E XP ER I ME NTAL C E LL RE S E ARCH
] (]]]]) ]]]–]]]
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells Fei Zhun, Wanfu Yue, Yongxia Wang College of Animal Science and Technology, Zhejiang Agriculture and Forestry University, Hangzhou 311300, China
article information
abstract
Article Chronology:
Nuclear factor kappa B (NF-κB) is a ubiquitous transcription factor which controls the expression
Received 28 February 2014
of various genes involved in immune responses. However, it is not clear whether NF-κB activation
Received in revised form
is critical for phagocytosis when Staphylococcus aureus is the pathogen. Using oligonucleotide
22 April 2014
microarrays, we investigated whether NF-κB cascade genes are altered in a mouse leukemic
Accepted 23 April 2014
monocyte macrophage cell line (RAW 264.7) when the cells were stimulated to activate a host innate immune response against live S. aureus or heat-inactivated S. aureus (HISA). NF-κB cascade
Keywords:
genes such as Nfκb1, Nfκbiz, Nfκbie, Rel, Traf1 and Tnfaip3 were up-regulated by all treatments at
NF-κB
one hour after incubation. NF-κB play an important role in activating phagocytosis in RAW 264.7
Phagocytosis
cells infected with S. aureus. Inhibition of NF-κB significantly blocked phagocytosis of fluores-
Staphylococcus aureus
cently labeled S. aureus and decreased the expression of NFκB1, IL1α, IL1β and TLR2 in this cell
RAW 264.7 cells
line. Our results demonstrate that S. aureus may activate the NF-κB pathway and that NF-κB activation is required for phagocytosis of S. aureus by macrophages. & 2014 Elsevier Inc. All rights reserved.
Introduction Staphylococcus aureus is a major human community- and hospital-acquired pathogen leading to infections that have various morbidities and mortalities [1,2]. The pathogenicity of S. aureus is based partially on its ability to subvert the innate immune system: the pathogen can invade host cells and persist intracellularly in vitro [3]. To survive in the host, S. aureus can evade immune defenses by several mechanisms, including evasion of phagocytosis [4–7]. As a component of innate immunity, macrophages recognize, engulf, and kill invading microorganisms [8–11]. Nuclear factor kappa B (NF-κB) is a ubiquitous transcription factor that controls the expression of various genes involved in
immune responses [12–17]. As an immunoregulatory protein, NF-κB is also important in the pathogenesis of infectious diseases; NF-κB activation is a pathological mechanism of septic shock and inflammation [18–21]. Inhibition of NF-κB activation restores systemic hypotension, ameliorates septic myocardial dysfunction and vascular derangement, inhibits pro-inflammatory expression of multiple genes, diminishes intravascular coagulation, reduces tissue neutrophil influx, and prevents microvascular endothelial leakage [19,22,23]. Peptidoglycan and lipoteichoic acid from S. aureus induces IkBa degradation and NF-κB activation in human osteoblasts [24]; however, it is unclear whether NF-κB activation is critical in the phagocytosis of S. aureus. To address this uncertainty, we investigated the role of NF-κB in the phagocytosis of S. aureus in murine RAW 264.7 cells.
n
Corresponding author. Fax: þ86 571 88981127. E-mail address: [email protected] (F. Zhu).
http://dx.doi.org/10.1016/j.yexcr.2014.04.018 0014-4827/& 2014 Elsevier Inc. All rights reserved.
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
2
E XP E RI ME N TAL CE L L R ES E ARC H
Materials and methods Bacterial strains and culture conditions The S. aureus strains used for these experiments were all derivatives of ATCC25923. S. aureus was grown overnight in Columbia medium (Oxoid, UK) with 2% NaCl and resuspended in PhosphateBuffered Saline (Hyclone, USA), and subsequently heat-inactivated 60 min at 80 1C and stored then at 4 1C.
Cell culture and reagents Mus musculus RAW 264.7 cells (Cell bank of Chinese Academy of Science, China) were cultured in RPMI 1640 medium (Hyclone, USA) supplemented with 10% heat inactivated/refiltered fetal bovine serum (FBS), 10 mM HEPES, 0.11 mg/mL sodium pyruvate, 0.002 M L-glutamine, and penicillin/streptomycin (1 mg/mL, 100 U/mL). RAW 264.7 cells were inoculated with S. aureus at a density of 5 106/mL and incubated for 1 h. At different time points, RAW 264.7 cells were collected for analysis. To investigate the role of NF-κB in endocytosis of heat-inactivated S. aureus (HISA), RAW 264.7 cells were initially incubated with 150 nM NF-κB activation inhibitor IV (EMD Millipore, USA) for five hours and then used in subsequent experiments. NF-κB activation inhibitor IV, (E)-2-fluoro-4ibitor IV,V,MD Mi, is a cell-permeable trans-stilbene resveratrol analog that has enhanced antiinflammatory potency, but no anti-oxidant activity [25].
] (]]]]) ]]]–]]]
Confocal microscopy of phagocytosis RAW 264.7 cells were plated in 6-well plastic tissue culture plates in 1 ml of Schneider's medium with 10% FBS. FITC-labeled (Invitrogen, USA) HISA was added to each well containing RAW 264.7 cells at a density of 5 106 and incubated for various times at 37 1C. Then RAW264.7 cells were treated as previously described [27]. Fluorescent images were taken with a Zeiss Laser scanning systems LSM 510 Meta (Carl Zeiss, Germany). Images were processed using Zeiss LSM Image Examiner Version software, and figures were assembled with Adobe Photoshop (Adobe Systems, USA).
Analysis of mRNA expression by using oligonucleotide arrays Total RNA was extracted from RAW 264.7 cells (1 106) using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Total RNA samples were then sent to CapitalBio Corp. for chip (Affymetrix) assay. Gene expression analysis was performed using the Affymetrix (Santa Clara, CA) mouse genome 430 2.0 array GeneChip, using the manufacturer's protocol. Gene expression analysis was performed with multiple arrays and multiple independent mRNA samples for each treatment. Microarray data were analyzed with Bio MAS (molecule annotation system) 3.0 software (CapitalBio Corporation, Beijing, China). Using the cutoff limitation as a fold-change Z2 or r0.5 and q-valuer5%, differential expression genes were screened and clustered.
RNA extraction and quantitative real-time RT-PCR Transmission electron microscopy and sample preparation RAW 264.7 cells were treated as previously described [26] and sections were cut using a Reichert Ultracut OMU3 microtome (Leica, Germany) at a 100-nm thickness, stained with uranyl acetate/70% methanol. The images were collected on a Hitachi 7650 transmission electron microscope (Hitachi, Japan) operating at 70 kV.
Total RNA was extracted from RAW 264.7 cells (1 106) for each time point by using Trizol reagent (Invitrogen) according to the manufacturer's instructions, and total RNA (5 mg) was reverse transcribed to synthesize cDNA (volume¼20 mL; Reverse Transcriptase M-MLV, Takara). Quantitative RT-PCR was performed on a MyiQ2 Real-Time System (Bio-RAD), and transcripts were measured using Universal Probe Library probes (Takara). The relative expression of target genes was calculated according to
Table 1 – NF-κB cascade genes induced preferentially by HISA or live S. aureus. The numbers in the table refer to a fold change value. Gene name
Description
HISA
S. aureus
Nfkb1 Nfkbiz/IkBζ Nfkbie Ikbkb Ikbkg Rel Rela Tank Traf1 Traf2 Traf5 Traf6 Tradd Tnfaip3/A20 Map3k1 Map3k14
Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, p105 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Inhibitor of kappaB kinase beta Inhibitor of kappaB kinase gamma Reticuloendotheliosis oncogene; NFκB subunit v-rel reticuloendotheliosis viral oncogene homolog A TRAF family member-associated NFκB activator TNF receptor-associated factor 1 TNF receptor-associated factor 2 TNF receptor-associated factor 5 TNF receptor-associated factor 6 TNFRSF1A-associated via death domain Tumor necrosis factor, alpha-induced protein 3 Mitogen-activated protein kinase kinase kinase 1 Mitogen-activated protein kinase kinase kinase 14
1.95 12.38 2.16 0.93 1.01 6.02 1.58 1.27 11.26 1.12 2.51 1.64 1.08 3.28 0.58 1.06
1.51 15.74 2.82 0.86 0.89 3.38 1.41 1.09 12.78 1.09 3.61 1.78 0.74 8.77 0.17 0.79
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
previously published methods [28], using GAPDH as an internal control in RAW 264.7 cells. Primer sequences and UPL probes are shown in Tables 1 and 2. TaqMan Real-time qPCR amplification reactions were carried out in a final volume of 20 ml, containing 10 ml Premix Ex Taq (TaKaRa, Japan), 1 ml diluted cDNA template, 7.2 ml dH2O, 0.3 ml of each TaqMan probe and 0.4 ml of each primer. PCR conditions were as follows: 95 1C for 30 s, followed by 50 cycles of 95 1C for 5 s and 60 1C for 30 s. Resultant data were analyzed using iQTM5 software.
Statistics Data from three independent experiments were analyzed by ANOVA followed by a post-test (Dunnett's, Tukey–Kramer etc.) to calculate the mean and standard deviation (SD) of triplicate assays. Statistical significance was measured using the Student's t-test (two-tailed distribution with a two-sample equal variance; po0.05).
Results S. aureus-induced production of NF-κB cascade genes in macrophages To investigate whether NF-κB cascade genes are altered in the host innate immune response to HISA or live S. aureus, we used oligonucleotide microarrays to perform a genome-wide analysis of RAW 246.7 cells. The results showed that in NF-κB cascade
3
] (]]]]) ]]]–]]]
genes, Nfκb1, Nfκbiz, Nfκbie, Rel, Traf1, Traf5, Traf6 and Tnfaip3/ A20 were significantly up-regulated (po0.01) by HISA or live S. aureus (Table 1). Although most NF-κB cascade genes were upregulated in two treatments, some genes showed different expressions in two treatments. Nfkb1 and Rel were upregulated more by HISA, and Nfkbiz/IkBζ, Nfkbie and Tnfaip3/ A20 were up-regulated more by live S. aureus. And Tradd, Map3k1 and Map3k14 are down-regulated by live S. aureus more than by HISA. These significantly different expressed genes may be involved in the pathogensis of live S. aureus. Two inhibitors of kappa B kinase (Ikbkb and Ikbkg) were down-regulated by live S. aureus but were not affected by HISA. The microarray data showed that S. aureus induced the production of NF-κB cascade genes in RAW 246.7 macrophages at 1 hour post-incubation, indicating NF-κB pathway activation in RAW 246.7 cells.
Inhibition of NF-κB inhibited the phagocytosis of HISA by macrophages As phagocytosis is one of the important roles for macrophages, we investigated the effect of NF-κB knock-down on phagocytosis of S. aureus in murine RAW 246.7 cells. Transmission electron microscopy (TEM) revealed that RAW 264.7 cells phagocytosed HISA at 1 hour post-incubation, but that treatment with an NF-κB inhibitor blocked HISA phagocytosis (Fig. 1). HISA was observed extracellularly in NF-κB-inhibitor treatment but HISA was localized in the membrane of non-treated cells (Fig. 1). To gain further insight into the involvement of the NF-κB
Table 2 – Sequences of forward primer, reverse primer and TaqMan probe used for real-time quantitative RT-PCR. Gene
Forward (left) primer
Reverse (right) primer
TaqMan probe
GAPDH Nfkb1 TLR2 IL1a IL1b
caatgtgtccgtcgtggatct agtgcaaaggaaacgccagaag ataagctgaaaacactcccagatg cgggaggagacgactctaaatatc cctgggctgtcctgatgagag
gtcctcagtgtagcccaagatg gccagggcttccggtactc gaaaagaaccaagttggtc ggtcggtctcactacctgtg tccacgggaaagacacaggta
cgtgccgcctggagaaacctgcc tccgccaccgccactaccga tgttccctgtgttgctggtcatga tggcaactccttcagcaacacgggc tcgcagcagcacatcaacaagagc
Fig. 1 – Transmission electron microscopy (TEM) of phagocytosis of HISA or live S. aureus in RAW 264.7 cells (one hour). Multiple normal RAW 264.7 cells (one hour), Bar¼ 2 lm; Single normal RAW cells. Bar¼1 lm. Phagocytosis of HISA in RAW 264.7 cells. Bar¼2 lm; Enlarged RAW cell, Black arrow indicates internalized HISA. Bar¼1 lm. Phagocytosis of HISA in NF-κB-inhibitortreated RAW 264.7 cells, Bar¼ 2 lm; Enlarged NF-κB-inhibitor-treated RAW cells, Bar¼1 lm. Phagocytosis of live S. aureus in RAW 264.7 cells (one hour). Bar¼ 2 lm; Enlarged RAW cell, Black arrow indicates internalized live S. aureus. Bar¼1 lm. Phagocytosis of live S. aureus in NF-κB-inhibitor-treated RAW 264.7 cells, Bar¼2 lm; Enlarged NF-κB-inhibitor-treated RAW cells, Bar¼1 lm. Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
4
E XP E RI ME N TAL CE L L R ES E ARC H
] (]]]]) ]]]–]]]
signaling pathway in the phagocytosis, the relative expression of NFκB1, inteleukin-1α(IL1α), IL1β and Toll-like receptor 2 (TLR2) was measured with quantitative RT-PCR. HISA treatment significantly increased (po0.05) the expressions of NFκB1, IL1α, IL1β and TLR2 and NF-κB-inhibitor treatment significantly decreased (po0.05) the expression of these genes in RAW 264.7 cells (Fig. 2A). Thus, IL1α and IL1β are likely components of the NFκB signaling pathway that can be induced by NF-κB activation. (Fig. 2A). However, the expressions of NFκB1 and NFκBie after NFκB inhibitor treatment was significantly lower compared to that of the control (Fig. 2C). As shown in Fig. 3A, phagocytosis was observed in HISA treatment at one hour after incubation. NF-κB inhibitor treatment blocked phagocytosis of FITC-labeled HISA in RAW 264.7 cells (Fig. 3A). In addition, actin filaments of RAW 264.7 cells treated with NF-κB-inhibitor were very different compared with that of the other two treatments. NF-κB pathway may be important in affecting actin filaments to activate phagocytosis of S. aureus. Phagocytotic activity of RAW 264.7 cells was measured using flow cytometry detecting FITC-labeled HISA. With inhibition of NF-κB, the rate of phagocytosis in HISA treatment was significantly higher (po0.05) than that of NF-κB inhibitor treatment (Fig. 3B), suggesting that NF-κB activation was required for phagocytosis of HISA by macrophages.
Inhibition of NF-κB inhibited the phagocytosis of live S. aureus by macrophages
Fig. 2 – (A) mRNA analysis of NFκB1, IL1α, IL1β and TLR2 with three treatments at one-hour post-incubation in RAW 264.7 cells using quantitative RT–PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05). (B) mRNA analysis of NFκB1, IL1α, IL1β and TLR2
TEM results showed that RAW 264.7 cells phagocytosed live S. aureus at 1 hour post-incubation, but that treatment with an NF-κB inhibitor blocked live S. aureus phagocytosis (Fig. 1). Next, we analyzed the expression profile of NFκB1, IL1α, IL1β and TLR2 to investigate the process of phagocytosis in RAW 264.7 cells. The four genes expression of live S. aureus was significantly higher (po0.05) than that of control at 1 hour post-incubation (Fig. 1). Phagocytotic activity of RAW 264.7 cells was measured using flow cytometry detecting FITC-labeled live S. aureus. Confocal microscopy showed that phagocytosis of live S. aureus was observed at 1 hour post-incubation and NF-κB inhibitor treatment blocked phagocytosis of live S. aureus in RAW 264.7 cells (Fig. 4A). In addition, actin filaments of NF-κB-inhibitor-treated RAW 264.7 cells were significantly changed like the previous HISA plus NFκB-inhibitor treatment. NF-κB may affect the phagocytosis of S. aureus with the regulation of cytoskeleton organization. Phagocytosis of FITC-labeled live S. aureus was quantified to evaluate phagocytotic activity. The rate of phagocytosis in HISA treatment was significantly higher (po0.05) than that of NF-κB inhibitor treatment (Fig. 4B), indicating that NF-κB was required for activating phagocytosis of live S. aureus by macrophages.
with three treatments at one-hour post-incubation in RAW 264.7 cells using quantitative RT-PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05). (C) Effects of the inhibition of NF-κB activity on expressions of genes of NF-κB pathway. RAW264.7 cells were treated with the NF-κB inhibitor. The expressions of NFκB1 and NFκBie genes were evaluated using real-time PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05).
Discussion S. aureus is an important nosocomial and community-acquired pathogen and a leading cause of human infections worldwide [1,2]. HISA is a common model for studying phagocytosis, phagosome acidification, bacterial recognition, and cytokine production in response to S. aureus in phagocytes [29–32]. Here, we report that HISA induced production of NFκB1, IL1α, IL1β and TLR2 and
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
] (]]]]) ]]]–]]]
5
Fig. 3 – The role of NF-κB on phagocytosis of HISA by RAW 264.7 cells. (A) Confocal microscopy of phagocytosis of FITC-labeled HISA by RAW 264.7 cells at 1 hour post incubation (up, 100 , Bar¼ 10 lm; down, 400 , Bar¼ 5 lm). (B) Phagocytosis percentage of FITC-labeled HISA (down, 100 ) by RAW 264.7 cells at one-hour post incubation. Number of RAW 264.7 cells phagocytosing FITClabeled HISA was quantified using flow cytometry at one-hour post-incubation. Non-treated S2 cells were controls. Statistically significant differences between treatments were indicated with asterisks (*Po0.05).
that inhibition of NF-κB decreased NFκB1, IL1α, IL1β and TLR2 expression. S. aureus protein A (SpA) can bind to tumor necrosis factor receptor-1 (TNFR-1) and activate NF-κB in osteoblasts [33], and S. aureus can activate NF-κB in human osteoblasts, but the actual attachment of S. aureus is required for activation in response to infection [34]. To determine whether S. aureus can
activate the NF-κB signaling pathway in macrophages, we performed a genome-wide analysis on RAW 246.7 cells and found that HISA can activate the NF-κB pathway in this cell line at one hour after incubation and significantly different expressed genes between HISA and S. aureus may be involved in the pathogensis of live S. aureus. Gram-positive bacteria and lipopeptides activate
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
6
E XP E RI ME N TAL CE L L R ES E ARC H
] (]]]]) ]]]–]]]
Fig. 4 – The role of NF-κB in phagocytosis of Live S. aureus by RAW 264.7 cells. (A) Confocal microscopy of phagocytosis of FITClabeled live S. aureus by RAW 264.7 cells at 1 hour post incubation (up, 100 , Bar¼ 10 lm; down, 400 , Bar¼ 5 lm). (B) Phagocytosis percentage of FITC-labeled live S. aureus (down, 100 ) by RAW 264.7 cells at 1 hour post incubation. Number of RAW 264.7 cells phagocytosing FITC-labeled live S. aureus was quantified using flow cytometry at one-hour post-incubation. Nontreated S2 cells were controls. Statistically significant differences between treatments were indicated with asterisks (*po0.05). macrophages through pattern recognition receptors such as Tolllike receptor 2 (TLR2), which is recruited to phagosomes and discriminates among pathogens [35–36]. Micrococci and peptidoglycan can activate the TLR2-MyD88-IRAK-TRAF-NIK-
IKK-NF-κB signal transduction pathway [37], and TLR2 can mediate activation of transcription factor NF-κB [38–40]. We found that HISA induced expression of NFκB1 and TLR2 and NFκB inhibitor treatment decreased TLR2 expression much. TLR2
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
was found to regulate the secretion of IL1 via distinct mechanisms in response to Listeria monocytogenes [41]. The interleukin (IL1) family is closely linked to the innate immune response and controls inflammation [42]. S. aureus infection would result in production of IL-1β in endothelial cells [43]. IL1 produced by phagocytes is an important cytokine orchestrating host defense against S. aureus [44–46]. IL1β is an important pro-inflammatory cytokine that activates monocytes, macropages, and neutrophils [47]. IL1 activates transcription factor NF-κB, and NF-κB regulates the induction of IL1β transcription [48–50]. HISA induces expression of NFκB1, IL1α, IL1β and TLR2 simultaneously and NF-κB regulates induction of IL1α and IL1β transcription. Our data suggest that NF-κB may regulate phargocyte activation via the induction of cytokine production. Phagocytic stimuli have been reported to induce NF-κB activation, and expression of kappa B-responsive genes was reported to be enhanced in neutrophils [51]. A novel NF-κB inhibitor, dehydroxymethylepoxyquinomicin, was found to inhibit allergic inflammation and airway remodeling in mice [52]. Resveratrol was found to control phagocytosis of Escherichia coli and of S. aureus through an NF-κB-dependent gene program [53]. To our knowledge, our study is the first to offer evidence of the involvement of NF-κB in phagocytosis of S. aureus by macrophages. Blockade of NF-κB activation with an NF-κB inhibitor revealed inhibition the phagocytosis of S. aureus in RAW 264.7 cells. As scientists better understand the regulation of the NF-κB pathway, the therapeutic potential for inhibiting this pathway to treat inflammation and cancer is gaining attention [54]. However, therapeutic inhibition of classical NF-κB activation in macrophages, as we demonstrated in RAW 264.7 cells, may hamper the initiation of adaptive immunity [55]. Inhibition of NF-κB activation was found to inhibit phagocytic activity in murine macrophage in this study. So the therapeutic potential of inhibition NF-κB pathway should be carefully assessed by further investigation for the destructive potential of immune system.
Acknowledgments This work was financially supported by National Natural Science Foundation of China, People's Republic of China (31370050), the National Basic Research Program of China (2012CB114403) and National High-tech R&D Program (863 Program) (2012AA0922052) and The Development of Scientific Research Fund Project of Zhejiang Agriculture and Forestry University (2012FR019).
[7]
[8]
[9] [10]
[11]
[12] [13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
references [1] G.L. Archer, Staphylococus aureus: a well-armed pathogen, Clin. Infect. Dis. 26 (1998) 1179–1181. [2] F.D. Lowy, Staphylococcus aureus infections, N. Engl. J. Med. 339 (1998) 520–532. [3] C. Garzoni, W.L. Kelley, Staphylococcus aureus: new evidence for intracellular persistence, Trends Microbiol. 17 (2009) 59–65. [4] T.J. Foster, Immune evasion by staphylococci, Nat. Rev. Microbiol. 3 (2005) 948–958. [5] S.H. Rooijakkers, K.P. van-Kessel, J.A. van-Strijp, Staphylococcal innate immune evasion, Trends Microbiol. 13 (2005) 596–601. [6] R. Yokoyama, S. Itoh, G. Kamoshida, T. Takii, S. Fujii, T. Tsuji, K. Onozaki, Staphylococcal superantigen-like protein 3 binds to the Toll-like receptor 2 extracellular domain and inhibits
[22]
[23]
[24]
[25]
] (]]]]) ]]]–]]]
7
cytokine production induced by Staphylococcus aureus, cell wall component, or lipopeptides in murine macrophages, Infect. Immun. 80 (2012) 2816–2825. B.W. Bardoel, R. Vos, T. Bouman, P.C. Aerts, J. Bestebroer, E.G. Huizinga, T.H. Brondijk, J.A. van Strijp, C.J. de Haas, Evasion of Toll-like receptor 2 activation by staphylococcal superantigenlike protein 3, J. Mol. Med. 90 (2012) 1109–1120. R.S. Flannagan, G. Cosio, S. Grinstein, Antimicrobial mechanisms of phagocytes and bacterial evasion strategies, Nat. Rev. Microbiol. 7 (2009) 355–366. R.S. Flannagan, V. Jaumouille, S. Grinstein, The cell biology of phagocytosis, Annu. Rev. Pathol. 7 (2012) 61–98. J. Koziel, A. Maciag-Gudowska, T. Mikolajczyk, M. Bzowska, D.E. Sturdevant, A.R. Whitney, L.N. Shaw, F.R. DeLeo, J. Potempa, Phagocytosis of Staphylococcus aureus by macrophages exerts cytoprotective effects manifested by the upregulation of antiapoptotic factors, PLOS One 4 (2009) e5210. A.M. Houghton, W.O. Hartzell, C.S. Robbins, F.X. Gomis-Rüth, S.D. Shapiro, Macrophage elastase kills bacteria within murine macrophages, Nature 460 (2009) 637–641. P.A. Baeuerle, T. Henkel, Function and activation of NF-kappa B in the immune system, Annu. Rev. Immunol. 12 (1994) 141–179. S. Ghosh, M.J. May, E.B. Kopp, NF-κB and Rel proteins: evolutionarily conserved mediators of immune responses, Annu. Rev. Immunol. 16 (1998) 225–260. S. Gerondakis, R. Grumont, I. Rourke, M. Grossmann, The regulation and roles of Rel/NF-κB transcription factors during lymphocyte activation, Curr. Opin. Immunol. 10 (1998) 353–359. F. Chen, V. Castranova, X. Shi, L.M. Demers, New insights into the role of nuclear factor-kappaB, a ubiquitous transcription factor in the initiation of diseases, Clin. Chem. 45 (1999) 7–17. E. Dale, M. Davis, D.L. Faustman, A role for transcription factor NFkappaB in autoimmunity: possible interactions of genes, sex, and the immune response, Adv. Physiol. Educ. 30 (2006) 152–158. M.C. Maiuri, G. Tajana, T. Iuvone, D. De-Stefano, G. Mele, M.T. Ribecco, M.P. Cinelli, M.F. Romano, M.C. Turco, R. Carnuccio, Nuclear factor-kappaB regulates inflammatory cell apoptosis and phagocytosis in rat carrageenin-sponge implant model, Am. J. Pathol. 165 (2004) 115–126. B. Spellerberg, C. Rosenow, W. Sha, E.I. Tuomanen, Pneumococcal cell wall activates NF-kappa B in human monocytes: aspects distinct from endotoxin, Microb. Pathog. 20 (1996) 309–317. S.F. Liu, A.B. Malik, NF-kappa B activation as a pathological mechanism of septic shock and inflammation, Am. J. Physiol. Lung Cell. Mol. Physiol. 290 (2006) L622–L645. C. Toma, N. Higa, Y. Koizumi, N. Nakasone, Y. Ogura, A.J. McCoy, L. Franchi, S. Uematsu, J. Sagara, S. Taniguchi, H. Tsutsui, S. Akira, J. Tschopp, G. Nunez, T. Suzuki, Pathogenic Vibrio activate NLRP3 inflammasome via cytotoxins and TLR/nucleotide-binding oligomerization domain-mediated NF-kappa B signaling, J. Immunol. 184 (2010) 5287–5297. A.M. Pinto, P.C. Sales, E.R. Camargos, A.M. Silva, Tumour necrosis factor (TNF)-mediated NF-κB activation facilitates cellular invasion of non-professional phagocytic epithelial cell lines by Trypanosoma cruzi, Cell. Microbiol. 13 (2011) 1518–1529. S.F. Liu, X. Ye, A.B. Malik, Inhibition of NF-kappaB activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes, Circulation 100 (1999) 1330–1337. M. Di-Giuseppe, F. Gambelli, G.W. Hoyle, G. Lungarella, S.M. Studer, T. Richards, S. Yousem, K. McCurry, J. Dauber, N. Kaminski, G. Leikauf, L.A. Ortiz, Systemic inhibition of NF-kappaB activation protects from silicosis, PLOS One 4 (2009) e5689. R. Ning, X. Zhang, X. Guo, Q. Li, Attachment of Staphylococcus aureus is required for activation of nuclear factor kappa B in human osteoblasts, Acta Biochim. Biophys. Sin. 42 (2010) 883–892. J.J. Heynekamp, W.M. Weber, L.A. Hunsaker, A.M. Gonzales, R.A. Orlando, L.M. Deck, D.L. Jagt, Substituted trans-stilbenes,
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
8
E XP E RI ME N TAL CE L L R ES E ARC H
[26]
[27]
[28] [29]
[30]
[31]
[32]
[33]
[34]
[35] [36]
[37]
[38]
[39]
including analogues of the natural product resveratrol, inhibit the human tumor necrosis factor alpha-induced activation of transcription factor nuclear factor kappa B, J. Med. Chem. 49 (2006) 7182–7189. A.L. Fedrow, T.V. Ohlen, D. Boyle, R.R. Ganta, S.K. Chapes, Use of Drosophila S2 cells as a model for studying Ehrlichia chaffeensis infections, Appl. Environ. Microbiol. 74 (2008) 1886–1891. F. Zhu, X. Zhang., The Wnt signaling pathway is involved in the regulation of phagocytosis of virus in Drosophila, Sci. Rep. 3 (2013) 2069. M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucl. Acids Res 29 (2001) e45. R. Kapetanovic, M.A. Nahori, V. Balloy, C. Fitting, D.J. Philpott, J.M. Cavaillon, M. Adib-Conquy, Contribution of phagocytosis and intracellular sensing for cytokine production by Staphylococcus aureus-activated macrophages, Infect. Immun. 75 (2007) 830–837. R. Kapetanovic, M. Parlato, C. Fitting, V. Quesniaux, J.M. Cavaillon, M. Adib-Conquy, Mechanisms of TNF induction by heat-killed Staphylococcus aureus differ upon the origin of mononuclear phagocytes, Am. J. Physiol. Cell. Physiol 300 (2011) C850–C859. J.B. Wardenburg, W.A. Williams, D. Missiakas, Host defenses against Staphylococcus aureus infection require recognition of bacterial lipoproteins, Proc. Natl. Acad. Sci. USA 103 (2006) 13831–13836. W.K. Ip, A. Sokolovska, G.M. Charriere, L. Boyer, S. Dejardin, M.P. Cappillino, L.M. Yantosca, K. Takahashi, K.J. Moore, A. Lacy-Hulbert, L.M. Stuart, Phagocytosis and phagosome acidification are required for pathogen processing and MyD88dependent responses to Staphylococcus aureus, J. Immunol. 184 (2010) 7071–7081. T. Claro, A. Widaa, C. McDonnell, T.J. Foster, F.J. O’Brien, S.W. Kerrigan, Staphylococcus aureus protein A binding to osteoblast tumour necrosis factor receptor 1 results in activation of nuclear factor kappa B and release of interleukin-6 in bone infection, Microbiology 159 (2013) 147–154. R. Dziarski, Q. Wang, C.J. Kirschning, K. Miyake, D. Gupta, MD-2 enables Toll-like receptor-2 (TLR2)-mediated responses to LPS and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components, J. Immunol. 166 (2001) 1938–1944. K. Takeda, O. Takeuchi, S. Akira, Recognition of lipopeptides by Toll-like receptors, J. Endotoxin Res. 8 (2002) 459–463. M. Azuma, R. Sawahata, Y. Akao, T. Ebihara, S. Yamazaki, M. Matsumoto, M. Hashimoto, K. Fukase, Y. Fujimoto, T. Seya, The peptide sequence of diacyl lipopeptides determines dendritic cell TLR2-mediated NK activation, PLOS One 5 (2010) e12550. G. Zhang, S. Ghosh, Toll-like receptor-mediated NF-kappa B activation: a phylogenetically conserved paradigm in innate immunity, J. Clin. Invest. 107 (2001) 13–19. L. Arbibe, J.P. Mira, N. Teusch, L. Kline, M. Guha, N. Mackman, P.J. Godowski, R.J. Ulevitch, U.G. Knaus, Toll-like receptor 2-mediated NF-kappa B activation requires a Rac1-dependent pathway, Nat. Immunol. 1 (2000) 533–540. F. Sandor, E. Latz, F. Re, L. Mandell, G. Repik, D.T. Golenbock, T. Espevik, E.A. Kurt-Jones, R.W. Finberg, Importance of extraand intracellular domains of TLR1 and TLR2 in NFkappa B signaling, J. Cell Biol. 162 (2003) 1099–1110.
] (]]]]) ]]]–]]]
[40] N. Ozoren, J. Masumoto, L. Franchi, T.D. Kanneganti, M. BodyMalapel, I. Erturk, R. Jagirdar, L. Zhu, N. Inohara, J. Bertin, A. Coyle, E.P. Grant, G. Nunez, Distinct roles of TLR2 and the adaptor ASC in IL-1beta/IL-18 secretion in response to Listeria monocytogenes, J. Immunol. 176 (2006) 4337–4342. [41] C.A. Dinarello, Immunological and inflammatory functions of the interleukin-1 family, Annu. Rev. Immunol. 27 (2009) 519–550. [42] L. Yao, V. Bengualid, F.D. Lowy, J.J. Gibbons, V.B. Hatcher, J.W. Berman, Internalization of Staphylococcus aureus by endothelial cells induces cytokine gene expression, Infect. Immun. 63 (1995) 1835–1839. [43] T. Kielian, E.D. Bearden, A.C. Baldwin, N. Esen, IL-1 and TNFalpha play a pivotal role in the host immune response in a mouse model of Staphylococcus aureus-induced experimental brain abscess, J. Neuropathol. Exp. Neurol. 63 (2004) 381–396. [44] M. Verdrengh, J.A. Thomas, O.H. Hultgren, IL-1 receptor-associated kinase 1 mediates protection against Staphylococcus aureus infection, Microbes Infect. 6 (2004) 1268–1272. [45] L.S. Miller, E.M. Pietras, L.H. Uricchio, K. Hirano, S. Rao, H. Lin, R. M. O’Connell, Y. Iwakura, A.L. Cheung, G. Cheng, R.L. Modlin, Inflammasome-mediated production of IL-1beta is required for neutrophil recruitment against Staphylococcus aureus in vivo, J. Immunol. 179 (2007) 6933–6942. [46] M.G. Netea, A. Simon, F. van de Veerdonk, B.J. Kullberg, J.W.M. Van der Meer, L.A. Joosten, IL-1β processing in host defense: beyond the inflammasomes, PLOS Pathog. 6 (2010) e1000661. [47] P.N. Moynagh, D.C. Williams, L.A.J. O’Neill, Interleukin-1 activates transcription factor NFκB in glial cells, Biochem. J. 294 (1993) 343–347. [48] E. Stylianou, L.A.J. O’Neill, L. Rawlinson, M.R. Edbrooke, P. Woo, J. Saklatvala, Interleukin 1 induces NF-κB through its type I but not its type II receptor in lymphocytes, J. Biol. Chem. 267 (1992) 15836–15841. [49] J.P. Cogswell, M.M. Godlevski, G.B. Wisely, W.C. Clay, L.M. Leesnitzer, J.P. Ways, J.G. Gray, NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site, J. Immunol. 153 (1994) 712–723. [50] P.P. McDonald, M.A. Cassatella, Activation of transcription factor NF-kappa B by phagocytic stimuli in human neutrophils, FEBS Lett. 412 (1997) 583–586. [51] E. Suzuki, K. Umezawa, Inhibition of macrophage activation and phagocytosis by a novel NF-kappaB inhibitor, dehydroxymethylepoxyquinomicin, Biomed. Pharmacother. 60 (2006) 578–586. [52] K. Shimizu, S. Konno, M. Ozaki, K. Umezawa, K. Yamashita, S. Todo, M. Nishimura, Dehydroxymethylepoxyquinomicin (DHMEQ), a novel NF-kappaB inhibitor, inhibits allergic inflammation and airway remodeling in murine models of asthma, Clin. Exp. Allergy 42 (2012) 1273–12781. [53] Y. Yamamoto, R.B. Gaynor, Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer, J. Clin. Invest. 107 (2001) 135–142. [54] G. Zhang, R. Liu, Y. Zhong, A.N. Plotnikov, W. Zhang, L. Zeng, E. Rusinova, G. Gerona-Nevarro, N. Moshkina, J. Joshua, P.Y. Chuang, M. Ohlmeyer, J.C. He, M.M. Zhou, Down-regulation of NF-κB transcriptional activity in HIV-associated kidney disease by BRD4 inhibition, J. Biol. Chem. 287 (2012) 28840–28851. [55] H.V. Groesdonk, S. Schlottmann, F. Richter, M. Georgieff, U. Senftleben, Escherichia coli prevents phagocytosis-induced death of macrophages via classical NF-κB signaling, a link to T-cell activation, Infect. Immun. 74 (2006) 5989–6000.
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
] (]]]]) ]]]–]]]
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells Fei Zhun, Wanfu Yue, Yongxia Wang College of Animal Science and Technology, Zhejiang Agriculture and Forestry University, Hangzhou 311300, China
article information
abstract
Article Chronology:
Nuclear factor kappa B (NF-κB) is a ubiquitous transcription factor which controls the expression
Received 28 February 2014
of various genes involved in immune responses. However, it is not clear whether NF-κB activation
Received in revised form
is critical for phagocytosis when Staphylococcus aureus is the pathogen. Using oligonucleotide
22 April 2014
microarrays, we investigated whether NF-κB cascade genes are altered in a mouse leukemic
Accepted 23 April 2014
monocyte macrophage cell line (RAW 264.7) when the cells were stimulated to activate a host innate immune response against live S. aureus or heat-inactivated S. aureus (HISA). NF-κB cascade
Keywords:
genes such as Nfκb1, Nfκbiz, Nfκbie, Rel, Traf1 and Tnfaip3 were up-regulated by all treatments at
NF-κB
one hour after incubation. NF-κB play an important role in activating phagocytosis in RAW 264.7
Phagocytosis
cells infected with S. aureus. Inhibition of NF-κB significantly blocked phagocytosis of fluores-
Staphylococcus aureus
cently labeled S. aureus and decreased the expression of NFκB1, IL1α, IL1β and TLR2 in this cell
RAW 264.7 cells
line. Our results demonstrate that S. aureus may activate the NF-κB pathway and that NF-κB activation is required for phagocytosis of S. aureus by macrophages. & 2014 Elsevier Inc. All rights reserved.
Introduction Staphylococcus aureus is a major human community- and hospital-acquired pathogen leading to infections that have various morbidities and mortalities [1,2]. The pathogenicity of S. aureus is based partially on its ability to subvert the innate immune system: the pathogen can invade host cells and persist intracellularly in vitro [3]. To survive in the host, S. aureus can evade immune defenses by several mechanisms, including evasion of phagocytosis [4–7]. As a component of innate immunity, macrophages recognize, engulf, and kill invading microorganisms [8–11]. Nuclear factor kappa B (NF-κB) is a ubiquitous transcription factor that controls the expression of various genes involved in
immune responses [12–17]. As an immunoregulatory protein, NF-κB is also important in the pathogenesis of infectious diseases; NF-κB activation is a pathological mechanism of septic shock and inflammation [18–21]. Inhibition of NF-κB activation restores systemic hypotension, ameliorates septic myocardial dysfunction and vascular derangement, inhibits pro-inflammatory expression of multiple genes, diminishes intravascular coagulation, reduces tissue neutrophil influx, and prevents microvascular endothelial leakage [19,22,23]. Peptidoglycan and lipoteichoic acid from S. aureus induces IkBa degradation and NF-κB activation in human osteoblasts [24]; however, it is unclear whether NF-κB activation is critical in the phagocytosis of S. aureus. To address this uncertainty, we investigated the role of NF-κB in the phagocytosis of S. aureus in murine RAW 264.7 cells.
n
Corresponding author. Fax: þ86 571 88981127. E-mail address: [email protected] (F. Zhu).
http://dx.doi.org/10.1016/j.yexcr.2014.04.018 0014-4827/& 2014 Elsevier Inc. All rights reserved.
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
2
E XP E RI ME N TAL CE L L R ES E ARC H
Materials and methods Bacterial strains and culture conditions The S. aureus strains used for these experiments were all derivatives of ATCC25923. S. aureus was grown overnight in Columbia medium (Oxoid, UK) with 2% NaCl and resuspended in PhosphateBuffered Saline (Hyclone, USA), and subsequently heat-inactivated 60 min at 80 1C and stored then at 4 1C.
Cell culture and reagents Mus musculus RAW 264.7 cells (Cell bank of Chinese Academy of Science, China) were cultured in RPMI 1640 medium (Hyclone, USA) supplemented with 10% heat inactivated/refiltered fetal bovine serum (FBS), 10 mM HEPES, 0.11 mg/mL sodium pyruvate, 0.002 M L-glutamine, and penicillin/streptomycin (1 mg/mL, 100 U/mL). RAW 264.7 cells were inoculated with S. aureus at a density of 5 106/mL and incubated for 1 h. At different time points, RAW 264.7 cells were collected for analysis. To investigate the role of NF-κB in endocytosis of heat-inactivated S. aureus (HISA), RAW 264.7 cells were initially incubated with 150 nM NF-κB activation inhibitor IV (EMD Millipore, USA) for five hours and then used in subsequent experiments. NF-κB activation inhibitor IV, (E)-2-fluoro-4ibitor IV,V,MD Mi, is a cell-permeable trans-stilbene resveratrol analog that has enhanced antiinflammatory potency, but no anti-oxidant activity [25].
] (]]]]) ]]]–]]]
Confocal microscopy of phagocytosis RAW 264.7 cells were plated in 6-well plastic tissue culture plates in 1 ml of Schneider's medium with 10% FBS. FITC-labeled (Invitrogen, USA) HISA was added to each well containing RAW 264.7 cells at a density of 5 106 and incubated for various times at 37 1C. Then RAW264.7 cells were treated as previously described [27]. Fluorescent images were taken with a Zeiss Laser scanning systems LSM 510 Meta (Carl Zeiss, Germany). Images were processed using Zeiss LSM Image Examiner Version software, and figures were assembled with Adobe Photoshop (Adobe Systems, USA).
Analysis of mRNA expression by using oligonucleotide arrays Total RNA was extracted from RAW 264.7 cells (1 106) using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Total RNA samples were then sent to CapitalBio Corp. for chip (Affymetrix) assay. Gene expression analysis was performed using the Affymetrix (Santa Clara, CA) mouse genome 430 2.0 array GeneChip, using the manufacturer's protocol. Gene expression analysis was performed with multiple arrays and multiple independent mRNA samples for each treatment. Microarray data were analyzed with Bio MAS (molecule annotation system) 3.0 software (CapitalBio Corporation, Beijing, China). Using the cutoff limitation as a fold-change Z2 or r0.5 and q-valuer5%, differential expression genes were screened and clustered.
RNA extraction and quantitative real-time RT-PCR Transmission electron microscopy and sample preparation RAW 264.7 cells were treated as previously described [26] and sections were cut using a Reichert Ultracut OMU3 microtome (Leica, Germany) at a 100-nm thickness, stained with uranyl acetate/70% methanol. The images were collected on a Hitachi 7650 transmission electron microscope (Hitachi, Japan) operating at 70 kV.
Total RNA was extracted from RAW 264.7 cells (1 106) for each time point by using Trizol reagent (Invitrogen) according to the manufacturer's instructions, and total RNA (5 mg) was reverse transcribed to synthesize cDNA (volume¼20 mL; Reverse Transcriptase M-MLV, Takara). Quantitative RT-PCR was performed on a MyiQ2 Real-Time System (Bio-RAD), and transcripts were measured using Universal Probe Library probes (Takara). The relative expression of target genes was calculated according to
Table 1 – NF-κB cascade genes induced preferentially by HISA or live S. aureus. The numbers in the table refer to a fold change value. Gene name
Description
HISA
S. aureus
Nfkb1 Nfkbiz/IkBζ Nfkbie Ikbkb Ikbkg Rel Rela Tank Traf1 Traf2 Traf5 Traf6 Tradd Tnfaip3/A20 Map3k1 Map3k14
Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, p105 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Inhibitor of kappaB kinase beta Inhibitor of kappaB kinase gamma Reticuloendotheliosis oncogene; NFκB subunit v-rel reticuloendotheliosis viral oncogene homolog A TRAF family member-associated NFκB activator TNF receptor-associated factor 1 TNF receptor-associated factor 2 TNF receptor-associated factor 5 TNF receptor-associated factor 6 TNFRSF1A-associated via death domain Tumor necrosis factor, alpha-induced protein 3 Mitogen-activated protein kinase kinase kinase 1 Mitogen-activated protein kinase kinase kinase 14
1.95 12.38 2.16 0.93 1.01 6.02 1.58 1.27 11.26 1.12 2.51 1.64 1.08 3.28 0.58 1.06
1.51 15.74 2.82 0.86 0.89 3.38 1.41 1.09 12.78 1.09 3.61 1.78 0.74 8.77 0.17 0.79
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
previously published methods [28], using GAPDH as an internal control in RAW 264.7 cells. Primer sequences and UPL probes are shown in Tables 1 and 2. TaqMan Real-time qPCR amplification reactions were carried out in a final volume of 20 ml, containing 10 ml Premix Ex Taq (TaKaRa, Japan), 1 ml diluted cDNA template, 7.2 ml dH2O, 0.3 ml of each TaqMan probe and 0.4 ml of each primer. PCR conditions were as follows: 95 1C for 30 s, followed by 50 cycles of 95 1C for 5 s and 60 1C for 30 s. Resultant data were analyzed using iQTM5 software.
Statistics Data from three independent experiments were analyzed by ANOVA followed by a post-test (Dunnett's, Tukey–Kramer etc.) to calculate the mean and standard deviation (SD) of triplicate assays. Statistical significance was measured using the Student's t-test (two-tailed distribution with a two-sample equal variance; po0.05).
Results S. aureus-induced production of NF-κB cascade genes in macrophages To investigate whether NF-κB cascade genes are altered in the host innate immune response to HISA or live S. aureus, we used oligonucleotide microarrays to perform a genome-wide analysis of RAW 246.7 cells. The results showed that in NF-κB cascade
3
] (]]]]) ]]]–]]]
genes, Nfκb1, Nfκbiz, Nfκbie, Rel, Traf1, Traf5, Traf6 and Tnfaip3/ A20 were significantly up-regulated (po0.01) by HISA or live S. aureus (Table 1). Although most NF-κB cascade genes were upregulated in two treatments, some genes showed different expressions in two treatments. Nfkb1 and Rel were upregulated more by HISA, and Nfkbiz/IkBζ, Nfkbie and Tnfaip3/ A20 were up-regulated more by live S. aureus. And Tradd, Map3k1 and Map3k14 are down-regulated by live S. aureus more than by HISA. These significantly different expressed genes may be involved in the pathogensis of live S. aureus. Two inhibitors of kappa B kinase (Ikbkb and Ikbkg) were down-regulated by live S. aureus but were not affected by HISA. The microarray data showed that S. aureus induced the production of NF-κB cascade genes in RAW 246.7 macrophages at 1 hour post-incubation, indicating NF-κB pathway activation in RAW 246.7 cells.
Inhibition of NF-κB inhibited the phagocytosis of HISA by macrophages As phagocytosis is one of the important roles for macrophages, we investigated the effect of NF-κB knock-down on phagocytosis of S. aureus in murine RAW 246.7 cells. Transmission electron microscopy (TEM) revealed that RAW 264.7 cells phagocytosed HISA at 1 hour post-incubation, but that treatment with an NF-κB inhibitor blocked HISA phagocytosis (Fig. 1). HISA was observed extracellularly in NF-κB-inhibitor treatment but HISA was localized in the membrane of non-treated cells (Fig. 1). To gain further insight into the involvement of the NF-κB
Table 2 – Sequences of forward primer, reverse primer and TaqMan probe used for real-time quantitative RT-PCR. Gene
Forward (left) primer
Reverse (right) primer
TaqMan probe
GAPDH Nfkb1 TLR2 IL1a IL1b
caatgtgtccgtcgtggatct agtgcaaaggaaacgccagaag ataagctgaaaacactcccagatg cgggaggagacgactctaaatatc cctgggctgtcctgatgagag
gtcctcagtgtagcccaagatg gccagggcttccggtactc gaaaagaaccaagttggtc ggtcggtctcactacctgtg tccacgggaaagacacaggta
cgtgccgcctggagaaacctgcc tccgccaccgccactaccga tgttccctgtgttgctggtcatga tggcaactccttcagcaacacgggc tcgcagcagcacatcaacaagagc
Fig. 1 – Transmission electron microscopy (TEM) of phagocytosis of HISA or live S. aureus in RAW 264.7 cells (one hour). Multiple normal RAW 264.7 cells (one hour), Bar¼ 2 lm; Single normal RAW cells. Bar¼1 lm. Phagocytosis of HISA in RAW 264.7 cells. Bar¼2 lm; Enlarged RAW cell, Black arrow indicates internalized HISA. Bar¼1 lm. Phagocytosis of HISA in NF-κB-inhibitortreated RAW 264.7 cells, Bar¼ 2 lm; Enlarged NF-κB-inhibitor-treated RAW cells, Bar¼1 lm. Phagocytosis of live S. aureus in RAW 264.7 cells (one hour). Bar¼ 2 lm; Enlarged RAW cell, Black arrow indicates internalized live S. aureus. Bar¼1 lm. Phagocytosis of live S. aureus in NF-κB-inhibitor-treated RAW 264.7 cells, Bar¼2 lm; Enlarged NF-κB-inhibitor-treated RAW cells, Bar¼1 lm. Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
4
E XP E RI ME N TAL CE L L R ES E ARC H
] (]]]]) ]]]–]]]
signaling pathway in the phagocytosis, the relative expression of NFκB1, inteleukin-1α(IL1α), IL1β and Toll-like receptor 2 (TLR2) was measured with quantitative RT-PCR. HISA treatment significantly increased (po0.05) the expressions of NFκB1, IL1α, IL1β and TLR2 and NF-κB-inhibitor treatment significantly decreased (po0.05) the expression of these genes in RAW 264.7 cells (Fig. 2A). Thus, IL1α and IL1β are likely components of the NFκB signaling pathway that can be induced by NF-κB activation. (Fig. 2A). However, the expressions of NFκB1 and NFκBie after NFκB inhibitor treatment was significantly lower compared to that of the control (Fig. 2C). As shown in Fig. 3A, phagocytosis was observed in HISA treatment at one hour after incubation. NF-κB inhibitor treatment blocked phagocytosis of FITC-labeled HISA in RAW 264.7 cells (Fig. 3A). In addition, actin filaments of RAW 264.7 cells treated with NF-κB-inhibitor were very different compared with that of the other two treatments. NF-κB pathway may be important in affecting actin filaments to activate phagocytosis of S. aureus. Phagocytotic activity of RAW 264.7 cells was measured using flow cytometry detecting FITC-labeled HISA. With inhibition of NF-κB, the rate of phagocytosis in HISA treatment was significantly higher (po0.05) than that of NF-κB inhibitor treatment (Fig. 3B), suggesting that NF-κB activation was required for phagocytosis of HISA by macrophages.
Inhibition of NF-κB inhibited the phagocytosis of live S. aureus by macrophages
Fig. 2 – (A) mRNA analysis of NFκB1, IL1α, IL1β and TLR2 with three treatments at one-hour post-incubation in RAW 264.7 cells using quantitative RT–PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05). (B) mRNA analysis of NFκB1, IL1α, IL1β and TLR2
TEM results showed that RAW 264.7 cells phagocytosed live S. aureus at 1 hour post-incubation, but that treatment with an NF-κB inhibitor blocked live S. aureus phagocytosis (Fig. 1). Next, we analyzed the expression profile of NFκB1, IL1α, IL1β and TLR2 to investigate the process of phagocytosis in RAW 264.7 cells. The four genes expression of live S. aureus was significantly higher (po0.05) than that of control at 1 hour post-incubation (Fig. 1). Phagocytotic activity of RAW 264.7 cells was measured using flow cytometry detecting FITC-labeled live S. aureus. Confocal microscopy showed that phagocytosis of live S. aureus was observed at 1 hour post-incubation and NF-κB inhibitor treatment blocked phagocytosis of live S. aureus in RAW 264.7 cells (Fig. 4A). In addition, actin filaments of NF-κB-inhibitor-treated RAW 264.7 cells were significantly changed like the previous HISA plus NFκB-inhibitor treatment. NF-κB may affect the phagocytosis of S. aureus with the regulation of cytoskeleton organization. Phagocytosis of FITC-labeled live S. aureus was quantified to evaluate phagocytotic activity. The rate of phagocytosis in HISA treatment was significantly higher (po0.05) than that of NF-κB inhibitor treatment (Fig. 4B), indicating that NF-κB was required for activating phagocytosis of live S. aureus by macrophages.
with three treatments at one-hour post-incubation in RAW 264.7 cells using quantitative RT-PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05). (C) Effects of the inhibition of NF-κB activity on expressions of genes of NF-κB pathway. RAW264.7 cells were treated with the NF-κB inhibitor. The expressions of NFκB1 and NFκBie genes were evaluated using real-time PCR. Statistically significant differences between treatments were indicated with asterisks (*Po0.05).
Discussion S. aureus is an important nosocomial and community-acquired pathogen and a leading cause of human infections worldwide [1,2]. HISA is a common model for studying phagocytosis, phagosome acidification, bacterial recognition, and cytokine production in response to S. aureus in phagocytes [29–32]. Here, we report that HISA induced production of NFκB1, IL1α, IL1β and TLR2 and
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
] (]]]]) ]]]–]]]
5
Fig. 3 – The role of NF-κB on phagocytosis of HISA by RAW 264.7 cells. (A) Confocal microscopy of phagocytosis of FITC-labeled HISA by RAW 264.7 cells at 1 hour post incubation (up, 100 , Bar¼ 10 lm; down, 400 , Bar¼ 5 lm). (B) Phagocytosis percentage of FITC-labeled HISA (down, 100 ) by RAW 264.7 cells at one-hour post incubation. Number of RAW 264.7 cells phagocytosing FITClabeled HISA was quantified using flow cytometry at one-hour post-incubation. Non-treated S2 cells were controls. Statistically significant differences between treatments were indicated with asterisks (*Po0.05).
that inhibition of NF-κB decreased NFκB1, IL1α, IL1β and TLR2 expression. S. aureus protein A (SpA) can bind to tumor necrosis factor receptor-1 (TNFR-1) and activate NF-κB in osteoblasts [33], and S. aureus can activate NF-κB in human osteoblasts, but the actual attachment of S. aureus is required for activation in response to infection [34]. To determine whether S. aureus can
activate the NF-κB signaling pathway in macrophages, we performed a genome-wide analysis on RAW 246.7 cells and found that HISA can activate the NF-κB pathway in this cell line at one hour after incubation and significantly different expressed genes between HISA and S. aureus may be involved in the pathogensis of live S. aureus. Gram-positive bacteria and lipopeptides activate
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
6
E XP E RI ME N TAL CE L L R ES E ARC H
] (]]]]) ]]]–]]]
Fig. 4 – The role of NF-κB in phagocytosis of Live S. aureus by RAW 264.7 cells. (A) Confocal microscopy of phagocytosis of FITClabeled live S. aureus by RAW 264.7 cells at 1 hour post incubation (up, 100 , Bar¼ 10 lm; down, 400 , Bar¼ 5 lm). (B) Phagocytosis percentage of FITC-labeled live S. aureus (down, 100 ) by RAW 264.7 cells at 1 hour post incubation. Number of RAW 264.7 cells phagocytosing FITC-labeled live S. aureus was quantified using flow cytometry at one-hour post-incubation. Nontreated S2 cells were controls. Statistically significant differences between treatments were indicated with asterisks (*po0.05). macrophages through pattern recognition receptors such as Tolllike receptor 2 (TLR2), which is recruited to phagosomes and discriminates among pathogens [35–36]. Micrococci and peptidoglycan can activate the TLR2-MyD88-IRAK-TRAF-NIK-
IKK-NF-κB signal transduction pathway [37], and TLR2 can mediate activation of transcription factor NF-κB [38–40]. We found that HISA induced expression of NFκB1 and TLR2 and NFκB inhibitor treatment decreased TLR2 expression much. TLR2
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
E X PE R IM EN TA L C ELL R E S EA RC H
was found to regulate the secretion of IL1 via distinct mechanisms in response to Listeria monocytogenes [41]. The interleukin (IL1) family is closely linked to the innate immune response and controls inflammation [42]. S. aureus infection would result in production of IL-1β in endothelial cells [43]. IL1 produced by phagocytes is an important cytokine orchestrating host defense against S. aureus [44–46]. IL1β is an important pro-inflammatory cytokine that activates monocytes, macropages, and neutrophils [47]. IL1 activates transcription factor NF-κB, and NF-κB regulates the induction of IL1β transcription [48–50]. HISA induces expression of NFκB1, IL1α, IL1β and TLR2 simultaneously and NF-κB regulates induction of IL1α and IL1β transcription. Our data suggest that NF-κB may regulate phargocyte activation via the induction of cytokine production. Phagocytic stimuli have been reported to induce NF-κB activation, and expression of kappa B-responsive genes was reported to be enhanced in neutrophils [51]. A novel NF-κB inhibitor, dehydroxymethylepoxyquinomicin, was found to inhibit allergic inflammation and airway remodeling in mice [52]. Resveratrol was found to control phagocytosis of Escherichia coli and of S. aureus through an NF-κB-dependent gene program [53]. To our knowledge, our study is the first to offer evidence of the involvement of NF-κB in phagocytosis of S. aureus by macrophages. Blockade of NF-κB activation with an NF-κB inhibitor revealed inhibition the phagocytosis of S. aureus in RAW 264.7 cells. As scientists better understand the regulation of the NF-κB pathway, the therapeutic potential for inhibiting this pathway to treat inflammation and cancer is gaining attention [54]. However, therapeutic inhibition of classical NF-κB activation in macrophages, as we demonstrated in RAW 264.7 cells, may hamper the initiation of adaptive immunity [55]. Inhibition of NF-κB activation was found to inhibit phagocytic activity in murine macrophage in this study. So the therapeutic potential of inhibition NF-κB pathway should be carefully assessed by further investigation for the destructive potential of immune system.
Acknowledgments This work was financially supported by National Natural Science Foundation of China, People's Republic of China (31370050), the National Basic Research Program of China (2012CB114403) and National High-tech R&D Program (863 Program) (2012AA0922052) and The Development of Scientific Research Fund Project of Zhejiang Agriculture and Forestry University (2012FR019).
[7]
[8]
[9] [10]
[11]
[12] [13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
references [1] G.L. Archer, Staphylococus aureus: a well-armed pathogen, Clin. Infect. Dis. 26 (1998) 1179–1181. [2] F.D. Lowy, Staphylococcus aureus infections, N. Engl. J. Med. 339 (1998) 520–532. [3] C. Garzoni, W.L. Kelley, Staphylococcus aureus: new evidence for intracellular persistence, Trends Microbiol. 17 (2009) 59–65. [4] T.J. Foster, Immune evasion by staphylococci, Nat. Rev. Microbiol. 3 (2005) 948–958. [5] S.H. Rooijakkers, K.P. van-Kessel, J.A. van-Strijp, Staphylococcal innate immune evasion, Trends Microbiol. 13 (2005) 596–601. [6] R. Yokoyama, S. Itoh, G. Kamoshida, T. Takii, S. Fujii, T. Tsuji, K. Onozaki, Staphylococcal superantigen-like protein 3 binds to the Toll-like receptor 2 extracellular domain and inhibits
[22]
[23]
[24]
[25]
] (]]]]) ]]]–]]]
7
cytokine production induced by Staphylococcus aureus, cell wall component, or lipopeptides in murine macrophages, Infect. Immun. 80 (2012) 2816–2825. B.W. Bardoel, R. Vos, T. Bouman, P.C. Aerts, J. Bestebroer, E.G. Huizinga, T.H. Brondijk, J.A. van Strijp, C.J. de Haas, Evasion of Toll-like receptor 2 activation by staphylococcal superantigenlike protein 3, J. Mol. Med. 90 (2012) 1109–1120. R.S. Flannagan, G. Cosio, S. Grinstein, Antimicrobial mechanisms of phagocytes and bacterial evasion strategies, Nat. Rev. Microbiol. 7 (2009) 355–366. R.S. Flannagan, V. Jaumouille, S. Grinstein, The cell biology of phagocytosis, Annu. Rev. Pathol. 7 (2012) 61–98. J. Koziel, A. Maciag-Gudowska, T. Mikolajczyk, M. Bzowska, D.E. Sturdevant, A.R. Whitney, L.N. Shaw, F.R. DeLeo, J. Potempa, Phagocytosis of Staphylococcus aureus by macrophages exerts cytoprotective effects manifested by the upregulation of antiapoptotic factors, PLOS One 4 (2009) e5210. A.M. Houghton, W.O. Hartzell, C.S. Robbins, F.X. Gomis-Rüth, S.D. Shapiro, Macrophage elastase kills bacteria within murine macrophages, Nature 460 (2009) 637–641. P.A. Baeuerle, T. Henkel, Function and activation of NF-kappa B in the immune system, Annu. Rev. Immunol. 12 (1994) 141–179. S. Ghosh, M.J. May, E.B. Kopp, NF-κB and Rel proteins: evolutionarily conserved mediators of immune responses, Annu. Rev. Immunol. 16 (1998) 225–260. S. Gerondakis, R. Grumont, I. Rourke, M. Grossmann, The regulation and roles of Rel/NF-κB transcription factors during lymphocyte activation, Curr. Opin. Immunol. 10 (1998) 353–359. F. Chen, V. Castranova, X. Shi, L.M. Demers, New insights into the role of nuclear factor-kappaB, a ubiquitous transcription factor in the initiation of diseases, Clin. Chem. 45 (1999) 7–17. E. Dale, M. Davis, D.L. Faustman, A role for transcription factor NFkappaB in autoimmunity: possible interactions of genes, sex, and the immune response, Adv. Physiol. Educ. 30 (2006) 152–158. M.C. Maiuri, G. Tajana, T. Iuvone, D. De-Stefano, G. Mele, M.T. Ribecco, M.P. Cinelli, M.F. Romano, M.C. Turco, R. Carnuccio, Nuclear factor-kappaB regulates inflammatory cell apoptosis and phagocytosis in rat carrageenin-sponge implant model, Am. J. Pathol. 165 (2004) 115–126. B. Spellerberg, C. Rosenow, W. Sha, E.I. Tuomanen, Pneumococcal cell wall activates NF-kappa B in human monocytes: aspects distinct from endotoxin, Microb. Pathog. 20 (1996) 309–317. S.F. Liu, A.B. Malik, NF-kappa B activation as a pathological mechanism of septic shock and inflammation, Am. J. Physiol. Lung Cell. Mol. Physiol. 290 (2006) L622–L645. C. Toma, N. Higa, Y. Koizumi, N. Nakasone, Y. Ogura, A.J. McCoy, L. Franchi, S. Uematsu, J. Sagara, S. Taniguchi, H. Tsutsui, S. Akira, J. Tschopp, G. Nunez, T. Suzuki, Pathogenic Vibrio activate NLRP3 inflammasome via cytotoxins and TLR/nucleotide-binding oligomerization domain-mediated NF-kappa B signaling, J. Immunol. 184 (2010) 5287–5297. A.M. Pinto, P.C. Sales, E.R. Camargos, A.M. Silva, Tumour necrosis factor (TNF)-mediated NF-κB activation facilitates cellular invasion of non-professional phagocytic epithelial cell lines by Trypanosoma cruzi, Cell. Microbiol. 13 (2011) 1518–1529. S.F. Liu, X. Ye, A.B. Malik, Inhibition of NF-kappaB activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes, Circulation 100 (1999) 1330–1337. M. Di-Giuseppe, F. Gambelli, G.W. Hoyle, G. Lungarella, S.M. Studer, T. Richards, S. Yousem, K. McCurry, J. Dauber, N. Kaminski, G. Leikauf, L.A. Ortiz, Systemic inhibition of NF-kappaB activation protects from silicosis, PLOS One 4 (2009) e5689. R. Ning, X. Zhang, X. Guo, Q. Li, Attachment of Staphylococcus aureus is required for activation of nuclear factor kappa B in human osteoblasts, Acta Biochim. Biophys. Sin. 42 (2010) 883–892. J.J. Heynekamp, W.M. Weber, L.A. Hunsaker, A.M. Gonzales, R.A. Orlando, L.M. Deck, D.L. Jagt, Substituted trans-stilbenes,
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
8
E XP E RI ME N TAL CE L L R ES E ARC H
[26]
[27]
[28] [29]
[30]
[31]
[32]
[33]
[34]
[35] [36]
[37]
[38]
[39]
including analogues of the natural product resveratrol, inhibit the human tumor necrosis factor alpha-induced activation of transcription factor nuclear factor kappa B, J. Med. Chem. 49 (2006) 7182–7189. A.L. Fedrow, T.V. Ohlen, D. Boyle, R.R. Ganta, S.K. Chapes, Use of Drosophila S2 cells as a model for studying Ehrlichia chaffeensis infections, Appl. Environ. Microbiol. 74 (2008) 1886–1891. F. Zhu, X. Zhang., The Wnt signaling pathway is involved in the regulation of phagocytosis of virus in Drosophila, Sci. Rep. 3 (2013) 2069. M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucl. Acids Res 29 (2001) e45. R. Kapetanovic, M.A. Nahori, V. Balloy, C. Fitting, D.J. Philpott, J.M. Cavaillon, M. Adib-Conquy, Contribution of phagocytosis and intracellular sensing for cytokine production by Staphylococcus aureus-activated macrophages, Infect. Immun. 75 (2007) 830–837. R. Kapetanovic, M. Parlato, C. Fitting, V. Quesniaux, J.M. Cavaillon, M. Adib-Conquy, Mechanisms of TNF induction by heat-killed Staphylococcus aureus differ upon the origin of mononuclear phagocytes, Am. J. Physiol. Cell. Physiol 300 (2011) C850–C859. J.B. Wardenburg, W.A. Williams, D. Missiakas, Host defenses against Staphylococcus aureus infection require recognition of bacterial lipoproteins, Proc. Natl. Acad. Sci. USA 103 (2006) 13831–13836. W.K. Ip, A. Sokolovska, G.M. Charriere, L. Boyer, S. Dejardin, M.P. Cappillino, L.M. Yantosca, K. Takahashi, K.J. Moore, A. Lacy-Hulbert, L.M. Stuart, Phagocytosis and phagosome acidification are required for pathogen processing and MyD88dependent responses to Staphylococcus aureus, J. Immunol. 184 (2010) 7071–7081. T. Claro, A. Widaa, C. McDonnell, T.J. Foster, F.J. O’Brien, S.W. Kerrigan, Staphylococcus aureus protein A binding to osteoblast tumour necrosis factor receptor 1 results in activation of nuclear factor kappa B and release of interleukin-6 in bone infection, Microbiology 159 (2013) 147–154. R. Dziarski, Q. Wang, C.J. Kirschning, K. Miyake, D. Gupta, MD-2 enables Toll-like receptor-2 (TLR2)-mediated responses to LPS and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components, J. Immunol. 166 (2001) 1938–1944. K. Takeda, O. Takeuchi, S. Akira, Recognition of lipopeptides by Toll-like receptors, J. Endotoxin Res. 8 (2002) 459–463. M. Azuma, R. Sawahata, Y. Akao, T. Ebihara, S. Yamazaki, M. Matsumoto, M. Hashimoto, K. Fukase, Y. Fujimoto, T. Seya, The peptide sequence of diacyl lipopeptides determines dendritic cell TLR2-mediated NK activation, PLOS One 5 (2010) e12550. G. Zhang, S. Ghosh, Toll-like receptor-mediated NF-kappa B activation: a phylogenetically conserved paradigm in innate immunity, J. Clin. Invest. 107 (2001) 13–19. L. Arbibe, J.P. Mira, N. Teusch, L. Kline, M. Guha, N. Mackman, P.J. Godowski, R.J. Ulevitch, U.G. Knaus, Toll-like receptor 2-mediated NF-kappa B activation requires a Rac1-dependent pathway, Nat. Immunol. 1 (2000) 533–540. F. Sandor, E. Latz, F. Re, L. Mandell, G. Repik, D.T. Golenbock, T. Espevik, E.A. Kurt-Jones, R.W. Finberg, Importance of extraand intracellular domains of TLR1 and TLR2 in NFkappa B signaling, J. Cell Biol. 162 (2003) 1099–1110.
] (]]]]) ]]]–]]]
[40] N. Ozoren, J. Masumoto, L. Franchi, T.D. Kanneganti, M. BodyMalapel, I. Erturk, R. Jagirdar, L. Zhu, N. Inohara, J. Bertin, A. Coyle, E.P. Grant, G. Nunez, Distinct roles of TLR2 and the adaptor ASC in IL-1beta/IL-18 secretion in response to Listeria monocytogenes, J. Immunol. 176 (2006) 4337–4342. [41] C.A. Dinarello, Immunological and inflammatory functions of the interleukin-1 family, Annu. Rev. Immunol. 27 (2009) 519–550. [42] L. Yao, V. Bengualid, F.D. Lowy, J.J. Gibbons, V.B. Hatcher, J.W. Berman, Internalization of Staphylococcus aureus by endothelial cells induces cytokine gene expression, Infect. Immun. 63 (1995) 1835–1839. [43] T. Kielian, E.D. Bearden, A.C. Baldwin, N. Esen, IL-1 and TNFalpha play a pivotal role in the host immune response in a mouse model of Staphylococcus aureus-induced experimental brain abscess, J. Neuropathol. Exp. Neurol. 63 (2004) 381–396. [44] M. Verdrengh, J.A. Thomas, O.H. Hultgren, IL-1 receptor-associated kinase 1 mediates protection against Staphylococcus aureus infection, Microbes Infect. 6 (2004) 1268–1272. [45] L.S. Miller, E.M. Pietras, L.H. Uricchio, K. Hirano, S. Rao, H. Lin, R. M. O’Connell, Y. Iwakura, A.L. Cheung, G. Cheng, R.L. Modlin, Inflammasome-mediated production of IL-1beta is required for neutrophil recruitment against Staphylococcus aureus in vivo, J. Immunol. 179 (2007) 6933–6942. [46] M.G. Netea, A. Simon, F. van de Veerdonk, B.J. Kullberg, J.W.M. Van der Meer, L.A. Joosten, IL-1β processing in host defense: beyond the inflammasomes, PLOS Pathog. 6 (2010) e1000661. [47] P.N. Moynagh, D.C. Williams, L.A.J. O’Neill, Interleukin-1 activates transcription factor NFκB in glial cells, Biochem. J. 294 (1993) 343–347. [48] E. Stylianou, L.A.J. O’Neill, L. Rawlinson, M.R. Edbrooke, P. Woo, J. Saklatvala, Interleukin 1 induces NF-κB through its type I but not its type II receptor in lymphocytes, J. Biol. Chem. 267 (1992) 15836–15841. [49] J.P. Cogswell, M.M. Godlevski, G.B. Wisely, W.C. Clay, L.M. Leesnitzer, J.P. Ways, J.G. Gray, NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site, J. Immunol. 153 (1994) 712–723. [50] P.P. McDonald, M.A. Cassatella, Activation of transcription factor NF-kappa B by phagocytic stimuli in human neutrophils, FEBS Lett. 412 (1997) 583–586. [51] E. Suzuki, K. Umezawa, Inhibition of macrophage activation and phagocytosis by a novel NF-kappaB inhibitor, dehydroxymethylepoxyquinomicin, Biomed. Pharmacother. 60 (2006) 578–586. [52] K. Shimizu, S. Konno, M. Ozaki, K. Umezawa, K. Yamashita, S. Todo, M. Nishimura, Dehydroxymethylepoxyquinomicin (DHMEQ), a novel NF-kappaB inhibitor, inhibits allergic inflammation and airway remodeling in murine models of asthma, Clin. Exp. Allergy 42 (2012) 1273–12781. [53] Y. Yamamoto, R.B. Gaynor, Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer, J. Clin. Invest. 107 (2001) 135–142. [54] G. Zhang, R. Liu, Y. Zhong, A.N. Plotnikov, W. Zhang, L. Zeng, E. Rusinova, G. Gerona-Nevarro, N. Moshkina, J. Joshua, P.Y. Chuang, M. Ohlmeyer, J.C. He, M.M. Zhou, Down-regulation of NF-κB transcriptional activity in HIV-associated kidney disease by BRD4 inhibition, J. Biol. Chem. 287 (2012) 28840–28851. [55] H.V. Groesdonk, S. Schlottmann, F. Richter, M. Georgieff, U. Senftleben, Escherichia coli prevents phagocytosis-induced death of macrophages via classical NF-κB signaling, a link to T-cell activation, Infect. Immun. 74 (2006) 5989–6000.
Please cite this article as: F. Zhu, et al., The nuclear factor kappa B (NF-κB) activation is required for phagocytosis of staphylococcus aureus by RAW 264.7 cells, Exp Cell Res (2014), http://dx.doi.org/10.1016/j.yexcr.2014.04.018
