Virology 468-470 (2014) 631–636
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
The Minute Virus of Mice NS2 proteins are not essential for productive infection of embryonic murine cells in utero Saar Tal a, Michal Mincberg a, Irina Rostovsky a, Jean Rommelaere b, Nathali Salome b, Claytus Davis a,n a b
Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, Ben Gurion University of the Negev, Beer Sheva, Israel Division ofTumor Virology, Deutsches Krebsforschungszentrum, Heidelberg, Germany
art ic l e i nf o
a b s t r a c t
Article history: Received 6 May 2014 Returned to author for revisions 5 June 2014 Accepted 29 August 2014 Available online 11 October 2014
The P4 promoter of the autonomous parvovirus Minute Virus of Mice (MVM) drives the production of its non-structural proteins, NS1 and NS2. The NS2 isoforms are without enzymatic activity but interact with cellular proteins. While NS2 is crucial to the viral life cycle in cultured murine cells, NS2-null mutant virus productively infects transformed host cells of other species. In the mouse, sensitivity to MVM infection is age dependent, exhibiting limited subclinical infections in adults, but sustained and potentially lethal infection in embryos. We therefore questioned whether the species-dependent requirement for NS2 function in vitro would be retained in utero. We report here that it is not. NS2null mutant MVMp is capable of mounting a productive, albeit much reduced, infection of normal embryonic mouse cells in vivo. Based on the data, we hypothesize that NS2 may bear an as-yet undescribed immunosuppressive function. & 2014 Elsevier Inc. All rights reserved.
Keywords: Parvovirus Minute Virus of Mice Virus – host cell interaction Viral gene function Congenital infection NS2
Introduction The Parvoviridae are all the small, isometric, non-enveloped DNA viruses that contain linear single-stranded DNA genomes of 4000–6000 nt inside icosahedral capsids. Their genomes terminate in palindromic sequences that can base-pair to form hairpins or other complex forms. These are essential for replication and are the hallmark of the family. The parvovirus subfamily contains the autonomous, vertebrate-specific viruses and includes the prototypic group member, Minute Virus of Mice (MVM) (Crawford, 1966; Kerr and Boschetti, 2006). Among the MVM variants, two, MVMm and MVMc, are common pathogens in mouse animal colonies (Besselsen et al., 2006). Two others – the fibrotropic (MVMp) and the lymphotropic (MVMi) – are the most commonly studied parvoviruses in a research setting (Bonnard et al., 1976; Crawford, 1966; McMaster et al., 1981). The MVM genome contains two promoters, at map units 4 and 38, driving the expression of overlapping and alternatively spliced RNAs that encode the two major non-structural proteins, NS1 and NS2 (P4), and capsid proteins, VP1 and VP2 (P38). With their minimalist approach, all family members are tightly tuned to the host cell and the natural execution of its functions. None is able to push the cell cycle and each relies almost entirely on the normal host replication machinery (e.g. Deleu et al., 1999). Integration of
n
Corresponding author.
http://dx.doi.org/10.1016/j.virol.2014.08.032 0042-6822/& 2014 Elsevier Inc. All rights reserved.
virus replication into the host machinery is largely executed by the viral non-structural protein 1 (NS1), a pleiotropic 83 kDa (672 amino acid) nuclear phosphoprotein that binds to the viral DNA with sequence specificity. It has ATPase, helicase, nickase, and sitespecific endonuclease activities (Cotmore and Tattersall, 1995), and a Mg þ þ binding site (Astell et al., 1987; Cotmore and Tattersall, 1986; Jindal et al., 1994). On the other side of the lifecycle, binding and delivery of the viral genome through the cell and nuclear membranes and into the nucleus are mediated by the VP proteins which exhibit a strikingly diverse set of functions (e.g. Lombardo et al., 2002; Mani et al., 2006; Maroto et al., 2004; Nam et al., 2006). This leaves NS2. The NS2 protein has three isoforms NS2-P, NS2-Y, and NS2-L, derived from alternative splicing events (Cotmore and Tattersall, 1990) and having identical N-termini but different carboxy ends. They have no known enzymatic activities but are known to interact with a variety of cellular proteins, including members of the 14-3-3 family, SMN, and CRM1 (Bodendorf et al., 1999; Brockhaus et al., 1996; Young et al., 2002; Young et al., 2005). In the setting of its normal cultured murine host cells, NS2 is needed for genome replication (Choi et al., 2005; Naeger et al., 1990) and expression (Mincberg, 2008; Naeger et al., 1993), accumulation of NS1 (Naeger et al., 1990), capsid assembly (Cotmore et al., 1997), and production and nuclear egress of infectious particles (Eichwald et al., 2002; Engelsma et al., 2008; Miller and Pintel, 2002; Naeger et al., 1990). Given this range of interactions and roles, it is not surprising that NS2 is crucial for
632
S. Tal et al. / Virology 468-470 (2014) 631–636
viral reproduction in murine cells (Brownstein et al., 1992; Cater and Pintel, 1992; Naeger et al., 1990; Naeger et al., 1993). And it is surprising that NS2 is not needed for productive infection in transformed host cells of other species (Cater and Pintel, 1992; Naeger et al., 1990) although, even in other species, its loss can certainly reduce propagation of progeny virions (Cotmore et al., 1997). Although the two research strains of the virus, MVMp and MVMi, display limited and subclinical infections in adult mice in vivo, MVMi infection of neonates can be lethal (Kimsey et al., 1986) and we showed that both mounted productive, sustained and occasionally lethal infections in embryos inoculated during the second trimester in utero (Itah et al., 2004b). It was therefore a natural extension of the curious species-dependent requirement for NS2 to question whether the restriction observed in vitro would be retained in utero. We report here that it is not. NS2-null mutant MVMp is capable of mounting a productive, albeit much
reduced, infection of normal mid-trimester mouse embryos in utero.
Results Pattern of MVMp-NS2null infection in developing mouse embryos Our initial approach to characterizing a requirement for NS2 activity during infection in utero was to repeat with the mutant virus a time course infection study (Itah et al., 2004b). 5 105 pfu of MVMp-NS2null virus or MVMp-wt virus were injected into 13.5 dpc C57BL/6 embryos. After a further 24, 48, 72, or 96 h gestation, embryos were removed and processed for immunohistochemistry. At least 3 injected embryos and 2 non-injected littermates from each time point were serially sectioned and the distribution of viral capsid was determined using an anti-capsid primary
Dermis
Lung
A
B
ْC
D
E
F
wt
48hr
null
Epi
wt
Fib
72hr
G
H
null
I
MVMp-wt
MVMp-NS2null
Hepatocytes Podocytes Radial glia/ neurons Smooth muscle
Fibroblasts Mesothelium Endothelium Epithelium
Fig. 1. MVMp-NS2null infection in C57BL/6 embryos. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp-wt at 13.5 dpc by injection in utero (Materials and methods). Gestation was left to continue for another 24, 48, 72, or 96 h. Embryos were collected, sectioned and subjected to immunohistochemistry using a polyclonal anti-MVMp capsid primary antibody and Cy3-labeled secondary antibody (Materials and methods). Viral coat protein distribution is shown in image pairs (A–H): immunofluorescence (left) and DIC (right). Two representative tissues showing widespread infection, dermis (A, C, E, G) and lung (B, D, F, H), were selected for illustration. Panels are 48 h post-inoculation (A–D) or 72 h post-inoculation (E–H). Inoculum was either wild type MVMp (A, B, E, F) or NS2 null mutant virus (C, D, G, H). (I) Tropism of MVMp-NS2null virus vs. MVMp wt virus. Host cell types were determined by histology and immunohistochemistry at 24, 48, 72, and 96 h post-infection. Fib – fibroblasts, and Epi – epithelia.
S. Tal et al. / Virology 468-470 (2014) 631–636
633
antibody. Characteristic signal patterns and intensities are shown in Fig. 1. The combined host cell type results were compiled and compared (Fig 1H). Like the parental MVMp, sparsely distributed signal was observed by 24 h. Over the next three days, the extent of infection increased, but was at all times less in extent and intensity than wildtype MVMp infection in C57BL/6 embryos. None of the uninjected littermate embryos exhibited signal. These results provided an initial indication that NS2 activity is not essential for productive infection of the mouse embryo. With respect to host cell type specificity, those cell types most frequently infected by the wildtype virus, fibroblasts, epithelia, and mesothelia, were also infected by the NS2-null mutant. Some cell types less frequently infected by wildtype MVMp were not observed to stain in the NS2-null mutant infected embryos (Fig. 1H). However, MVMp-NS2null did sporadically infect endothelium, a cell type that the parental MVMp was never observed to infect, but one which the related MVMi regularly did. Viral NS1 protein production in infected embryos Given the discrepancy between the literature and our in utero results concerning NS2, corroborating evidence of productive infection of the NS2-null mutant was needed, especially since the viral element being detected, capsid, was present in the inoculum. We therefore collected NS2-null infected embryos and littermates as described above and looked for the presence of NS1, the non-structural protein known to be essential for productive infection, by Western analysis. A total of four different MVMPNS2null-injected and two contra-lateral embryo lysates were used for each time point (0 h, 24 h, 48 h, 72 h and 96 h). As a positive control we used lysate from an MVMp w.t.-infected embryo at 96 h and as a negative control an uninfected embryo of the same gestational age. We detected increasing levels of viral NS1 protein in all injected and incubated embryos (Fig. 2). As expected, uninfected embryos did not show signal. The weak signal at time 0, before there is any chance of translation of viral product by the host, is most likely due to the frequent tethering of a single NS1 molecule to the 30 termini of encapsidated genomes (Cotmore and Tattersall, 1989). This result indicates that MVMp-NS2null is at least able to complete formation of the viral RF genome and to transcribe it in the developing mouse embryo. Viral quantitation by qPCR in MVMp-NS2null infected embryos To quantitate NS2-null viral infection in developing mouse embryos total DNA samples from embryos infected as above were prepared and viral genome copy number was measured by qPCR and normalized to host genome copy number, similarly determined. Untreated embryos from the same incubational period were used as negative controls. The results (Fig. 3) show small but increasing viral burdens starting at 24 h post-infection. The small signal observed at time 0 probably represents the incoming viral
HPI 83 kDa
NC
0
24
NS2-null 48 72
96
MVMp 96 NS1
Fig. 2. MVMp-NS2null NS1 protein expression. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp wildtype at 13.5 dpc. Embryos were collected immediately (t¼ 0) or gestation was left to continue for the times shown (t¼ 24, 48, 72, 96 h). Embryos were collected, homogenized, and equal amounts of proteins subjected to PAGE. Viral NS1 proteins were detected by Western analysis (Materials and methods). h.p.i – hours post-infection, and N.C. – negative control uninfected cells.
Fig. 3. Viral DNA burden in MVMp-NS2null infected embryos. C57BL/6 embryos were inoculated with virus and homogenates prepared 24, 48, 72 and 96 h postinoculation as described. Genomic DNA was prepared and subjected to qPCR using primers amplifying a fragment of the mouse genome and primers amplifying a fragment of the MVM viral genome (Materials and methods). At least 4 embryos/ time point were analyzed. Viral levels were normalized to mouse genome levels to give an approximate estimate of viral genomes/haploid host genome. Solid bars – NS2-null, Hatched bar – MVMp wildtype. Hash marks on the Y-axis and MVMp wt bar indicate a depicted jump in the scale. Error bars are Standard Error of Mean.
genomes in the inoculum. The virus levels in the NS2-null mutant infections were lower than observed for w.t. MVM by a factor of 30.
Production of infectious virions in MVMp-NS2null infected embryos The above results could possibly be explained by postulating that the NS2-null virus is able to infect embryonic cells and then over the course of the continued gestation drive the accumulation of viral products in those initially infected cells, without fully completing the viral lifecycle. Indeed, MVMp-NS2null virus is able to advance part way through its life cycle in murine cells in vitro, at least accumulating replicative double-stranded DNA genomes, albeit at much reduced rates (Cotmore et al., 1997). To show that MVMp-NS2null fully completes the viral life cycle and produces infectious virions in the embryo, we used embryo homogenates prepared 24, 72, and 96 h after inoculation to infect NBK cells (5 μl/well in 24 wells plate), a human transformed host cell type that is productively infected by NS2-null MVMp and A9 cells, murine fibroblasts that absolutely require NS2 activity for productive infection. The cultures were inspected and photographed 3 and 7 days post-infection. At 7 DPI, a distinct cytopathic effect was observed in NBK cells treated with the extracts from embryos inoculated 96 h earlier with either w.t. or MVMp-NS2null virus, indicating a progressive infection. This effect was much reduced in cells infected with 24 h extract and absent in negative control cultures. As expected, A9 cells exhibited no cytopathic effect after treatment with the 96 h extract from embryos inoculated with MVMp-NS2null virus but a clear cytopathic effect when treated with extracts from embryos infected with wild type MVMp (Fig. 4). We estimated the extent of infectious virion production during incubation in utero by end-point dilution assay. The MVMpNS2null stock and 96 h infected embryo homogenates were serially diluted and used to infect NBK cells in triplicate. Total infectious particle yield in the embryo was estimated to be 1.6 108 pfu. Since the initial inoculum contained 5 105 pfu of NS2null virus, the 96 h incubation was accompanied by an approximately 300-fold increase in infectious particles.
634
S. Tal et al. / Virology 468-470 (2014) 631–636
Uninfected
MVMp-NS2null 24 h lysate 96 h lysate
MVMp wt 96 h lysate
Uninfected
MVMp-NS2null 24 h lysate 96 h lysate
MVMp wt 96 h lysate
NBK
MVMp-NS2null Stock
A9
Fig. 4. Cytotoxic effect of NS2null injected embryo homogenates on NBK cells. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp wildtype (wt) at 13.5 dpc and homogenates prepared at 24 or 96 h post-inoculation as described. Cleared homogenates from inoculated embryos were used to infect mid-log phase NBK or A9 cells. The cells were inspected daily and photographed 6 days post-infection. Negative control (uninfected) NBK and A9 cells were treated with PBS.
The NS2-null mutation is stable over the embryonic infection course One final confounding scenario to consider was the possibility that, while the inoculum consisted of NS2null mutant virus, during the course of a non-productive infection, the engineered mutation reverted to wildtype; and that this, not the original mutant was responsible for our results. Infection was limited to 96 h; nonetheless, parvoviral mutation rates could be strikingly high, more similar to retrovirus than other DNA viruses (Shackelton and Holmes, 2006). To rule out the possibility of reversion during the infection, the region covering the engineered NS2null mutation was amplified by PCR from 96 h embryo lysates, sequenced, and then compared to the w.t. genome. The automated sequencer base calling indicated that the mutation had been retained and visual inspection of the raw electropherograms did not reveal any evidence of sequence heterogeneity in the region. We conclude that the infection data obtained was due to activity of the mutant virus alone.
Discussion Our data indicate that NS2 function is not absolutely essential for replication of MVM in murine host cells. Given the published literature, this is somewhat surprising, but, we suggest, not completely unexpected. The function of the parvovirus NS2 protein during the viral lifecycle has always had an enigmatic aspect. On one hand, the abundance of identified interactions and the typically deleterious consequences of ablating NS2 activity indicate that the proteins play one or more vital roles, although the only mechanistic pathway traced between an interaction and the normal events of viral replication is the NS2/Crm1 interaction and virion nuclear egress (Eichwald et al., 2002; Miller and Pintel, 2002). However there must be additional functions. In murine A9 fibroblasts, NS2null mutant virus fails to produce any single-stranded viral genomes. Yet in at least some cells in culture that are not derived from its normal host species, the functionally deficient virus produces single-stranded genome and is able to complete its lifecycle but with a much delayed virion release (Cotmore et al., 1997). Similarly, we (Eichwald and Salome, unpublished) observed that infection of human 293 T cells with NS2null mutant virus yielded relatively small plaques, a result that also suggests flawed virion propagation.
The infection in vivo provides grounds for some hypothesizing. First, the data show that, although NS2 is not essential for replication, it is still important. In all of our assays, infection parameters were greatly diminished with the mutant virus. This is consistent with infection studies in other experimental settings. The reduction in viral burden in most cell types in which NS2 is not essential is so severe that the infection can almost be considered accidental. For instance, if we accept a central role for NS2 in propagation of infectious particles (e.g. Cotmore et al., 1997), then we can view the resulting infectious virion production during an NS2-null infection of human NBK cells as chance release—an accidental byproduct resulting from an abundance of primary reactants. Nonetheless, in the complete absence of NS2, production, albeit much reduced, does occur in some systems, but not in others. One possibility is that these productive cells are providing the virus with some helper activity that circumvents the need for an NS2 mediated function. Alternatively, we suggest that the difference can be accounted for by assigning another, independent function to NS2—not unlikely given the number of variants and the multiple identified independent interactions with host cell factors. If this function is mediated through interaction with a host factor, then there are two possibilities—that the interaction promotes completion of part of the viral life cycle, or that the interaction alleviates a cellular block to viral replication. There is little reason to favor one over the other, although our in utero data tilts towards the latter. The innate immune system that drives anti-viral responses is underdeveloped in the embryo (e.g. Marodi, 2006). It would not be surprising that the virus is better able to replicate when missing a component that inhibits an inhibitor—if the inhibitor itself is missing from the cell. Currently we suspect that this is one of the reasons that the wildtype virus is able to mount a much more aggressive infection in the embryo than in neonates or adults. Searching for interaction between NS2 and the cellular antiviral machinery may be rewarding.
Materials and methods Cells A9 – A subline of mouse fibroblast L-cells (Littlefield, 1964). NBK – A SV40 transformed newborn human kidney cells (Shein and Enders, 1962). Cells were grown at 37 1C, 5% CO2 in DMEM
S. Tal et al. / Virology 468-470 (2014) 631–636
635
with 5% fetal bovine serum (FBS), 0.8% Penicillin (10,000 μ/ml)/ Streptomycin(10 mg/ml), and 2% Glutamine.
signal was derived from Ct crossing number using the Pfaffle formulation (Pfaffl, 2001) excluding the fold-induction final step.
Virus
Western analysis Proteins were prepared from embryo homogenates by TCA precipitation and then resuspended in cracking buffer (8 M Urea, 10 mM NaPO4, 1% βmercapoethanol, 1% SDS). Following addition of sample buffer, samples were heated for 5 min at 95 1C, centrifuged, and equal quantities of soluble proteins were fractionated by 10% SDS-polyacrylamide gel electrophoresis. Proteins were blotted onto nitrocellulose membrane (Amersham), which was then blocked with 1X TBST containing 10% Skim milk powder (FLUKA) and 0.2% Tween 20 for 1 h. For detection of viral protein production, a primary monoclonal antibody recognizing NS1 (CE10, gift from C. Astell), a secondary polyclonal antibody (peroxidase-conjugated Anti-Mouse IgG(H þL), Jackson ImmunoResearch), and a chemiluminescence kit (SuperSignal West Pico Chemiluminescent Substrate, Thermo) were used in a standard Western procedure using the manufacturers' recommendations.
MVMp-wt Wild-type MVMp double-stranded DNA was excised from pMM984 (Merchlinsky et al., 1983) and cloned into a high copy number plasmid vector, pGEM-T, and grown in Escherichia coli SureII host cells. MVMp-wt virion was prepared by transfection of A9 cells with the infectious plasmid. Construction of MVMp-NS2null MVMp-NS2null was constructed by introducing multiple single-nucleotide mutations centered on the large splice acceptor site of the MVMp genome. The dimer bridge MVMp-bearing plasmid pdBMVp (Kestler et al., 1999) was used as a backbone. Mutations were introduced into the sequence using a PCR-based strategy. Primers capable of annealing but bearing the desired sequence changes were annealed to the pdBMVp template. Subsequent PCR reactions introduced changes into the amplified vector DNA. The final infectious MVMp-NS2null-bearing plasmid replaced nt 1988–1994 (Genbank Accession J02275) of the MVMp sequence, AGGTTCG, with CGGTAGC. The modifications were confirmed by sequencing. This complex mutation is the same as was described by Cotmore et al. (1997) who showed it to be resistant to reversion compared to single point mutations. Embryo inoculation in utero Virus diluted in sterile saline was injected into the liver of second trimester mouse embryos in utero as described previously (Itah et al., 2004a), with the exception that a pulled glass capillary needle and syringe pump were used instead of the Hamilton syringe for injection. Embryo dissection and sample preparation At chosen times post-infection, dams were killed and embryos with placentae were removed into cold physiological saline. Only live embryos exhibiting normal morphology were used for subsequent analysis. Embryos for Western and qPCR analyses were homogenized in 10 ml of cold physiological saline and the homogenates stored at 20 1C until analysis. Histology and immunohistochemistry Embryos were processed for cryosectioning and antibody incubation as described previously (Itah et al., 2004b) but with the addition of an initial 4% PFA, microwave-enhanced fixation (Kahveci et al., 1997) and equilibration in 15% sucrose before freezing. Quantitative real time PCR DNA was extracted from whole embryo homogenates using a standard SDS-Proteinase K-phenol extraction protocol (Maniatis et al., 1982). Diluted samples were subjected to quantitative realtime PCR (MyiQ, BioRad) using a Sybr Green I-containing reaction mix ( Sybr Fast, Kappa Biosystems) and the manufacturers' protocols. PCR primer pairs were as follows: VF 50 AAATACTCCTGTTGCGGGCACTGC and VR 50 CGTCAGATGGATTGGTTGGTTCTCC amplify a 371 bp fragment of the MVM viral genome, HF 50 TTCCCCTGTTCTCCCATTTTACTCG and HR 50 TCTTTGGACCCGCCTCATTTTTG amplify a 241 bp fragment of the host genome located in the GAPDH gene. Cycle efficiencies were calculated from dilution standards with each run and amplification integrity confirmed by melt curve analysis. Starting
Cytopathic effect assays Cleared homogenates from three different infected and uninfected embryos, and stock virus were used to infect log-phase A9 and NBK cells. Cells were grown in 12-well micro-titer plates and representative images were collected at 0, 1, 2, 5, and 6 days postinfection from each sample for imaging experiments. For virus quantitation, virus stock or extracts were serially diluted 10-fold and used to infect in triplicate NBK cells grown in 96 well plates. The cells were observed for each of six days after infection.
Acknowledgements We would like to thank Virginie Eichwald, Michèle Vogel, Natascha Winkelhöfer and Leura Gebert for assistance in constructing the MVMp NS2null mutant. This work was supported by German-Israeli Foundation for Scientific Research and Development Grant I-762-210.2 and Israel Science Foundation Grant 634/12. References Astell, C.R., Mol, C.D., Anderson, W.F., 1987. Structural and functional homology of parvovirus and papovavirus polypeptides. J. Gen. Virol. 68, 885–893. Besselsen, D.G., Romero, M.J., Wagner, A.M., Henderson, K.S., Livingston, R.S., 2006. Identification of novel murine parvovirus strains by epidemiological analysis of naturally infected mice. J. Gen. Virol. 87, 1543–1556. Bodendorf, U., Cziepluch, C., Jauniaux, J.C., Rommelaere, J., Salome, N., 1999. Nuclear export factor CRM1 interacts with nonstructural proteins NS2 from parvovirus minute virus of mice. J. Virol. 73, 7769–7779. Bonnard, G.D., Manders, E.K., Campbell Jr., D.A., Herberman, R.B., Collins Jr., M.J., 1976. Immunosuppressive activity of a subline of the mouse EL-4 lymphoma. Evidence for minute virus of mice causing the inhibition. J. Exp. Med. 143, 187–205. Brockhaus, K., Plaza, S., Pintel, D.J., Rommelaere, J., Salome, N., 1996. Nonstructural proteins NS2 of minute virus of mice associate in vivo with 14-3-3 protein family members. J. Virol. 70, 7527–7534. Brownstein, D.G., Smith, A.L., Johnson, E.A., Pintel, D.J., Naeger, L.K., Tattersall, P., 1992. The pathogenesis of infection with minute virus of mice depends on expression of the small nonstructural protein NS2 and on the genotype of the allotropic determinants VP1 and VP2. J. Virol. 66, 3118–3124. Cater, J.E., Pintel, D.J., 1992. The small non-structural protein NS2 of the autonomous parvovirus minute virus of mice is required for virus growth in murine cells. J. Gen. Virol. 73, 1839–1843. Choi, E.Y., Newman, A.E., Burger, L., Pintel, D., 2005. Replication of minute virus of mice DNA is critically dependent on accumulated levels of NS2. J. Virol. 79, 12375–12381. Cotmore, S., Tattersall, P., 1995. DNA replication in the autonomous parvoviruses. Semin. Virol. 6, 271–281. Cotmore, S.F., D’Abramo Jr., A.M., Carbonell, L.F., Bratton, J., Tattersall, P., 1997. The NS2 polypeptide of parvovirus MVM is required for capsid assembly in murine cells. Virology 231, 267–280. Cotmore, S.F., Tattersall, P., 1986. The NS-1 polypeptide of the autonomous parvovirus MVM is a nuclear phosphoprotein. Virus Res. 4, 243–250.
636
S. Tal et al. / Virology 468-470 (2014) 631–636
Cotmore, S.F., Tattersall, P., 1989. A genome-linked copy of the NS-1 polypeptide is located on the outside of infectious parvovirus particles. J. Virol. 63, 3902–3911. Cotmore, S.F., Tattersall, P., 1990. Alternate splicing in a parvoviral nonstructural gene links a common amino-terminal sequence to downstream domains which confer radically different localization and turnover characteristics. Virology 177, 477–487. Crawford, L.V., 1966. A minute virus of mice. Virology 29, 605–612. Deleu, L., Pujol, A., Faisst, S., Rommelaere, J., 1999. Activation of promoter P4 of the autonomous parvovirus minute virus of mice at early S phase is required for productive infection. J. Virol. 73, 3877–3885. Eichwald, V., Daeffler, L., Klein, M., Rommelaere, J., Salome, N., 2002. The NS2 proteins of parvovirus minute virus of mice are required for efficient nuclear egress of progeny virions in mouse cells. J. Virol. 76, 10307–10319. Engelsma, D., Valle, N., Fish, A., Salome, N., Almendral, J.M., Fornerod, M., 2008. A supraphysiological nuclear export signal is required for parvovirus nuclear export. Mol. Biol. Cell 19, 2544–2552. Itah, R., Gitelman, I., Tal, J., Davis, C., 2004a. Viral inoculation of mouse embryos in utero. J. Virol. Methods 120, 1–8. Itah, R., Tal, J., Davis, C., 2004b. Host cell specificity of minute virus of mice in the developing mouse embryo. J. Virol. 78, 9474–9486. Jindal, H.K., Yong, C.B., Wilson, G.M., Tam, P., Astell, C.R., 1994. Mutations in the NTP-binding motif of minute virus of mice (MVM) NS-1 protein uncouple ATPase and DNA helicase functions. J. Biol. Chem. 269, 3283–3289. Kahveci, Z., Cavusoglu, I., Sirmali, S.A., 1997. Microwave fixation of whole fetal specimens. Biotech. Histochem. 72, 144–147. Kerr, J.R., Boschetti, N., 2006. Short regions of sequence identity between the genomes of human and rodent parvoviruses and their respective hosts occur within host genes for the cytoskeleton, cell adhesion and Wnt signalling. J. Gen. Virol. 87, 3567–3575. Kestler, J., Neeb, B., Struyf, S., Van Damme, J., Cotmore, S.F., D’Abramo, A., Tattersall, P., Rommelaere, J., Dinsart, C., Cornelis, J.J., 1999. cis requirements for the efficient production of recombinant DNA vectors based on autonomous parvoviruses. Hum. Gene Ther. 10, 1619–1632. Kimsey, P.B., Engers, H.D., Hirt, B., Jongeneel, C.V., 1986. Pathogenicity of fibroblastand lymphocyte-specific variants of minute virus of mice. J. Virol. 59, 8–13. Littlefield, J.W., 1964. Three degrees of guanylic acid–inosinic acid pyrophosphorylase deficiency in mouse fibroblasts. Nature 203, 1142–1144. Lombardo, E., Ramirez, J.C., Garcia, J., Almendral, J.M., 2002. Complementary roles of multiple nuclear targeting signals in the capsid proteins of the parvovirus minute virus of mice during assembly and onset of infection. J. Virol. 76, 7049–7059. Mani, B., Baltzer, C., Valle, N., Almendral, J.M., Kempf, C., Ros, C., 2006. Low pHdependent endosomal processing of the incoming parvovirus minute virus of mice virion leads to externalization of the VP1 N-terminal sequence (N-VP1), N-VP2 cleavage, and uncoating of the full-length genome. J. Virol. 80, 1015–1024.
Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Marodi, L., 2006. Innate cellular immune responses in newborns. Clin. Immunol. 118, 137–144. Maroto, B., Valle, N., Saffrich, R., Almendral, J.M., 2004. Nuclear export of the nonenveloped parvovirus virion is directed by an unordered protein signal exposed on the capsid surface. J. Virol. 78, 10685–10694. McMaster, G.K., Beard, P., Engers, H.D., Hirt, B., 1981. Characterization of an immunosuppressive parvovirus related to the minute virus of mice. J. Virol. 38, 317–326. Merchlinsky, M.J., Tattersall, P.J., Leary, J.J., Cotmore, S.F., Gardiner, E.M., Ward, D.C., 1983. Construction of an infectious molecular clone of the autonomous parvovirus minute virus of mice. J. Virol. 47, 227–232. Miller, C.L., Pintel, D.J., 2002. Interaction between parvovirus NS2 protein and nuclear export factor Crm1 is important for viral egress from the nucleus of murine cells. J. Virol. 76, 3257–3266. Mincberg, M., 2008. The involvement of viral and cell proteins with the parvovirus Minute Virus of Mice (MVM) cis-elements on the pathogenesis pathway (Ph.D. thesis), Department of Virology and Developmental Biology. Ben Gurion University of the Negev. Naeger, L.K., Cater, J., Pintel, D.J., 1990. The small nonstructural protein (NS2) of the parvovirus minute virus of mice is required for efficient DNA replication and infectious virus production in a cell-type-specific manner. J. Virol. 64, 6166–6175. Naeger, L.K., Salome, N., Pintel, D.J., 1993. NS2 is required for efficient translation of viral mRNA in minute virus of mice-infected murine cells. J. Virol. 67, 1034–1043. Nam, H.J., Gurda-Whitaker, B., Gan, W.Y., Ilaria, S., McKenna, R., Mehta, P., Alvarez, R.A., Agbandje-McKenna, M., 2006. Identification of the sialic acid structures recognized by minute virus of mice and the role of binding affinity in virulence adaptation. J. Biol. Chem. 281, 25670–25677. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Shackelton, L.A., Holmes, E.C., 2006. Phylogenetic evidence for the rapid evolution of human B19 erythrovirus. J. Virol. 80, 3666–3669. Shein, H.M., Enders, J.F., 1962. Multiplication and cytopathogenicity of Simian vacuolating virus 40 in cultures of human tissues. Exp. Biology and Medicine 109, 495–500. Young, P.J., Jensen, K.T., Burger, L.R., Pintel, D.J., Lorson, C.L., 2002. Minute virus of mice small nonstructural protein NS2 interacts and colocalizes with the Smn protein. J. Virol. 76, 6364–6369. Young, P.J., Newman, A., Jensen, K.T., Burger, L.R., Pintel, D.J., Lorson, C.L., 2005. Minute virus of mice small non-structural protein NS2 localizes within, but is not required for the formation of, Smn-associated autonomous parvovirusassociated replication bodies. J. Gen. Virol. 86, 1009–1014.
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
The Minute Virus of Mice NS2 proteins are not essential for productive infection of embryonic murine cells in utero Saar Tal a, Michal Mincberg a, Irina Rostovsky a, Jean Rommelaere b, Nathali Salome b, Claytus Davis a,n a b
Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, Ben Gurion University of the Negev, Beer Sheva, Israel Division ofTumor Virology, Deutsches Krebsforschungszentrum, Heidelberg, Germany
art ic l e i nf o
a b s t r a c t
Article history: Received 6 May 2014 Returned to author for revisions 5 June 2014 Accepted 29 August 2014 Available online 11 October 2014
The P4 promoter of the autonomous parvovirus Minute Virus of Mice (MVM) drives the production of its non-structural proteins, NS1 and NS2. The NS2 isoforms are without enzymatic activity but interact with cellular proteins. While NS2 is crucial to the viral life cycle in cultured murine cells, NS2-null mutant virus productively infects transformed host cells of other species. In the mouse, sensitivity to MVM infection is age dependent, exhibiting limited subclinical infections in adults, but sustained and potentially lethal infection in embryos. We therefore questioned whether the species-dependent requirement for NS2 function in vitro would be retained in utero. We report here that it is not. NS2null mutant MVMp is capable of mounting a productive, albeit much reduced, infection of normal embryonic mouse cells in vivo. Based on the data, we hypothesize that NS2 may bear an as-yet undescribed immunosuppressive function. & 2014 Elsevier Inc. All rights reserved.
Keywords: Parvovirus Minute Virus of Mice Virus – host cell interaction Viral gene function Congenital infection NS2
Introduction The Parvoviridae are all the small, isometric, non-enveloped DNA viruses that contain linear single-stranded DNA genomes of 4000–6000 nt inside icosahedral capsids. Their genomes terminate in palindromic sequences that can base-pair to form hairpins or other complex forms. These are essential for replication and are the hallmark of the family. The parvovirus subfamily contains the autonomous, vertebrate-specific viruses and includes the prototypic group member, Minute Virus of Mice (MVM) (Crawford, 1966; Kerr and Boschetti, 2006). Among the MVM variants, two, MVMm and MVMc, are common pathogens in mouse animal colonies (Besselsen et al., 2006). Two others – the fibrotropic (MVMp) and the lymphotropic (MVMi) – are the most commonly studied parvoviruses in a research setting (Bonnard et al., 1976; Crawford, 1966; McMaster et al., 1981). The MVM genome contains two promoters, at map units 4 and 38, driving the expression of overlapping and alternatively spliced RNAs that encode the two major non-structural proteins, NS1 and NS2 (P4), and capsid proteins, VP1 and VP2 (P38). With their minimalist approach, all family members are tightly tuned to the host cell and the natural execution of its functions. None is able to push the cell cycle and each relies almost entirely on the normal host replication machinery (e.g. Deleu et al., 1999). Integration of
n
Corresponding author.
http://dx.doi.org/10.1016/j.virol.2014.08.032 0042-6822/& 2014 Elsevier Inc. All rights reserved.
virus replication into the host machinery is largely executed by the viral non-structural protein 1 (NS1), a pleiotropic 83 kDa (672 amino acid) nuclear phosphoprotein that binds to the viral DNA with sequence specificity. It has ATPase, helicase, nickase, and sitespecific endonuclease activities (Cotmore and Tattersall, 1995), and a Mg þ þ binding site (Astell et al., 1987; Cotmore and Tattersall, 1986; Jindal et al., 1994). On the other side of the lifecycle, binding and delivery of the viral genome through the cell and nuclear membranes and into the nucleus are mediated by the VP proteins which exhibit a strikingly diverse set of functions (e.g. Lombardo et al., 2002; Mani et al., 2006; Maroto et al., 2004; Nam et al., 2006). This leaves NS2. The NS2 protein has three isoforms NS2-P, NS2-Y, and NS2-L, derived from alternative splicing events (Cotmore and Tattersall, 1990) and having identical N-termini but different carboxy ends. They have no known enzymatic activities but are known to interact with a variety of cellular proteins, including members of the 14-3-3 family, SMN, and CRM1 (Bodendorf et al., 1999; Brockhaus et al., 1996; Young et al., 2002; Young et al., 2005). In the setting of its normal cultured murine host cells, NS2 is needed for genome replication (Choi et al., 2005; Naeger et al., 1990) and expression (Mincberg, 2008; Naeger et al., 1993), accumulation of NS1 (Naeger et al., 1990), capsid assembly (Cotmore et al., 1997), and production and nuclear egress of infectious particles (Eichwald et al., 2002; Engelsma et al., 2008; Miller and Pintel, 2002; Naeger et al., 1990). Given this range of interactions and roles, it is not surprising that NS2 is crucial for
632
S. Tal et al. / Virology 468-470 (2014) 631–636
viral reproduction in murine cells (Brownstein et al., 1992; Cater and Pintel, 1992; Naeger et al., 1990; Naeger et al., 1993). And it is surprising that NS2 is not needed for productive infection in transformed host cells of other species (Cater and Pintel, 1992; Naeger et al., 1990) although, even in other species, its loss can certainly reduce propagation of progeny virions (Cotmore et al., 1997). Although the two research strains of the virus, MVMp and MVMi, display limited and subclinical infections in adult mice in vivo, MVMi infection of neonates can be lethal (Kimsey et al., 1986) and we showed that both mounted productive, sustained and occasionally lethal infections in embryos inoculated during the second trimester in utero (Itah et al., 2004b). It was therefore a natural extension of the curious species-dependent requirement for NS2 to question whether the restriction observed in vitro would be retained in utero. We report here that it is not. NS2-null mutant MVMp is capable of mounting a productive, albeit much
reduced, infection of normal mid-trimester mouse embryos in utero.
Results Pattern of MVMp-NS2null infection in developing mouse embryos Our initial approach to characterizing a requirement for NS2 activity during infection in utero was to repeat with the mutant virus a time course infection study (Itah et al., 2004b). 5 105 pfu of MVMp-NS2null virus or MVMp-wt virus were injected into 13.5 dpc C57BL/6 embryos. After a further 24, 48, 72, or 96 h gestation, embryos were removed and processed for immunohistochemistry. At least 3 injected embryos and 2 non-injected littermates from each time point were serially sectioned and the distribution of viral capsid was determined using an anti-capsid primary
Dermis
Lung
A
B
ْC
D
E
F
wt
48hr
null
Epi
wt
Fib
72hr
G
H
null
I
MVMp-wt
MVMp-NS2null
Hepatocytes Podocytes Radial glia/ neurons Smooth muscle
Fibroblasts Mesothelium Endothelium Epithelium
Fig. 1. MVMp-NS2null infection in C57BL/6 embryos. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp-wt at 13.5 dpc by injection in utero (Materials and methods). Gestation was left to continue for another 24, 48, 72, or 96 h. Embryos were collected, sectioned and subjected to immunohistochemistry using a polyclonal anti-MVMp capsid primary antibody and Cy3-labeled secondary antibody (Materials and methods). Viral coat protein distribution is shown in image pairs (A–H): immunofluorescence (left) and DIC (right). Two representative tissues showing widespread infection, dermis (A, C, E, G) and lung (B, D, F, H), were selected for illustration. Panels are 48 h post-inoculation (A–D) or 72 h post-inoculation (E–H). Inoculum was either wild type MVMp (A, B, E, F) or NS2 null mutant virus (C, D, G, H). (I) Tropism of MVMp-NS2null virus vs. MVMp wt virus. Host cell types were determined by histology and immunohistochemistry at 24, 48, 72, and 96 h post-infection. Fib – fibroblasts, and Epi – epithelia.
S. Tal et al. / Virology 468-470 (2014) 631–636
633
antibody. Characteristic signal patterns and intensities are shown in Fig. 1. The combined host cell type results were compiled and compared (Fig 1H). Like the parental MVMp, sparsely distributed signal was observed by 24 h. Over the next three days, the extent of infection increased, but was at all times less in extent and intensity than wildtype MVMp infection in C57BL/6 embryos. None of the uninjected littermate embryos exhibited signal. These results provided an initial indication that NS2 activity is not essential for productive infection of the mouse embryo. With respect to host cell type specificity, those cell types most frequently infected by the wildtype virus, fibroblasts, epithelia, and mesothelia, were also infected by the NS2-null mutant. Some cell types less frequently infected by wildtype MVMp were not observed to stain in the NS2-null mutant infected embryos (Fig. 1H). However, MVMp-NS2null did sporadically infect endothelium, a cell type that the parental MVMp was never observed to infect, but one which the related MVMi regularly did. Viral NS1 protein production in infected embryos Given the discrepancy between the literature and our in utero results concerning NS2, corroborating evidence of productive infection of the NS2-null mutant was needed, especially since the viral element being detected, capsid, was present in the inoculum. We therefore collected NS2-null infected embryos and littermates as described above and looked for the presence of NS1, the non-structural protein known to be essential for productive infection, by Western analysis. A total of four different MVMPNS2null-injected and two contra-lateral embryo lysates were used for each time point (0 h, 24 h, 48 h, 72 h and 96 h). As a positive control we used lysate from an MVMp w.t.-infected embryo at 96 h and as a negative control an uninfected embryo of the same gestational age. We detected increasing levels of viral NS1 protein in all injected and incubated embryos (Fig. 2). As expected, uninfected embryos did not show signal. The weak signal at time 0, before there is any chance of translation of viral product by the host, is most likely due to the frequent tethering of a single NS1 molecule to the 30 termini of encapsidated genomes (Cotmore and Tattersall, 1989). This result indicates that MVMp-NS2null is at least able to complete formation of the viral RF genome and to transcribe it in the developing mouse embryo. Viral quantitation by qPCR in MVMp-NS2null infected embryos To quantitate NS2-null viral infection in developing mouse embryos total DNA samples from embryos infected as above were prepared and viral genome copy number was measured by qPCR and normalized to host genome copy number, similarly determined. Untreated embryos from the same incubational period were used as negative controls. The results (Fig. 3) show small but increasing viral burdens starting at 24 h post-infection. The small signal observed at time 0 probably represents the incoming viral
HPI 83 kDa
NC
0
24
NS2-null 48 72
96
MVMp 96 NS1
Fig. 2. MVMp-NS2null NS1 protein expression. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp wildtype at 13.5 dpc. Embryos were collected immediately (t¼ 0) or gestation was left to continue for the times shown (t¼ 24, 48, 72, 96 h). Embryos were collected, homogenized, and equal amounts of proteins subjected to PAGE. Viral NS1 proteins were detected by Western analysis (Materials and methods). h.p.i – hours post-infection, and N.C. – negative control uninfected cells.
Fig. 3. Viral DNA burden in MVMp-NS2null infected embryos. C57BL/6 embryos were inoculated with virus and homogenates prepared 24, 48, 72 and 96 h postinoculation as described. Genomic DNA was prepared and subjected to qPCR using primers amplifying a fragment of the mouse genome and primers amplifying a fragment of the MVM viral genome (Materials and methods). At least 4 embryos/ time point were analyzed. Viral levels were normalized to mouse genome levels to give an approximate estimate of viral genomes/haploid host genome. Solid bars – NS2-null, Hatched bar – MVMp wildtype. Hash marks on the Y-axis and MVMp wt bar indicate a depicted jump in the scale. Error bars are Standard Error of Mean.
genomes in the inoculum. The virus levels in the NS2-null mutant infections were lower than observed for w.t. MVM by a factor of 30.
Production of infectious virions in MVMp-NS2null infected embryos The above results could possibly be explained by postulating that the NS2-null virus is able to infect embryonic cells and then over the course of the continued gestation drive the accumulation of viral products in those initially infected cells, without fully completing the viral lifecycle. Indeed, MVMp-NS2null virus is able to advance part way through its life cycle in murine cells in vitro, at least accumulating replicative double-stranded DNA genomes, albeit at much reduced rates (Cotmore et al., 1997). To show that MVMp-NS2null fully completes the viral life cycle and produces infectious virions in the embryo, we used embryo homogenates prepared 24, 72, and 96 h after inoculation to infect NBK cells (5 μl/well in 24 wells plate), a human transformed host cell type that is productively infected by NS2-null MVMp and A9 cells, murine fibroblasts that absolutely require NS2 activity for productive infection. The cultures were inspected and photographed 3 and 7 days post-infection. At 7 DPI, a distinct cytopathic effect was observed in NBK cells treated with the extracts from embryos inoculated 96 h earlier with either w.t. or MVMp-NS2null virus, indicating a progressive infection. This effect was much reduced in cells infected with 24 h extract and absent in negative control cultures. As expected, A9 cells exhibited no cytopathic effect after treatment with the 96 h extract from embryos inoculated with MVMp-NS2null virus but a clear cytopathic effect when treated with extracts from embryos infected with wild type MVMp (Fig. 4). We estimated the extent of infectious virion production during incubation in utero by end-point dilution assay. The MVMpNS2null stock and 96 h infected embryo homogenates were serially diluted and used to infect NBK cells in triplicate. Total infectious particle yield in the embryo was estimated to be 1.6 108 pfu. Since the initial inoculum contained 5 105 pfu of NS2null virus, the 96 h incubation was accompanied by an approximately 300-fold increase in infectious particles.
634
S. Tal et al. / Virology 468-470 (2014) 631–636
Uninfected
MVMp-NS2null 24 h lysate 96 h lysate
MVMp wt 96 h lysate
Uninfected
MVMp-NS2null 24 h lysate 96 h lysate
MVMp wt 96 h lysate
NBK
MVMp-NS2null Stock
A9
Fig. 4. Cytotoxic effect of NS2null injected embryo homogenates on NBK cells. C57BL/6 embryos were inoculated with 5 105 pfu of MVMp-NS2null or MVMp wildtype (wt) at 13.5 dpc and homogenates prepared at 24 or 96 h post-inoculation as described. Cleared homogenates from inoculated embryos were used to infect mid-log phase NBK or A9 cells. The cells were inspected daily and photographed 6 days post-infection. Negative control (uninfected) NBK and A9 cells were treated with PBS.
The NS2-null mutation is stable over the embryonic infection course One final confounding scenario to consider was the possibility that, while the inoculum consisted of NS2null mutant virus, during the course of a non-productive infection, the engineered mutation reverted to wildtype; and that this, not the original mutant was responsible for our results. Infection was limited to 96 h; nonetheless, parvoviral mutation rates could be strikingly high, more similar to retrovirus than other DNA viruses (Shackelton and Holmes, 2006). To rule out the possibility of reversion during the infection, the region covering the engineered NS2null mutation was amplified by PCR from 96 h embryo lysates, sequenced, and then compared to the w.t. genome. The automated sequencer base calling indicated that the mutation had been retained and visual inspection of the raw electropherograms did not reveal any evidence of sequence heterogeneity in the region. We conclude that the infection data obtained was due to activity of the mutant virus alone.
Discussion Our data indicate that NS2 function is not absolutely essential for replication of MVM in murine host cells. Given the published literature, this is somewhat surprising, but, we suggest, not completely unexpected. The function of the parvovirus NS2 protein during the viral lifecycle has always had an enigmatic aspect. On one hand, the abundance of identified interactions and the typically deleterious consequences of ablating NS2 activity indicate that the proteins play one or more vital roles, although the only mechanistic pathway traced between an interaction and the normal events of viral replication is the NS2/Crm1 interaction and virion nuclear egress (Eichwald et al., 2002; Miller and Pintel, 2002). However there must be additional functions. In murine A9 fibroblasts, NS2null mutant virus fails to produce any single-stranded viral genomes. Yet in at least some cells in culture that are not derived from its normal host species, the functionally deficient virus produces single-stranded genome and is able to complete its lifecycle but with a much delayed virion release (Cotmore et al., 1997). Similarly, we (Eichwald and Salome, unpublished) observed that infection of human 293 T cells with NS2null mutant virus yielded relatively small plaques, a result that also suggests flawed virion propagation.
The infection in vivo provides grounds for some hypothesizing. First, the data show that, although NS2 is not essential for replication, it is still important. In all of our assays, infection parameters were greatly diminished with the mutant virus. This is consistent with infection studies in other experimental settings. The reduction in viral burden in most cell types in which NS2 is not essential is so severe that the infection can almost be considered accidental. For instance, if we accept a central role for NS2 in propagation of infectious particles (e.g. Cotmore et al., 1997), then we can view the resulting infectious virion production during an NS2-null infection of human NBK cells as chance release—an accidental byproduct resulting from an abundance of primary reactants. Nonetheless, in the complete absence of NS2, production, albeit much reduced, does occur in some systems, but not in others. One possibility is that these productive cells are providing the virus with some helper activity that circumvents the need for an NS2 mediated function. Alternatively, we suggest that the difference can be accounted for by assigning another, independent function to NS2—not unlikely given the number of variants and the multiple identified independent interactions with host cell factors. If this function is mediated through interaction with a host factor, then there are two possibilities—that the interaction promotes completion of part of the viral life cycle, or that the interaction alleviates a cellular block to viral replication. There is little reason to favor one over the other, although our in utero data tilts towards the latter. The innate immune system that drives anti-viral responses is underdeveloped in the embryo (e.g. Marodi, 2006). It would not be surprising that the virus is better able to replicate when missing a component that inhibits an inhibitor—if the inhibitor itself is missing from the cell. Currently we suspect that this is one of the reasons that the wildtype virus is able to mount a much more aggressive infection in the embryo than in neonates or adults. Searching for interaction between NS2 and the cellular antiviral machinery may be rewarding.
Materials and methods Cells A9 – A subline of mouse fibroblast L-cells (Littlefield, 1964). NBK – A SV40 transformed newborn human kidney cells (Shein and Enders, 1962). Cells were grown at 37 1C, 5% CO2 in DMEM
S. Tal et al. / Virology 468-470 (2014) 631–636
635
with 5% fetal bovine serum (FBS), 0.8% Penicillin (10,000 μ/ml)/ Streptomycin(10 mg/ml), and 2% Glutamine.
signal was derived from Ct crossing number using the Pfaffle formulation (Pfaffl, 2001) excluding the fold-induction final step.
Virus
Western analysis Proteins were prepared from embryo homogenates by TCA precipitation and then resuspended in cracking buffer (8 M Urea, 10 mM NaPO4, 1% βmercapoethanol, 1% SDS). Following addition of sample buffer, samples were heated for 5 min at 95 1C, centrifuged, and equal quantities of soluble proteins were fractionated by 10% SDS-polyacrylamide gel electrophoresis. Proteins were blotted onto nitrocellulose membrane (Amersham), which was then blocked with 1X TBST containing 10% Skim milk powder (FLUKA) and 0.2% Tween 20 for 1 h. For detection of viral protein production, a primary monoclonal antibody recognizing NS1 (CE10, gift from C. Astell), a secondary polyclonal antibody (peroxidase-conjugated Anti-Mouse IgG(H þL), Jackson ImmunoResearch), and a chemiluminescence kit (SuperSignal West Pico Chemiluminescent Substrate, Thermo) were used in a standard Western procedure using the manufacturers' recommendations.
MVMp-wt Wild-type MVMp double-stranded DNA was excised from pMM984 (Merchlinsky et al., 1983) and cloned into a high copy number plasmid vector, pGEM-T, and grown in Escherichia coli SureII host cells. MVMp-wt virion was prepared by transfection of A9 cells with the infectious plasmid. Construction of MVMp-NS2null MVMp-NS2null was constructed by introducing multiple single-nucleotide mutations centered on the large splice acceptor site of the MVMp genome. The dimer bridge MVMp-bearing plasmid pdBMVp (Kestler et al., 1999) was used as a backbone. Mutations were introduced into the sequence using a PCR-based strategy. Primers capable of annealing but bearing the desired sequence changes were annealed to the pdBMVp template. Subsequent PCR reactions introduced changes into the amplified vector DNA. The final infectious MVMp-NS2null-bearing plasmid replaced nt 1988–1994 (Genbank Accession J02275) of the MVMp sequence, AGGTTCG, with CGGTAGC. The modifications were confirmed by sequencing. This complex mutation is the same as was described by Cotmore et al. (1997) who showed it to be resistant to reversion compared to single point mutations. Embryo inoculation in utero Virus diluted in sterile saline was injected into the liver of second trimester mouse embryos in utero as described previously (Itah et al., 2004a), with the exception that a pulled glass capillary needle and syringe pump were used instead of the Hamilton syringe for injection. Embryo dissection and sample preparation At chosen times post-infection, dams were killed and embryos with placentae were removed into cold physiological saline. Only live embryos exhibiting normal morphology were used for subsequent analysis. Embryos for Western and qPCR analyses were homogenized in 10 ml of cold physiological saline and the homogenates stored at 20 1C until analysis. Histology and immunohistochemistry Embryos were processed for cryosectioning and antibody incubation as described previously (Itah et al., 2004b) but with the addition of an initial 4% PFA, microwave-enhanced fixation (Kahveci et al., 1997) and equilibration in 15% sucrose before freezing. Quantitative real time PCR DNA was extracted from whole embryo homogenates using a standard SDS-Proteinase K-phenol extraction protocol (Maniatis et al., 1982). Diluted samples were subjected to quantitative realtime PCR (MyiQ, BioRad) using a Sybr Green I-containing reaction mix ( Sybr Fast, Kappa Biosystems) and the manufacturers' protocols. PCR primer pairs were as follows: VF 50 AAATACTCCTGTTGCGGGCACTGC and VR 50 CGTCAGATGGATTGGTTGGTTCTCC amplify a 371 bp fragment of the MVM viral genome, HF 50 TTCCCCTGTTCTCCCATTTTACTCG and HR 50 TCTTTGGACCCGCCTCATTTTTG amplify a 241 bp fragment of the host genome located in the GAPDH gene. Cycle efficiencies were calculated from dilution standards with each run and amplification integrity confirmed by melt curve analysis. Starting
Cytopathic effect assays Cleared homogenates from three different infected and uninfected embryos, and stock virus were used to infect log-phase A9 and NBK cells. Cells were grown in 12-well micro-titer plates and representative images were collected at 0, 1, 2, 5, and 6 days postinfection from each sample for imaging experiments. For virus quantitation, virus stock or extracts were serially diluted 10-fold and used to infect in triplicate NBK cells grown in 96 well plates. The cells were observed for each of six days after infection.
Acknowledgements We would like to thank Virginie Eichwald, Michèle Vogel, Natascha Winkelhöfer and Leura Gebert for assistance in constructing the MVMp NS2null mutant. This work was supported by German-Israeli Foundation for Scientific Research and Development Grant I-762-210.2 and Israel Science Foundation Grant 634/12. References Astell, C.R., Mol, C.D., Anderson, W.F., 1987. Structural and functional homology of parvovirus and papovavirus polypeptides. J. Gen. Virol. 68, 885–893. Besselsen, D.G., Romero, M.J., Wagner, A.M., Henderson, K.S., Livingston, R.S., 2006. Identification of novel murine parvovirus strains by epidemiological analysis of naturally infected mice. J. Gen. Virol. 87, 1543–1556. Bodendorf, U., Cziepluch, C., Jauniaux, J.C., Rommelaere, J., Salome, N., 1999. Nuclear export factor CRM1 interacts with nonstructural proteins NS2 from parvovirus minute virus of mice. J. Virol. 73, 7769–7779. Bonnard, G.D., Manders, E.K., Campbell Jr., D.A., Herberman, R.B., Collins Jr., M.J., 1976. Immunosuppressive activity of a subline of the mouse EL-4 lymphoma. Evidence for minute virus of mice causing the inhibition. J. Exp. Med. 143, 187–205. Brockhaus, K., Plaza, S., Pintel, D.J., Rommelaere, J., Salome, N., 1996. Nonstructural proteins NS2 of minute virus of mice associate in vivo with 14-3-3 protein family members. J. Virol. 70, 7527–7534. Brownstein, D.G., Smith, A.L., Johnson, E.A., Pintel, D.J., Naeger, L.K., Tattersall, P., 1992. The pathogenesis of infection with minute virus of mice depends on expression of the small nonstructural protein NS2 and on the genotype of the allotropic determinants VP1 and VP2. J. Virol. 66, 3118–3124. Cater, J.E., Pintel, D.J., 1992. The small non-structural protein NS2 of the autonomous parvovirus minute virus of mice is required for virus growth in murine cells. J. Gen. Virol. 73, 1839–1843. Choi, E.Y., Newman, A.E., Burger, L., Pintel, D., 2005. Replication of minute virus of mice DNA is critically dependent on accumulated levels of NS2. J. Virol. 79, 12375–12381. Cotmore, S., Tattersall, P., 1995. DNA replication in the autonomous parvoviruses. Semin. Virol. 6, 271–281. Cotmore, S.F., D’Abramo Jr., A.M., Carbonell, L.F., Bratton, J., Tattersall, P., 1997. The NS2 polypeptide of parvovirus MVM is required for capsid assembly in murine cells. Virology 231, 267–280. Cotmore, S.F., Tattersall, P., 1986. The NS-1 polypeptide of the autonomous parvovirus MVM is a nuclear phosphoprotein. Virus Res. 4, 243–250.
636
S. Tal et al. / Virology 468-470 (2014) 631–636
Cotmore, S.F., Tattersall, P., 1989. A genome-linked copy of the NS-1 polypeptide is located on the outside of infectious parvovirus particles. J. Virol. 63, 3902–3911. Cotmore, S.F., Tattersall, P., 1990. Alternate splicing in a parvoviral nonstructural gene links a common amino-terminal sequence to downstream domains which confer radically different localization and turnover characteristics. Virology 177, 477–487. Crawford, L.V., 1966. A minute virus of mice. Virology 29, 605–612. Deleu, L., Pujol, A., Faisst, S., Rommelaere, J., 1999. Activation of promoter P4 of the autonomous parvovirus minute virus of mice at early S phase is required for productive infection. J. Virol. 73, 3877–3885. Eichwald, V., Daeffler, L., Klein, M., Rommelaere, J., Salome, N., 2002. The NS2 proteins of parvovirus minute virus of mice are required for efficient nuclear egress of progeny virions in mouse cells. J. Virol. 76, 10307–10319. Engelsma, D., Valle, N., Fish, A., Salome, N., Almendral, J.M., Fornerod, M., 2008. A supraphysiological nuclear export signal is required for parvovirus nuclear export. Mol. Biol. Cell 19, 2544–2552. Itah, R., Gitelman, I., Tal, J., Davis, C., 2004a. Viral inoculation of mouse embryos in utero. J. Virol. Methods 120, 1–8. Itah, R., Tal, J., Davis, C., 2004b. Host cell specificity of minute virus of mice in the developing mouse embryo. J. Virol. 78, 9474–9486. Jindal, H.K., Yong, C.B., Wilson, G.M., Tam, P., Astell, C.R., 1994. Mutations in the NTP-binding motif of minute virus of mice (MVM) NS-1 protein uncouple ATPase and DNA helicase functions. J. Biol. Chem. 269, 3283–3289. Kahveci, Z., Cavusoglu, I., Sirmali, S.A., 1997. Microwave fixation of whole fetal specimens. Biotech. Histochem. 72, 144–147. Kerr, J.R., Boschetti, N., 2006. Short regions of sequence identity between the genomes of human and rodent parvoviruses and their respective hosts occur within host genes for the cytoskeleton, cell adhesion and Wnt signalling. J. Gen. Virol. 87, 3567–3575. Kestler, J., Neeb, B., Struyf, S., Van Damme, J., Cotmore, S.F., D’Abramo, A., Tattersall, P., Rommelaere, J., Dinsart, C., Cornelis, J.J., 1999. cis requirements for the efficient production of recombinant DNA vectors based on autonomous parvoviruses. Hum. Gene Ther. 10, 1619–1632. Kimsey, P.B., Engers, H.D., Hirt, B., Jongeneel, C.V., 1986. Pathogenicity of fibroblastand lymphocyte-specific variants of minute virus of mice. J. Virol. 59, 8–13. Littlefield, J.W., 1964. Three degrees of guanylic acid–inosinic acid pyrophosphorylase deficiency in mouse fibroblasts. Nature 203, 1142–1144. Lombardo, E., Ramirez, J.C., Garcia, J., Almendral, J.M., 2002. Complementary roles of multiple nuclear targeting signals in the capsid proteins of the parvovirus minute virus of mice during assembly and onset of infection. J. Virol. 76, 7049–7059. Mani, B., Baltzer, C., Valle, N., Almendral, J.M., Kempf, C., Ros, C., 2006. Low pHdependent endosomal processing of the incoming parvovirus minute virus of mice virion leads to externalization of the VP1 N-terminal sequence (N-VP1), N-VP2 cleavage, and uncoating of the full-length genome. J. Virol. 80, 1015–1024.
Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Marodi, L., 2006. Innate cellular immune responses in newborns. Clin. Immunol. 118, 137–144. Maroto, B., Valle, N., Saffrich, R., Almendral, J.M., 2004. Nuclear export of the nonenveloped parvovirus virion is directed by an unordered protein signal exposed on the capsid surface. J. Virol. 78, 10685–10694. McMaster, G.K., Beard, P., Engers, H.D., Hirt, B., 1981. Characterization of an immunosuppressive parvovirus related to the minute virus of mice. J. Virol. 38, 317–326. Merchlinsky, M.J., Tattersall, P.J., Leary, J.J., Cotmore, S.F., Gardiner, E.M., Ward, D.C., 1983. Construction of an infectious molecular clone of the autonomous parvovirus minute virus of mice. J. Virol. 47, 227–232. Miller, C.L., Pintel, D.J., 2002. Interaction between parvovirus NS2 protein and nuclear export factor Crm1 is important for viral egress from the nucleus of murine cells. J. Virol. 76, 3257–3266. Mincberg, M., 2008. The involvement of viral and cell proteins with the parvovirus Minute Virus of Mice (MVM) cis-elements on the pathogenesis pathway (Ph.D. thesis), Department of Virology and Developmental Biology. Ben Gurion University of the Negev. Naeger, L.K., Cater, J., Pintel, D.J., 1990. The small nonstructural protein (NS2) of the parvovirus minute virus of mice is required for efficient DNA replication and infectious virus production in a cell-type-specific manner. J. Virol. 64, 6166–6175. Naeger, L.K., Salome, N., Pintel, D.J., 1993. NS2 is required for efficient translation of viral mRNA in minute virus of mice-infected murine cells. J. Virol. 67, 1034–1043. Nam, H.J., Gurda-Whitaker, B., Gan, W.Y., Ilaria, S., McKenna, R., Mehta, P., Alvarez, R.A., Agbandje-McKenna, M., 2006. Identification of the sialic acid structures recognized by minute virus of mice and the role of binding affinity in virulence adaptation. J. Biol. Chem. 281, 25670–25677. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Shackelton, L.A., Holmes, E.C., 2006. Phylogenetic evidence for the rapid evolution of human B19 erythrovirus. J. Virol. 80, 3666–3669. Shein, H.M., Enders, J.F., 1962. Multiplication and cytopathogenicity of Simian vacuolating virus 40 in cultures of human tissues. Exp. Biology and Medicine 109, 495–500. Young, P.J., Jensen, K.T., Burger, L.R., Pintel, D.J., Lorson, C.L., 2002. Minute virus of mice small nonstructural protein NS2 interacts and colocalizes with the Smn protein. J. Virol. 76, 6364–6369. Young, P.J., Newman, A., Jensen, K.T., Burger, L.R., Pintel, D.J., Lorson, C.L., 2005. Minute virus of mice small non-structural protein NS2 localizes within, but is not required for the formation of, Smn-associated autonomous parvovirusassociated replication bodies. J. Gen. Virol. 86, 1009–1014.
