genet. 162, 51 57 (1978) Maxam, A., Gilbert, W.: A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74, 560 564 (1977) Mickel, S., Bauer, W.: Isolation by tetracycline selection of small plasmids from the R-factor R12 in Escherchia coli. J. Bacteriol. 127, 644-655 (1976) Mickel, S., Ohtsubo, E., Bauer, W.: Heteroduplex mapping of small plasmids derived from R-factor R12: In vivo recombination occurs at IS1 insertion sequences. Gene 2, i93 210 (1977) Morris, C.F., Hashimoto, H., Mickel, S., Rownd, R.: Round of
293 replication mutant of a drug resistance factor. J. Bacteriol. 118, 855-866 (1974) Nishimura, Y., Caro, L., Berg, C.M., Hirota, Y. : Control of chromosome replication and cell division by an integrated episome. J. Mol. Biol. 55, 441 (1971) Nordstrom, K., Ingrain, L.C., Lundback, A. : Mutations in R-factors of Escherichia coli causing an increased number of R-factor copies per chromosome. J. Bacteriol. 110, 562-569 (1972) Ohtsubo, E., Feingold, J., Ohtsubo, H., Michel, S., Bauer, W.: Unidirectional replication of three small plasmids derived from R factor R12 in Escherichia coli. Plasmid 1, 8-18 (1977) Ohtsubo, E., Rosenbloom, M., Schrempf, H., Goebel, W., Rosen, J.: Site specific recombination involved in the generation of small plasmids. Mol. Gen. Genet. 159, 131-141 (1978) Ohtsubo, H., Ohmori, H., Ohtsubo, E. : Nucleotide sequence analysis of the ampicillin resistance transposon Tn3: Implications for insertion and deletion. Cold Spring Harbor Symp. Quant. Biol. (in press, 1979) Ohtsubo, H., Ohtsubo, E.: Nucleotide sequence of an insertion element, IS1. Proc. Natl. Acad. Sci. U S.A. 75, 615-619 (1978) Roberts, R.J., Breitmeyer, J.B., Tabachnik, N.F., Meyers, P.A.: A second specific endonuclease from Haernophilus aegyptus. J. Mol. Biol. 91, 12I 123 (1975) Sanger, F., Coulson, A.R.: The use of thin acrylamide gels for DNA sequencing. FEBS Lett. 87, 107-110 (1978) Sharp, P.A., Cohen, S.N., Davidson, N. : Electron microscope heteroduplex studies of sequence relations among plasmids of E. coll. 1. Structure of drug resistance (R) and F factors. J. Mol. Biol. 75, 235-255 (1973) Shine, J., Dalgarno, L.: The 3' terminal sequence of E. coli 16s rRNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Scl. U.S.A. 71, 1342-1346 (i 974) Silver, L., Chandler, M., delaTour, E.B., Caro, L.: Origin and direction of replication of the drug resistance plasmid R100.1 and of a resistance transfer factor derivative in syncl~onized cultures. J. Bacteriol. 131, 929 942 (1977) Sugimoto, K., Oka, A., Sugisaki, H., Takanami, M., Nishimura, A., Yasuda, Y., Hirota, Y. : Nucleotide sequence of the replication origin of Escherichia coli K12. Proc. Natl. Acad. Sci. U.S.A. (m press, 1978) Tomizawa, J., Ohmori, H., Bird, R.E.: Origin of replication of colicin E1 plasmid DNA. Proc. Natl. Acad. Sci. USA 74, 1865 1869 (1977) Uhlin, B.E., Nordstrom, K.: Plasmid incompatibility and control of replication: copy mutants of the R-factor R1 of Escherichia coli K12. J. Bacteriol. 124, 641-649 (1975)
Communicated by E. Bautz Received December 12, 1978
The Nucleotide Sequence of the Region Surrounding the Replication Origin of an R100 Resistance Factor Derivative Jonathan Rosen, Hisako Ohtsubo, and Eiichi Ohtsubo Department of Microbiology, State University of New York at Stony Brook, Stony Brook, New York, 11794 USA
Summary. The replication origin of a group of small plasmids derived from R100 was previously determined by electron microscopy (Ohtsubo et al., 1977). This region was subjected to extensive restriction enzyme analysis and the nucleotide sequence of the region containing the replication origin was determined using the Maxam and Gilbert sequencing technique. Various characteristics of this sequence, including a very interesting secondary structure are described and discussed.
Introduction The resistance plasmid R100 is a closed circular DNA molecule 89.3 kilobases (Kb), in length which confers resistance against antibiotics such as streptomycin, chloramphenicol, sulfonamide and tetracycline. R100 utilizes host activities for most replication processes. However, this replication is, in part, controlled by the R-factor itself (Nishimura et al., 1971; Morris et al., 1974). R12, a copy number mutant of R100 has been isolated (Morris et al., 1974) and was found to generate small plasmids known as pSM plasmids capable of autonomous replication (Mickel and Bauer, 1976). Electron microscope heteroduplex analysis of the pSM plasmids demonstrated that the region necessary for replication can be restricted to a small area from 83.0 to 87.2 on the kilobase map of R100 (Mickel et al., 1977). Analysis of replicative molecules of the pSM plasmids pSM1, pSM2 and pSM3 demonstrated that they replicate unidirectionally from a unique origin, defined as the end of the replicative eye seen in electron microscopy. This has been mapped at 85,5 on the R100 map (Ohtsubo For offprints contact: J. Rosen
et al., 1977). The mode of replication of these plasraids appears to be the same as that of the parental R100 plasmid which replicates unidirectionally from the same origin as that found on the pSM plasmids (Silver et al., 1977). Although little is known about the control of replication, it is likely that the controlling mechanism in the replication of R100 is exerted at the initiation stage of replication at its unique replication origin. Another resistance plasmid, R1, is closely related to R100 and confers resistance to streptomycin, chloramphenicol, sulfonamide, kanamycin and ampicillin. It has been shown by heteroduplex analysis that R1, and R100 are homologous except for some small mismatched regions (Sharp et al., 1973) and large DNA insertion sequences, some of which have recently been identified as transposable DNA elements containing various resistance genes (see Kleckner, 1977 for a recent review). Yhe region at the origin of replication in both plasmids is completely homologous, indicating that R1 also replicates unidirectionally from the same unique origin utilized by R100 (Ohtsubo et al., 1978). A class of deletion mutants called Rsc plasmids have been isolated (Goebel and Bonewald, 1975) from a copy mutant of R1, Rldrdl9B2 (Nordstrom et al., 1972; Uhlin and Nordstrom, 1975). The heteroduplex analysis of these plasmids demonstrated that the region necessary for autonomous replication can be further narrowed to an area 2.5 Kb in length which, on the R100 map, is located between 83.2 and 85.7 (Ohtsubo et al., 1978). In this paper we describe the nucleotide sequence surrounding the replication origin of a small replicon derived from R100 and discuss various characteristics of this sequence including its similarities with other replication systems. Oertel et al. in an accompanying paper describes the sequence of a region from the
0026-8925/79/0171/0287/$01.40
288
related plasmid R1 which they find is required for replication in cis. As will be discussed later, their sequence, is almost identical to ours and is found in a Very interesting region of our sequence. Materials and Methods Bacterial Plasmids. The plasmids used in these experiments are pSM1, pSM2, pSM15, and Rscl3. Bacteria harboring a plasmid were grown overnight in L-broth to stationary phase. Cleared lysate containing D N A was prepared by the method of Clewell and Helinski (1969). Covalently closed circular D N A was purified according to Ohtsubo et al. (1978) and the pure D N A was dialyzed against TE buffer containing 0.01 M Tris and 0.001 M EDTA.
Enzymes. EcoR1 and HpalI were purchased from Miles Laboratory and PstI, AluI and HaeII were obtained from Bio Lab, Inc. These enzymes were assayed as recommended by the laboratory from which they were obtained. HinfI and HhaI were kindly supplied by H. Ohmori. HaeIII was isolated according to Roberts et al. (1975). The reaction mixtures for these endonucleases contained 6 m M MgClz, 6 m M 2-mercaptoethanol, 6 mM Tris-HC1 ( p H = 7.9) and bovine serum albumin (500 gg/ml). Polynucleotlde kinase (PL Biochemicals Co.) was used to phosphorylate the 5' ends of the restriction fragments used in sequencing with (gamma-32P) ATP (Amersham). The reaction mixture contained 50 m M Tris1-IC1 (pH=7.5), 10 m M MgC12, and 5 nrM dithiothreitol. Bacterial alkaline phosphatase (36 unitslml), obtained from Worthington Biochemicals, was used in 0.1 M Tris-HC1 (pH=8.0), 10 m M MgCl2.
Gel Electrophoresis. Native D N A fragments were separated by gel electrophoresis on a 13 × 15 x 0.2 cm mixed 0.7% agarose/2.2% polyacrylamide gel or on 4, 7, or 10% polyacrylamide slab gels (acrylamide : bisacrylamide = 20 : 1), D N A bands were visualized by staining with ethidium bromide (4 ~g/ml) under short wavelength UV light. They were then cut out, eluted electrophoretically into dialysis tubing, treated with phenol to remove the ethidium bromide, ethanol precipitated and washed.
Determinatton of Nucleotide Sequences. 5' 32p-labelled D N A fragments were obtained by strand separation or by further cleavage of double stranded D N A labelled at both 5' ends with another restriction endonuclease (Maxam and Gilbert, 1977). The nucleotide sequence of the 5' labelled fragments was determined as described by Maxam and Gilbert (1977) with two modifications (A. Maxam personal communication). A G-specific reaction was used in place of the G > A reaction and an A > C reaction was used in addition to the A > G reaction. Also, in the separation of the chemically modified and degraded products of the five base specific reactions, thin gels 0.04 x 20 x 40 cm (Sanger and Coulson, 1978) were used in addition to those described by Gilbert and Maxam (i977).
Computer Analysis. Computer analysis of the nucleotide sequences which we determined was performed on a Univac 1100 at the State University of New York at Stony Brook. The program was kindly provided by Laurence Jay Korn from the Carnegie Institute of Washington. We generally used the program to determine AC and GT rich regions on one strand in addition to AT and GC rich regions; (Nucleotide richness is defined such that six out of eight consecutive nucleotide bases are those requested); search for inverted and direct repeats ; and examine the possible peptide chains encoded by our sequence.
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin
Results and Discussion
Determination of the Fragments Containing the Origin of Replication A preliminary cleavage map of the pSM plasmids, pSM1, pSM2 and pSM15, constructed with the endonucleases HaeII and HinfI was described previously (Ohtsubo and Ohtsubo, 1978). Figure 1A presents a linear representation of the structures of the circular plasmids, pSM1, pSM2 and pSM15, which contain a common origin of replication. This origin has been located 1.746+0.173 Kbto the left of the EcoRl site (see Fig. 1A). This corresponds to 85.5 in the coordinate system of the pSM plasmids (see the legend to Fig. 1 for further explanation of the coordinate system). Replication of these plasmids proceeds unidirectionally from this origin as indicated in Fig. 1A. The construction of a cleavage map (Fig. 1B) was simplified due to the difference between the structures of these small plasmids. The final construction of this map was performed by elution of the DNA fragments generated by a restriction endonuclease and further digestion of these fragments with a second restriction endonuclease. It was determined that the HaeII-C fragment contained the origin since it spans the distance between 1.1 and 2.0 Kb to the left of the EcoR1 site which is within the range previously determined for the origin, i.e. 1.746 ± 0.173. HaeIl-C and nearby regions were fine mapped with other restriction endonucleases such as HpaII, AluI and HhaI to define fragments that were useful in sequencing this region. Very small fragments (less than 15 nucleotides) were localized as shown in Fig. 1 after sequencing these regions. The sequencing results also confirmed many parts of the cleavage map presented here.
Nucleotide Sequence Analysis of the Origin Region The nucleotide sequence of the HaeII-C and HaeII-D fragments was analyzed according to Maxam and Gilbert (1977). The DNA fragments and strands which were used for the sequence analysis are shown in Fig. 2. The final nucleotide sequence of the HaeII-C and part of the HaeII-D fragments is shown in Fig. 3. The sequence is arranged such that the first nucleotide appears at the left end of the HaeII-C fragment and proceeds rightward (positive) and leftward (negative) from that nucleotide. Results obtained with electron microscopy demonstrated that the origin was 1.746_+0.173 Kb from the EcoR1 site (Ohtsubo et al., 1977). Restriction analysis shows that the HaeII-C
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin
83.2 82.7 83420 J.~Ueleted in I( " ~ - - I pSMi5 pSM2 iI
A. •
i
H/'n f I
HoeTIT Psi T Hpa~
B.
t
t
t
t
~,, B /,~of, t t ,,7o:952o3o 9s~6"
t
t~11
1.11t tt tt il't'
t
t,,Got ! ',
t
/-/hot
p
i
c
t ft t
89.3/0 IS/
~\86.0
it
11ft T
89.6
~-Deleted in pSMI---)
I
i' p tt tt ft
/EcoRl site 8Z2 87.4
1.74s -+0.173 kb ~-2-1.22 _+0.12 kb
I
Homologous to Rscl5
A
Hoe IT }
85.5 I< Orl'~
289
ttl'f t
TTf t
t
i TIT t!t
1/11 11 t t 1'
?F T
,
1' ,
T i
Fig. 1. A Linear representation of the circular plasmids used. pSM2, pSM1 and pSM15 are deletion derivatives of R100. pSM1 and p S M l 5 have different deletions with respect to pSM2 (Mickel et al., 1977). All coordinates are in kilobases from a selected point at an end of an insertion sequence, IS1 present on R100 (Mickel et al., 1977). ori denotes the origin of replication, which proceeds toward the right, as is shown by the arrow. This origin was mapped 1.746+0.173 K b from the EcoR1 site by electron microscopy as shown in the figure (Ohtsubo et al., I977) by averaging the results obtained from three pSM plasmids. Rscl3, which is a plasmid related to pSM plasmids, is homologous with the pSM plasmids in the origin region of replication as shown. In addition, it contains the ampicillin resistance transposon, Tn3, which is not shown in the figure. One end of the homologous region to pSM plasmids has been mapped in relation to the EcoR1 site by electron microscopy as indicated. B The cleavage map of these plasmids with various restriction endonucleases. Only portions of the cleavage map for HpaII, HhaI and AluI are shown. The numbers indicate the number of nucleotides estimated by gel electrophoresis analysis. At the bottom of the figure, the length in bases from the EcoR1 site to the HaeII-C fragment is shown.
84.8
8(3.2
i
i
Hoe IT
HaeIT
I
I
I
I
I
I
El ~
~
IHI
II
~
}
~l
I
Fig. 2. Fragments used in the sequence determination of the origin region. in the 5 ' ~ 3 ' direction. Most strands were obtained by secondary cleavage of complementary strands of a particular region were sequenced. In all cases, polarity were sequenced. We can read approximately 200 bases from the 5' end
fragment begins 1116 bases from the EcoR1 site (see bottom of Fig. 1). The origin was thus mapped in the region contained between nucleotides 194 and 540 as shown by the box in Fig. 3. This region spans one standard deviation from the origin in each direction and thus includes the origin with a confidence level of 68%. If two standard deviations are included in each direction, we can predict with a confidence level greater than 95% that the origin is between nucleotides 21 and 713. Figure 4 shows an autoradiograph used in determining the sequence of part of the critical region appearing at the origin (positions 216 319).
HoeTI
~~
I
;
1
I
The arrows indicate the 5'-32p-labelled strands aligned a fragment labelled at both 5' ends. Whenever possible, however, at least two different fragments of the same of a fragment with high confidence
Relation between Measurements Obtained by the Electron Microscope and those Obtained by Restriction Analysis As described above, the origin of replication was derived from the results of length measurements obtained by electron microscopy. It is therefore important to know the relationship between electron microscopic measurements and measurements obtained from restriction analysis and sequencing results. An Rsc plasmid, Rscl3, carries a transposon Tn3 but is homologous to the pSM plasmids in the region 83.2 86.0 (see Fig. 1A). This is evident from both
290
J. Rosen et al. : Nucleotide Sequence of the RI00 Replication Origin
Nae_I I I
- I O0
GGVCCCCCCCTGTTr CCGGGGGGGACAAA TaqI
-80
V
.
-60 .
.
.
-40 .
.
-20
Hho,I Ha~_II VV
.
TCGATACAAAACACGCCTCACAGACGGGGAATTI-rGCTTATC CACATrAAACTGCAAGGGACI'CCCCATAAGGTrACAACCGTrCATGACATAAAGCGC T AGCTATGTTITGTGCGGAGTGTCTGCCCCTTAAAACGAATAGGTGTAATrTGAC GTTCCCTGAAGGGGTATTCCAATGTr GGCAAGTACTGTATTr CGCG 1
2~
40
60
80
100
i-ATCCGCCAGCGTrACAGG~tTGCAATGTA~-CTTrTAAAC~CCTGTTTAT~TCTC " CTTrA~ACTACTTAA~.TACATr CATI-TAAAAAGN~ACCTATTCA ~ ATAGGCGGT~G~AATGT~A~GTTA~ATAGAAAAl-FFGTGGA~AAATATAGAGGAAAl-FTGATGAATTAATGTAAGTAAATTTTT~Tl-I~TGGA~AAGTG 120
140
Ha.eII I
180
CpaII
I
~
TGCCTGTCCTGTGGACAGAEAGAI~AECTCCCACCGEAAGCGGCGGGtCCC C TACICGGAGCCGCTTTAGTTACAACAETCAGACACAACUtCCAGAAA ACGGACAGGACACCTGTCTGTCTATACGTGGAGGGTGGCGI-rCGCCGCCCGGGGATGGCCTCGGCGAAATCAATGTTGTGAGTCTGTGI-FGGIlGGTCTTT Hloal I / ~p~II H~al 22.0 . 24.0 . HaeIII ~Ip~II v Ha.elIl NcelII _ R,Z~fl 300 AACCCCGGTCCAGCGCAGAACTGAAACCACAAAGCCCCTC CCTCATAACTGAAAAGCGGVccccGCCCCGGC ' CCGAAGGG~;GGAACAGA ' GTCGC1-FTTAA TTGGGGCCAGGTCGCGTCTTGACTI-I'GGTG'I-FTCGGGGAGGGAGTAI-FGACTI-FTC GCCGGGGCGGGGCCGGGCF ' IC ' CCGGCCTTGTCTCAGCGAAAA'I-F 320 400 . . .340 . . 360 • Rae_I . I I • Ho,el I• I l ~ A T G A A T G T T G T A A C T A C T T C A T C A T C GCTGTCAGTCTrCTCGCTGGAAGTTCTCAGTACACGCTCGTAAGCGGCCCTGACGGCCCGCTAACGCGGAGA AATACTTACAACATTGATGAAGTAGTAGCGACAGTCAGAAGAGCGACCI-FCAAGAGTCATGTGCGAGCATTCGC CGGGACTGCCGGGCGA1-FGCGCCTCT 420 440 Hh~I A..f_u.I 460 480 500 TACGCCCCGACTTCGGGTAAACCCTCGT GGGACCACTCC " GACCGCG • CA"CAGAAG • CTCTC . TCATGGC . TGAAAGC.GGGTATGG . TCTGGCAG . GGCTGGGGAT ATGCGGGGCTGAAGCCCATTTGGGAGCAGCCCTGGTGAGGCTGGCGCGTGTC1-FCGAGAGAGTACCGACTI-r CGCCCATACCAGACCGTCCCGACCCCTA i
520
~.z
[
.~..iI
.
s.60
.
5.80
6.00
.
GGGTAAGG~ATCTAT~AATCAGTAc~GG~TrAcG~c~G~TT~GG~GGTT~TAcT~cTGTATcATATGAAACAA~AGAGTGC~GC~TT~ATG~Gc CCCA1-FCCACTTTAGATAGTTAGTCATGGCCGAATGCG G(ICCGAAGCCGCCAAAATGAGGACATAGTATAC1TI'GTTGTCTCACGGCGGAAGGTACGGCG Ee.oRI1" 640 660 680 700
TGATGCGGCATATCCTGGTAA•GATAT•TGAATTGTTATA•ATGTGTATATA•GTGGTAATGA•AAAAATAGGA•AAGTrAAAAATTTA•AGGCGATG•A ACTACG•CGTATAGGA••ATTG•TATAGAcTTAA•AATATGTACA•ATATATG•A••ATTA•TG•rTTTA•••TGTT•AATTTTTAAATGT••GcTACGT H/.~fl 720 Pail 740 760 780 Ha~,Ill ATG~TTCAAACA( ]TAATCAATATCTGCAGTl " ~ -I~ATGCTGGTTATGCTGG~TGCATGGGGCAl . . . -I~AGl-FGGGGAGCCAGATl . . -FGTCATGGAGcAGGCC~.F~ v " TACTAAGTTI'GT( ;ATTAGTTATAGACGTCAAATACGACCAATACGACCGACGTAccCCGTAATcAACCCCTCGGTCTAAACAGTACCTCGTCCGGCAAG 820 840 860 EeoRII . A.P.u.I . . . . . . . • . V • • • TGcTTTATGGATCAGGAAAAAACTATl-rGTTCl-FCAGTCATGGTACTGl-FCTGATGTACCTGCTGTGTGTTTTC~TGGTATACCGCCGTTGGATAGCTCc ACGAAATACCTAGTCCl-Fl-FTTGATAAAcAAGAAGTCAGTACCATGACAAGACTACATGGACGACACACAAAAGGACCATATGGCGGCAACCTATCGAGG HpaII •
"
920 Hh~I ' •
"
940 "
"
NetIII .
•
.
.
.
980
Hh~IV w Na~_II
G~TAcCGGTCGTTGGTCGCTGCGCAA~GTTGGCGTACCGTGGCTGGTCGGTGCGATGGCcGTGGTGTATGTCGGTGTATTTCTGCTCGGTAAGGCG~ CGATGGCCAGCAACCAGCGACGCGl-•GCAACCGCATGGCACCGACCAGCCACGCTACCGGcAcCAcATACAGCCACATAAAGACGAGCCA•I-FCCGCGR
3. Nucleotide sequence of HaeII-C and part of the HaeII-D fragments containing the origin region of pSM1. The sequence is arranged such that the number 1 nucleotide appears at the HaeII-C/D junction. Wedges indicate restriction enzyme cleavage sites on one strand which is aligned in the 5'-~3' direction. The upper strand appears in the 5'--.3" direction and the lower strand in the 3 ' ~ 5 ' orientation. The nucleotides enclosed within the smaller box (194-540) include one standard deviation from the origin; the larger box (21-713) includes two standard deviations. The two boxed triplets are the start (ATG) and stop (TGA) codons of a hypothetical polypeptide. The arrows at nucleotide 882 indicates the Rscl3 junction with Tn3. Nucleotides between 882 and Tn3 are all deleted. * shows the positions of 5-methylcytosine. Note that replication proceeds from the origin toward the right Fig.
endonuclease cleavage fragments from this region produced by various endonucleases and by heteroduplex analysis (Ohtsubo et al., 1977). Results from electron microscopic analysis mapped one end of this homologous region 1.22_+0.12 Kb from the EcoR1 site as shown at the top of Fig. 1A (Ohtsubo et al., 1978). Based on the measurements of the D N A fragments (1.116 Kb) as given in the bottom of Fig. 1B, the junction site must be on the HaeII-C fragment which we have sequenced. Sequencing data shows that the site is at nucleotide 884 on the HaeII-C fragment (Ohtsubo et al., 1979). This point is (1116 + (997 -- 884)) or 1229 bases from the EcoR1 site. This is consistent with the measurement (1.22_+0.12Kb) obtained in the electron microscope. These results indicate that mapping a site by electron microscopy and mapping by calculation of fragment lengths match well.
Essential Regions for Origin Function As described earlier, we have determined the nucleotide sequences of the region containing the origin of replication. Obviously the sequence 885-997, is not necessary for autonomous replication of these plasmids, since Rscl3 deletes this sequence but still replicates. It is also clear that the sequence 730-997 in Fig. 3 is not essential for replication since two PstI fragments obtained from the region to the left of nucleotide 729 are sufficient for normal replication of the plasmid (Kollek et al., 1978). On the other hand, at least part of the sequence 281-528, which is entirely within one standard deviation of the replication origin mapped by electron microscopy is vital for replication of the plasmid, since Oertel et al. in the accompanying paper show that the region is required in cis for replication.
J. Rosen et al. : Nucleotide Sequence of the RI00 Replication Origin
291
Fig. 4. Autoradiographs showing the sequence of the region from 216-319
Characteristic Sequences in the Origin Region Most striking in this sequence are the regions that are extremely rich in A - T or G - C base pairs which appear in large clusters. It can be seen in Fig. 3 that the regions between nucleotides 127-160; 257-286; 372-448 and 481 508 are extremely GC rich while AT rich regions can be found between nucleotides 24-101 ; 167 202; 243 256 and 294 327. Furthermore there is a region showing assymmetry of A's and C's on one strand and T's and G's on the other
strand. Between nucleotides 185 and 255, 56 of 70 residues on one strand are A's and C's. Numerous repeated sequences and dyad symmetries can be found in this region. One of the many possible stem and loop structures that can be drawn is shown in Fig. 5. The most striking feature of this construction is that the large loop occurs in the region at which the origin has been mapped, and also contains the extremely AC rich region on one strand as mentioned above. Since the origin of replication has been defined
292
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin A G
^ACCACAA^ 220..~ACTGA'~
A
C,G C.G C-G G-C--280 G.C C.G C.G C A C A G,C C A C.G C A 260--C-G G T G-C C-G G.C A,T Ao T
~GCCCcT
GAA:~A
G A C G C G A
240~Cc T C C A--300 TA'T ~.A,T A\T-A r./A" T
c
# c ~T-A
C.G
GA
T
G TGG AC / A ' T T T C _A / C.G C-G C-G A A CCCAA" ^cACc 18~) A'T 140--C-G 'AAAGA'-, A-T T,A G-C G.C 200t C.G T-A C.G A.T C,G T.A C-G A C T-A C A C,G G,C l G-C--120 O0~T, l C,G r60 A-T 320 C-G C-G i T,A / 5"-.-AAAACCTAT T CA ATATGCACCT CCCCTACCGGAGCCGCTT CTTCATCATC. . . . . . . . .
Fig.
5.
380 \
C
c'GC'G C C
G-C G-C C.G G.C A-T A A
T-A :360 G-C 400 I C,G I ACACGCT CGGAGATA. . . . . 3'
Possible secondary structure at the pSMI origin of replication
as the beginning of the replicative eye seen in electron microscopy, it is likely that this is the point at which D N A synthesis begins on an R N A primer. Bird and Tomizawa (1978) find at least one ribonucleotide attached to an early replicative fragment 20 40% of the time. Thus it is reasonable that the region to the left of the origin contains the sites used for primer synthesis. Particularly intriguing is the possibility that the large palindromic structure seen in Figure 5 is involved in the initiation of D N A synthesis. Some of the features mentioned above can also be seen in the origin regions of other replicons, such as E. coti (Sugimoto et al., 1978), lambda (DennistonThompson etal., 1977), ColE1 (Tomizawa et al., 1977), G4 (Fiddes et al., 1977) and fd (Geider et al., 1978). Although the sequences are not identical, some similarities can be found when our sequence is compared with other replication systems. This indicates that although control may differ many replicative processes are probably similar. Since the replication systems utilized by the other well characterized systems are rather different than R100 it is not surprising that only general similarities can be found. Many phage systems are known to contain their replication origin within a gene coding for a polypeptide involved in the replication of the phage. In dpX174 the origin of viral strand synthesis is found within the A gene (Baas et al., 1976). In phage lambda the
origin appears within the gene coding for the 0 protein (Furth et al., 1977). pSM1 may also contain its origin within a polypeptide involved in replication. In our sequence there is a reading frame beginning at the A T G start codon at position 125 and terminating at the T G A codon at position 509 (see Fig. 3) which can make a hypothetical protein containing 128 amino acid residues. Preceding the start codon are regions containing possible ribosome binding sequences (Shine and Dalgarno, 1974) as well as regions very rich in A - T base pairs which may contain D N A dependent R N A polymerase recognition and binding sites (see Gilbert, 1976). At present, there is no evidence to support this possibility, but it is interesting because of its similarity with other genetic systems mentioned above. Since we feel that the replication origin presented here contains several functional sites or regions which are involved in the initiation of the replication process in this plasmid, further biochemical and genetic studies are planned to elucidate the mechanism of control of replication by mapping such sites or regions in this small model system.
Acknowledgements. The authors wish to thank W. Goebel for sharing his data before publication, L. L Korn for sending us a copy of his computer program and B. Green and J. Milazzo for their help in making the program operational. Excellent technical assistance was provided by J. Feingold and F. Bartoli. This work was supported by the United States Public Health Service by research
J. Rosen et al. : Nucleotide Sequence of the R100 Replication Origin grants to E.O. (no. GM22007) and H.O. (IF-32 GM06908-01) and by support to J.R. and H.O. under an NIH training grant (no. CA-09176).
References Baas, P.D., Jansz, H.S., Sinsheimer, R.L.: Bacteriophage ~X174 DNA synthesis in a replication deficient host: Determination of the origin of ~X replication. J. Mol. Biol. 102, 633 656 (1976) Bird, R.E., Tomlzawa, J.: Ribonucleotide-deoxyribonucleotide linkages at the origin of DNA replication of Colicm E1 plasmid. J. Mol. Biol. 120, 137-143 (1978) Clewell, D.B., Helinski, D R.: Supercoiled circular DNA-protein complex in Escherichia coli: purification and induced conversion to an open circular DNA form. Proc. Natl. Acad. Sci. U.S.A. 62, 1159 (1969) Denniston-Thompson, K., Moore, D.D., Krieger, K.E., Furth, M.E., Blattner, F.R. : Physical structure of the replication origin of bacteriophage lambda. Science 198, 1051-1056 (1977) Fiddes, J.C., Barrell, B G., Godson, N.G.: Nucleotide sequences of the separate origins of synthesis of bacteriophage G4 viral and complementary DNA strands. Proc. Natl. Acad. Sci. U.S.A. 75, 1081-1085 (1978) Furth, M.E., Blattner, F.R., McLeester, C., Dove, W.F. : Genetic structure of the replication origin of the bacteriophage lambda. Science 198, 1046 1051 (1977) Geider, K., Beck, E., Schaller, H.: An RNA transcribed from DNA at the origin of phage fd single strand to replicative form conversion. Proc. Natl. Acad. Sci. U.S.A. 75, 645-649 (1978) Gilbert, W.: Starting and stopping sequences for the RNA polymerase. In: RNA polymerase (R. Losick and M. Chamberlin, eds.), pp. 193-205. New York: Cold Spring Harbor Laboratory 1976 Goebel, W., Bonewald, E. : Class of small multicopy plasmids originating from the mutant antibiotic resistance factor R 1drd- 19B2. J. Bacteriol. 123, 658 665 (1975) Kleckner, N.: Translocatable elements in prokaryotes. Cell 11, 11-23 (1977) Kollek, R., Oertel, W., Goebel, W. : Isolation and characterization of the minimal fragment required for autonomous replication ("basic replicon") of a copy mutant (pKN102) of the antibiotic resistance factor R1. Mol. Gen. Genet. 162, 51 57 (1978) Maxam, A., Gilbert, W.: A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74, 560 564 (1977) Mickel, S., Bauer, W.: Isolation by tetracycline selection of small plasmids from the R-factor R12 in Escherchia coli. J. Bacteriol. 127, 644-655 (1976) Mickel, S., Ohtsubo, E., Bauer, W.: Heteroduplex mapping of small plasmids derived from R-factor R12: In vivo recombination occurs at IS1 insertion sequences. Gene 2, i93 210 (1977) Morris, C.F., Hashimoto, H., Mickel, S., Rownd, R.: Round of
293 replication mutant of a drug resistance factor. J. Bacteriol. 118, 855-866 (1974) Nishimura, Y., Caro, L., Berg, C.M., Hirota, Y. : Control of chromosome replication and cell division by an integrated episome. J. Mol. Biol. 55, 441 (1971) Nordstrom, K., Ingrain, L.C., Lundback, A. : Mutations in R-factors of Escherichia coli causing an increased number of R-factor copies per chromosome. J. Bacteriol. 110, 562-569 (1972) Ohtsubo, E., Feingold, J., Ohtsubo, H., Michel, S., Bauer, W.: Unidirectional replication of three small plasmids derived from R factor R12 in Escherichia coli. Plasmid 1, 8-18 (1977) Ohtsubo, E., Rosenbloom, M., Schrempf, H., Goebel, W., Rosen, J.: Site specific recombination involved in the generation of small plasmids. Mol. Gen. Genet. 159, 131-141 (1978) Ohtsubo, H., Ohmori, H., Ohtsubo, E. : Nucleotide sequence analysis of the ampicillin resistance transposon Tn3: Implications for insertion and deletion. Cold Spring Harbor Symp. Quant. Biol. (in press, 1979) Ohtsubo, H., Ohtsubo, E.: Nucleotide sequence of an insertion element, IS1. Proc. Natl. Acad. Sci. U S.A. 75, 615-619 (1978) Roberts, R.J., Breitmeyer, J.B., Tabachnik, N.F., Meyers, P.A.: A second specific endonuclease from Haernophilus aegyptus. J. Mol. Biol. 91, 12I 123 (1975) Sanger, F., Coulson, A.R.: The use of thin acrylamide gels for DNA sequencing. FEBS Lett. 87, 107-110 (1978) Sharp, P.A., Cohen, S.N., Davidson, N. : Electron microscope heteroduplex studies of sequence relations among plasmids of E. coll. 1. Structure of drug resistance (R) and F factors. J. Mol. Biol. 75, 235-255 (1973) Shine, J., Dalgarno, L.: The 3' terminal sequence of E. coli 16s rRNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Scl. U.S.A. 71, 1342-1346 (i 974) Silver, L., Chandler, M., delaTour, E.B., Caro, L.: Origin and direction of replication of the drug resistance plasmid R100.1 and of a resistance transfer factor derivative in syncl~onized cultures. J. Bacteriol. 131, 929 942 (1977) Sugimoto, K., Oka, A., Sugisaki, H., Takanami, M., Nishimura, A., Yasuda, Y., Hirota, Y. : Nucleotide sequence of the replication origin of Escherichia coli K12. Proc. Natl. Acad. Sci. U.S.A. (m press, 1978) Tomizawa, J., Ohmori, H., Bird, R.E.: Origin of replication of colicin E1 plasmid DNA. Proc. Natl. Acad. Sci. USA 74, 1865 1869 (1977) Uhlin, B.E., Nordstrom, K.: Plasmid incompatibility and control of replication: copy mutants of the R-factor R1 of Escherichia coli K12. J. Bacteriol. 124, 641-649 (1975)
Communicated by E. Bautz Received December 12, 1978
