Mammalian Genome 2: 96--99, 1992
enome 9 Springer-VerlagNew York Inc. 1992
The mink gene for the h light immunoglobulin chain: Characterization of cDNA and chromosomal localization T.M. Khlebodarova, N.M. Matveeva, O.L. Serov, A.M. Najakshin, E.S. Belousov, S.V. Bogachev, and O.K. Baranov Institute of Cytology and Genetics, Academy of Sciences of the USSR, Siberian Department, Novosibirsk-90, USSR Received January 25, 1991; accepted June 20, 1991
Abstract. A cDNA library from mink spleen was constructed by use of the phage hgtll. The library was screened using polyvalent serum raised against the mink immunoglobulin k chain. As a result, several clones expressing mink immunoglobulin h light chains were identified. Sequencing of one of the clones with an 803 bp insert was performed. The insert comprised nearly the entire coding region for the mature k light immunoglobulin gene with the exception of the leader polypeptide and several amino acids of the FR1 region of the V segment. Compared with the rabbit, mouse and human h light immunoglobulin genes, the homology of the cloned sequence was found to be highest relative to the rabbit gene. With the cloned mink cDNA containing the C-region only as a probe, the DNAs from mink-Chinese hamster hybrid clones were studied. The results of segregation analysis of this mink cDNA sequence and mink chromosomes in the mink-Chinese hamster clone panel allowed us to assign the gene for the k light immunoglobulin constant polypeptide (IGLC) to mink Chromosome (Chr) 4.
Introduction Immunoglobulin molecules consist of four polypeptide chains: two identical heavy and two identical light chains. The mature genes coding for the immunoglobulin chains are formed during the differentiation of B lymphocytes as a result of rearrangement of germ line DNA. The light chains are composed of three (V/~, JL, CL) regions and the heavy of four regions (VH, D, JH, CH; Tonegawa 1983). There are five classes of heavy chains (Ix, g, % oL, ~) and two of light chains (K and h). The nucleotide sequence data reported in this paper have been submitted to the EMBL Data Library and have been assigned the accession number X56270 mink mRNA for X. Offprint requests to: O.L. Serov
Chromosome assignments have been made for the immunoglobulin genes of several mammals, including human and mouse. In human and mouse, the heavychain genes are, respectively, on Chrs 14 and 12, the K-chain genes on Chrs 2 and 6, and the k-chain genes are on Chrs 22 and 16 (Croce et al. 1979; Erikson et al. 1981; Malcolm et al. 1982; Hehgartner et al. 1978; D'Eustachio et al. 1981). Thus, the gene families for the heavy chains, K-chains, and h-chains, reside on different linkage groups. In this paper we describe the cloning and sequencing of a cDNA for the mink h light immunoglobulin chain and the chromosome localization of the mink h light immunoglobulin constant gene (IGLC). Materials and methods The spleen from a mink was used as the source of total RNA extracted by the urea-LiCl procedure of Auffray and Rougeon (1980). The poly(A+)-mRNA was purified by two passages through an oligo(dT~z,ts)-cellulose column (Aviv and Leder 1972). Doublestranded cDNA prepared by the method of Maniatis and others (1982) was inserted into the EcoR I site of the phage kgtl 1. A cDNA library (200,000 recombinants) was constructed and screened for the k light immunoglobulin sequence as described by Young and Davis (1983). Several clones giving strong signals with polyvalent serum raised against the mink k light immunoglobulin chains were isolated. To facilitate further analysis of the primary structure, MGL-2, one of the recombinant phages containing a 803 bp insert was recloned into the plasmid pUC19 (plGL-2 clone) and sequenced according to Maxam and Gilbert (1980). The plasmid plGL-21 was constructed from plGL-2. A D N A fragment containing the V J-region was deleted by exonuclease III and Sl-nuclease as described (Henikoff 1984). The plasmid plGL-21 containing the C-region of the mink IGL gene only was used as a probe for the determination of chromosome localization of the mink IGLC gene. To map the mink IGLC gene, we used a set of mink-Chinese hamster cell hybrids. The creation of a panel of mink-Chinese hamster cell hybrids and their karyotype characterization was described in previous papers (Serov et al. 1987; Matveeva et al. 1987). Conditions for cultivation of mink and Chinese hamster cells, as well as mink-Chinese hamster hYbrid clones, were as reported elsewhere (Rubtsov et al. 1981; Sukoyan et al. 1984).
T.M. Khlebodarova et al.: Mink gene for X light chain
97
Extraction of DNA from the cell hybrids and parental cell lines, the conditions for digestion with restriction endonuclease EcoR I have been described (Matveeva et al. 1987). DNA was transferred to g-probe blotting membrane in 0.4 M NaOH (Reed and Mann 1985). Prehybridization, hybridization and washing of the nylon filters after hybridization were all carried out at 65~ as previously described (Khlebodarova et al. 1988). To obtain the 400 bp C-region of the mink k light immunoglobulin gene, the plasmid pIGL-21 was digested with restriction endonuclease Pst I, subjected to electrophoresis in 0.8% agarose gel and electroelution. The DNA fragment was labeled with n p to a specific activity of 1 - 2 x 109 cproJlxg by the random-priming technique (Hodson and Fisk 1987). The probe was hybridized with fixed DNA on nylon filters at a concentration of 10 ng/ml.
Results and discussion
Screening of the cDNA library allowed us to identify seven clones. Of these, four gave no hybridization signals in the immunoblottings, and they were, consequently, illegitimate. Of the remaining clones, one had an insertion of 300 bp (plGL-I), and two clones had an insertion 803 bp in length (plGL-2 and plGL-7). It should be noted that the restriction maps of the clones were identical. Sequencing of the clone containing the 300 bp insert revealed that it had a polyA tract and a 3' untranslated sequence. For these reasons the plGL-1 clone was not analyzed later. The sequence of one clone with the 803 bp insert (plGL-2) is depicted in Fig. 1. The sequence has an open reading frame 636 bp long and a polyadenylation
site 65 bp far from the stop codon. Comparisons with the previously cloned rat, mouse, and human genes (Bernard et al. 1978; Hieter et al. 1981; Hayzer et al. 1987) revealed that this sequence codes for the k-light immunoglobulin chain and contains nearly the entire V-region, J-region, C-region, and the 3' untranslated region. When the sequence of the clone was aligned with the gene sequences, the rabbit k-gene was found to have the highest homology with the mink h-gene. The levels of homology in the coding sequences were as follows: the C segment, 79%; the J segment, 94%; and the FR3 region of the V segment, 63%. The homology levels for the other regions of the V segment and the 3' untranslated region did not exceed 40%. As compared with sequence of the rabbit immunogtobulin chain, the homology levels for the deduced sequence from clone pIGL-2 were 40% for the V, 68% for the C, and 100% for the J segment. A sequence containing the C-region and 3'untranslated region is designated in Fig. 1. The sequence was used as a probe for the chromosome localization of the mink IGLC gene. Under the hybridization conditions used, it did not cross react with Chinese hamster DNA, thus simplifying gene localization. The results for the hybridization of the EcoR I digests of the DNAs from mink (cell line MV), Chinese hamster (cell line V79) and some mink-Chinese hamster hybrid clones with the fragment of cDNA from
TC&TACT CTCAGCCCCCA TT&TG CA&TG6CTC G
................
CAGACAGCCCGAGTCACCTGTGGGGGCJ~kC;kACATTGGA~T~3%-ATGTTCACT GGTAC
20 40
II
CDRI
C GCAGhGCeG&Gec &cTce iTACTG TC TC AT& / C C CC CCeTC J FR2
J [ ~
60
CDR2
&~ATTCCT~AGC~ATTTTeAGGeAec~eTeTGsS~eATG&TTACeCTGAeTATCAGT 80 [
FR3
i00 GG~GeeCGGGCTGAG&ATGAGGCTGACTaT~AeT~TC~GT~T~SG~T~ceASTTCr~T ][ CDR3
A & G TC&GC&G & CCCA C &CC%TCC & TC CCOC C&TCC C CC C120 9
I
J
II
&GC.C&C CCCGCCCCCCT&AGGCC&C&CC,GC-b-&CC-CCC & C140 . G G.C A G.A C G G C A iG C. T C A. T C A. G T .G A T.T T C. T A C. C C C. A G C. G G .C G T.G A C. G G T. G G C. C T G. G A A C-region
&cc
160
Tc cc AG GC TG;Ac cciccL G cc ceL AG;GcL cL cL G Ac;cG;cc 180 GC GC AC TG GC TG CA&T ACL G G& CT&C GC GC TC GC GC G GTCACACACGAGGGC~uMAACCGTGGAGAAG/%-AGGTGGTCCCCTCACAGTGCTCT~GTC 3 CCTGAGACTTCCAGGGATGGGGGCCTTCCTCTCCCAGATACCCCTTTGCCAGCTCACCAT 3'- u n t r a n s l a t e d region
GCCCCCCTGAGTCCCCACCCAGGTTCTGCTCAGAGCAGGCAGGTCACAATGCCATCCCTG TTTATTATTTGCT~ATCTCATCATTTATCATCTG
200 218
Fig. 1. A nucleotide sequence of a cDNA for the mink k light immunoglobulin polypeptide. The positions of FRs, CDRs, the J-region, the C-region and 3'-untrans!ated regions are indicated. The codon position is numbered according to that reported in Kabat and co-workers (1983). The TAG termination codon and polyadenylation site are boxed. Arrow designates the sequence of the plGL-21 clone,
98
T.M. Khlebodarova et al.: Mink gene for h light chain
in all the positive hybrid clones (Fig. 2). In our previous study of mink-mouse hybridoma cells, we have observed that this concomitant appearance of EcoR I digests is a feature of clones secreting mink h light immunoglobulin chains (unpublished data). This pattern of EcoR I fragments may possibly be a reflection of the structure of the mature IGL gene. Clone K02-1 was exceptional. It did not contain the major mink IGL fragment 19 kb long, yet it contained a 17 kb fragment (Fig. 2). A point to be considered is that bone marrow cells and leukocytes from several animals were used to prepare the mink-Chinese h a m s t e r cell hybrids (Rubtsov et al. 1981). The modified IGLC pattern in K02-1 may be due to intraspecific polymorphism (RFLP) for the EcoR I sites of this gene in mink. Table 1 presents the segregation data for the IGLC fragments and mink chromosomes in the clone panel. The presence of the IGLC fragments shows concordance with the presence of mink Chr 4. Thus, the resuits obtained allowed us to assign the gene encoding the structure of IGLC on mink Chr 4. Mink Chr 4 carries the genes for isocitrate dehydrogenase-1 (IDH1) and peptidase A (PEPA; Serov et al. 1987). The human counterparts of the IDH1, PEPA and IGLC genes lie on chrs 2, 18, and 22, respectively (Creagan et al. 1973, 1974; Hamerton et al. 1975; Erikson et al. 1981), and those of mouse lie on Chrs 1, 16, and 18, respectively (Hutton and Roderick 1970; Franke et al. 1977; D'Eustachio et al. 1981). Thus, three genes that are all on mink Chr 4 reside on three different chromosomes in human and mouse. According to comparative mapping data (Nadeau 1989), however, the IDH1 gene is a member of a syntenic group occurring in the proximal part of mouse Chr 1. This 20 cM long region is marked by the genes acetylcholin receptor (Acrg) and alkaline phosphatase (Akp-3). The syntenic group of homologous genes in human is on the long arm of Chr 2 (Nadeau et al. 1989). Comparative analysis of G-banded chromosomes (Graphodatsky and Biltueva 1987) revealed that a major por-
I hydrolysates from mink, Chinese Fig. 2. Hybridization of E c o R hamster and some mink-Chinese hamster hybrid cells to a fragment of cloned mink cDNA IGL containing the C-region only. Lanes: 1 and 3, clones K 0 2 - 1 and R 0 1 - 1 , respectively, positive for the mink IGLC gene; 2 and 4, clones D 1 3 M and D 3 M , respectively, negative for the mink I G L C gene; 5, mink MV cells; and 6, Chinese hamster V79 cells. Fragment sizes are given in kb.
mink IGL gene are illustrated in Fig. 2. Hybridization to Chinese hamster DNA is not apparent (Fig. 2). In contrast, mink IGL C-region DNA hybridizes to genomic mink DNA, revealing at least four fragments of different sizes (19.0, 16.0, 5.5 and 4.6 kb). The hybrid clones containing DNA which hybridized to this probe were K02-1, L22-1, LI5-1, F12B-1, RO.I, and D12M. All the members of the set of restriction fragments, which we have described for the mink MV cells, were present in F12B-1. In the others, only three mink fragments appeared consistently together; their sizes were 19.0, 5.5 and 4.6 kb, that is, the 16 kb fragment was missing. However, the 2.3 kb was consistently present
Table 1. Segregation of the
sequence and mink chromosomes in mink-Chinese hamster cell hybrids.
IGLC
Mink Chr b Clone
Mink
1
2
3
4
5
6
7
8
9
10
11
12
13
14
K02-1
+
+
-
+
+
-
+
-
-
+
+
-
+
+
+
L22-1
+
+
-
-
+
+
+
-
-
+
-
-
+
+
-
+
F12B-1
+
-
+
+
+
+
-
-
+
+
+
-
+
-
+
+
L15-1
+
-
-
-
+
-
-
-
+
-
+
+
-
+
+
+
D7B-1
+
-
-
+
+
+
-
-
+
+
+
+
+
-
-
+
ROI-1
+
+
+
+
+
-
+
-
-
+
+
+
-
+
+
+
DI2M
+
-
+
+
+
+
-
-
+
+
+
-
+
-
+
+
F3M
-
+
-
+
-
+
+
+
-
+
-
-
-
+
+
+
K12-1
-
+
-
+
-
+
+
+
-
-
+
+
+
-
+
+
+
-
IGLC
a
L25-1
.
.
.
.
.
DllB-1
.
.
.
.
.
+
.
.
.
.
.
-
-
+
+
-
+
.
+
+
-
+
+
+
-
-
-
+
-
+
-
+
.
D3M
-
+
-
+
-
-
-
+
-
-
+
D13M
-
+
-
+
-
-
+
-
+
+
.
53
33
33
26
26
.
.
-
FD9M
.
+
+ +
R14-1
Discordancy (%)
+
. .
.
sequence present: yes (+)/no ( - ) . " Mink I G L C b Mink Chr present: yes (+)/no ( - ) .
0
33
60
73
33
.
.
.
.
40
+
-
+
+
+
+
+
+
+
-
+
-
-
+
+
+
46
53
.
.
46
X
40
T.M. Khlebodarova et al.: Mink gene for X light chain
tion of the long arm of mouse Chr 1 is homologous in G-banding to the distal part of the long arm of human chr 2 and the long arm of mink Chr 4. A stipulation should be made that the homology may be incomplete because, as judged by the more recent comparative data (Nadeau et al. 1989), the region in question may be smaller than previously thought (Graphodatsky and Biltueva 1987). However, it would appear that the IDH1 gene is located on the long arm of mink Chr 4, while the PEPA and IGLC genes lie outside the region. It remains to determined whether or not the assumption made here is correct. The answer will expand our knowledge of the evolution of mammalian chromosomes. Acknowledgments. The authors are indebted to A. Fadeeva for translation of this paper from Russian into English.
References Auffray, C. and Rougeon, F.: Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor. Eur J Biochem 107: 303-312, 1980. Aviv, H. and Leder, P.: Purification of biologically active globulin messenger RNA by chromatography on oligothymidylic acid cellulose. Proc Natl Acad Sci USA 69: 1418-1428, 1972. Bernard, O., Hozumi, N., and Tonegawa, S.: Sequences of mouse immunoglobulin light chain genes before and after somatic changes. Cell 15:1133-1136, 1978. Creagan, R., Tischfield, J., McMorris, F.A., Chen, S., Hirschi, M., Chen, T.R., Riccinti, F., and Ruddle, F.H.: Assignment of the genes for human peptidase A to chromosome 18 and cytoplasmic glutamic oxaloacetate transaminase to chromosome 10 using somatic cell hybrids. Cytogenet Cell Genet 12: 187-198, 1973. Creagan, R.P., Carritt, B., Chen, S., Kucherlapati, R., McMorris, F.A., Riccinti, F., Tan, Y.H., Tischfield, J.A., and Ruddle, F.H.: Chromosome assignments of genes in man using mouse-human somatic cell hybrids: Cytoplasmic isocitrate dehydrogenase (IDH1) and malate dehydrogenase (MDH1) to chromosome 2. Am J Hum Genet 26: 604-613, 1974. Croce, C.M., Shander, M., Martinis, J., Cicurel, L., D'Amona, G.G., Dolby, T.W., and Koprowski, H.: Chromosomal location of the genes for human immunoglobulin heavy chains. Proc Natl Acad Sci USA 76: 3416-3419, 1979. D'Eustachio, P., Bothwell, A., Takaro, T., Baltimore, D., and Ruddie, F.H.: Chromosomal locations of structural genes encoding murine immunoglobulin h light chains. J Exp Med 153: 793-800, 1981. Erikson, J., Martinis, J., and Croce, C.M.: Assignment of the genes for human X immunoglobulin chains to chromosome 22. Nature 294: 173-175, 1981. Francke, U., Lalley, P.A., Moss, W., Ivy, J., and Minna, J.D.: Gene mapping in Mus muscutus by interspecific cell hybridization: Assignment of the genes for tripeptidase-1 to chromosome 10, dipeptidase-2 to chromosome 18, acid phosphatase-1 to chromosome 12 and adenylate kinase-1 to chromosome 2. Cytogenet Cell Genet 19: 57-84, 1977. Graphodatsky, A.S. and Biltueva, L.S.: G-banding homeology of mammalian chromosomes. Genetika (Russia) 23: 93-102, 1987. Hamerton, J.L., Mohandas, T., McAlpine, P.J., and Douglas, G.: Localization of human gene loci using spontaneous chromosome rearrangements in human-Chinese hamster somatic cell hybrids. A m J Hum Genet 27: 595-608, 1975. Hayzer, D.J., Duvoisin, R.M., and Jaton, J.-C.: cDNA clones en-
99 coding rabbit immunoglobulin chains. Biochem J 245: 693--699, 1987. Henikoff, S.: Undirectional digestion with exonuclease III created targeted breakpoints for DNA sequencing. Gene 28: 351-359, 1984. Hengartner, M., Met, T., and Mfiller, E.: Assignment of genes for immunoglobulin K and heavy chains to chromosome 6 and 12 in the mouse. Proc Natl Acad Sci USA 75: 4494-4498, 1978. Hieter, P.A., Hollis, G.F., Korsmeyer, S.J., Waldmann, T.A., and Leder, P.: Clustered arrangement of immunoglobulin constant region genes in man. Nature 294: 536--538, 1981. Hodson, C.P. and Fisk, R.Z.: Hybridization probe size control: Optomized "oligolabelling." Nuct Acids Res 15: 6295--6306, 1987. Hutton, J.J. and Roderick, T.H.: Linkage analyses using biochemical variants in mice. III. Linkage relationships of eleven biochemical markers. Biochem Genet 4: 339-350, 1970. Kabat, E.A., Wu, T.T., Bilofsky, H., Reid-Miller, M., and Perry, H.: Sequences of proteins of immunological interest. U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, MD, 1983. Khlebodarova, T.M., Karasik, G.I., Lapteva, S.E., Matveeva, N.M., Serov, O.L., Sverdlov, E.D., Broude, N.E., Modyanov, N.N., and Monastyrskaya, G.S.: Chromosomal localization of the gene coding for the 13-subunit of Na + , K+-ATPase in the American mink (Mustela vison). FEBS Lett 236: 240-242, 1988. Malcolm, S., Barton, P., Murphy, C., Ferguson-Smith, M.A., Bentley, D.L., and Rabbitts, T.H.: Localization of human Klight chain variable region genes to the short arm of chromosome 2 by in situ hybridization. Proc Natl Acad Sci USA 79: 4957-4961, 1982. Maniatis, T., Fritsch, E.F., and Sambrook, J.: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1982. Matveeva, N.M., Khlebodarova, T.M., Karasik, G.I., Rubtsov, N.B., Serov, O.L., Sverdlov, E.D., Broude, N.E., Modyanov, N.N., Monastyrskaya, G.S., and Ovchinnikov, Y.A.: Chromosomal localization of the gene coding for a-subunit of Na + , K +ATPase in the American mink (Mustela vison). FEBS Lett 217: 42-44, 1987. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with base specific chemical cleavages. In L. Grossman and K. Moldave (eds.); Methods in Enzymology, Vol. 65, pp. 499-560, Academic Press, New York, 1980. Nadeau, J.H.: Maps of linkage and syntenic homologies between mouse and man. Trends Genet 5: 82-86, 1989. Nadeau, J.H., Eppig, J.T., and Reiner, A.H.: Linkage and synteny homologies between mouse and man. The Jackson Laboratory, Bar Harbor, ME, 1989. Reed, K.C. and Mann, D.A.: Rapid transfer of DNA from agarose gels to nylon membranes. Nucl Acids Res 13: 7207-7221, 1985. Rubtsov, N.B., Radjabli, S.I., Gradov, A.A., and Serov, O.L.: Chinese hamster • American mink somatic cell hybrids: Characterization of a clone panel and assignment of the mink genes for malate dehydrogenase, NADP-I, and malate dehydrogenase, NAD-1. Theor Appl Genet 60: 99-106, 1981. Serov, O.L., Gradov, A.A., Rubtsov, N.B., Zhdanova, M.S., Pack, S.D., Sukoyan, M.A., Mullakandov, M.R., and Zakijan, S.M.: Genetic map of the American mink: Gene conservation and organization of chromosomes. In M.C. Rattazzi, J.G. Scandalios, G.S. Whitt and C.L. Markert (eds.); Isozymes: Current Topics in Biological and Medical Research, Vol. 15, pp. 179--215, A.R. Liss, New York, 1987. Sukoyan, M.A., Matveeva, N.M., Belyaev, N.D., Pack, S.D., Gradov, A.A., Shilov, A.G., Zhdanova, N.S., and Serov, O.L.: Cotransfer and phenotypic stabilisation of syntenic and asyntenic mink genes into mouse cells by chromosome-mediated gene transfer. Mof Gen Genet 196: 97-104, 1984. Tonegawa, S.: Somatic generation of antibody diversity. Nature 302: 575-581, 1983. Young, R.A. and Davis, R.W.: Yeast RNA polymerase II genes: Isolation with antibody probes. Science 222: 778-782, 1983.
enome 9 Springer-VerlagNew York Inc. 1992
The mink gene for the h light immunoglobulin chain: Characterization of cDNA and chromosomal localization T.M. Khlebodarova, N.M. Matveeva, O.L. Serov, A.M. Najakshin, E.S. Belousov, S.V. Bogachev, and O.K. Baranov Institute of Cytology and Genetics, Academy of Sciences of the USSR, Siberian Department, Novosibirsk-90, USSR Received January 25, 1991; accepted June 20, 1991
Abstract. A cDNA library from mink spleen was constructed by use of the phage hgtll. The library was screened using polyvalent serum raised against the mink immunoglobulin k chain. As a result, several clones expressing mink immunoglobulin h light chains were identified. Sequencing of one of the clones with an 803 bp insert was performed. The insert comprised nearly the entire coding region for the mature k light immunoglobulin gene with the exception of the leader polypeptide and several amino acids of the FR1 region of the V segment. Compared with the rabbit, mouse and human h light immunoglobulin genes, the homology of the cloned sequence was found to be highest relative to the rabbit gene. With the cloned mink cDNA containing the C-region only as a probe, the DNAs from mink-Chinese hamster hybrid clones were studied. The results of segregation analysis of this mink cDNA sequence and mink chromosomes in the mink-Chinese hamster clone panel allowed us to assign the gene for the k light immunoglobulin constant polypeptide (IGLC) to mink Chromosome (Chr) 4.
Introduction Immunoglobulin molecules consist of four polypeptide chains: two identical heavy and two identical light chains. The mature genes coding for the immunoglobulin chains are formed during the differentiation of B lymphocytes as a result of rearrangement of germ line DNA. The light chains are composed of three (V/~, JL, CL) regions and the heavy of four regions (VH, D, JH, CH; Tonegawa 1983). There are five classes of heavy chains (Ix, g, % oL, ~) and two of light chains (K and h). The nucleotide sequence data reported in this paper have been submitted to the EMBL Data Library and have been assigned the accession number X56270 mink mRNA for X. Offprint requests to: O.L. Serov
Chromosome assignments have been made for the immunoglobulin genes of several mammals, including human and mouse. In human and mouse, the heavychain genes are, respectively, on Chrs 14 and 12, the K-chain genes on Chrs 2 and 6, and the k-chain genes are on Chrs 22 and 16 (Croce et al. 1979; Erikson et al. 1981; Malcolm et al. 1982; Hehgartner et al. 1978; D'Eustachio et al. 1981). Thus, the gene families for the heavy chains, K-chains, and h-chains, reside on different linkage groups. In this paper we describe the cloning and sequencing of a cDNA for the mink h light immunoglobulin chain and the chromosome localization of the mink h light immunoglobulin constant gene (IGLC). Materials and methods The spleen from a mink was used as the source of total RNA extracted by the urea-LiCl procedure of Auffray and Rougeon (1980). The poly(A+)-mRNA was purified by two passages through an oligo(dT~z,ts)-cellulose column (Aviv and Leder 1972). Doublestranded cDNA prepared by the method of Maniatis and others (1982) was inserted into the EcoR I site of the phage kgtl 1. A cDNA library (200,000 recombinants) was constructed and screened for the k light immunoglobulin sequence as described by Young and Davis (1983). Several clones giving strong signals with polyvalent serum raised against the mink k light immunoglobulin chains were isolated. To facilitate further analysis of the primary structure, MGL-2, one of the recombinant phages containing a 803 bp insert was recloned into the plasmid pUC19 (plGL-2 clone) and sequenced according to Maxam and Gilbert (1980). The plasmid plGL-21 was constructed from plGL-2. A D N A fragment containing the V J-region was deleted by exonuclease III and Sl-nuclease as described (Henikoff 1984). The plasmid plGL-21 containing the C-region of the mink IGL gene only was used as a probe for the determination of chromosome localization of the mink IGLC gene. To map the mink IGLC gene, we used a set of mink-Chinese hamster cell hybrids. The creation of a panel of mink-Chinese hamster cell hybrids and their karyotype characterization was described in previous papers (Serov et al. 1987; Matveeva et al. 1987). Conditions for cultivation of mink and Chinese hamster cells, as well as mink-Chinese hamster hYbrid clones, were as reported elsewhere (Rubtsov et al. 1981; Sukoyan et al. 1984).
T.M. Khlebodarova et al.: Mink gene for X light chain
97
Extraction of DNA from the cell hybrids and parental cell lines, the conditions for digestion with restriction endonuclease EcoR I have been described (Matveeva et al. 1987). DNA was transferred to g-probe blotting membrane in 0.4 M NaOH (Reed and Mann 1985). Prehybridization, hybridization and washing of the nylon filters after hybridization were all carried out at 65~ as previously described (Khlebodarova et al. 1988). To obtain the 400 bp C-region of the mink k light immunoglobulin gene, the plasmid pIGL-21 was digested with restriction endonuclease Pst I, subjected to electrophoresis in 0.8% agarose gel and electroelution. The DNA fragment was labeled with n p to a specific activity of 1 - 2 x 109 cproJlxg by the random-priming technique (Hodson and Fisk 1987). The probe was hybridized with fixed DNA on nylon filters at a concentration of 10 ng/ml.
Results and discussion
Screening of the cDNA library allowed us to identify seven clones. Of these, four gave no hybridization signals in the immunoblottings, and they were, consequently, illegitimate. Of the remaining clones, one had an insertion of 300 bp (plGL-I), and two clones had an insertion 803 bp in length (plGL-2 and plGL-7). It should be noted that the restriction maps of the clones were identical. Sequencing of the clone containing the 300 bp insert revealed that it had a polyA tract and a 3' untranslated sequence. For these reasons the plGL-1 clone was not analyzed later. The sequence of one clone with the 803 bp insert (plGL-2) is depicted in Fig. 1. The sequence has an open reading frame 636 bp long and a polyadenylation
site 65 bp far from the stop codon. Comparisons with the previously cloned rat, mouse, and human genes (Bernard et al. 1978; Hieter et al. 1981; Hayzer et al. 1987) revealed that this sequence codes for the k-light immunoglobulin chain and contains nearly the entire V-region, J-region, C-region, and the 3' untranslated region. When the sequence of the clone was aligned with the gene sequences, the rabbit k-gene was found to have the highest homology with the mink h-gene. The levels of homology in the coding sequences were as follows: the C segment, 79%; the J segment, 94%; and the FR3 region of the V segment, 63%. The homology levels for the other regions of the V segment and the 3' untranslated region did not exceed 40%. As compared with sequence of the rabbit immunogtobulin chain, the homology levels for the deduced sequence from clone pIGL-2 were 40% for the V, 68% for the C, and 100% for the J segment. A sequence containing the C-region and 3'untranslated region is designated in Fig. 1. The sequence was used as a probe for the chromosome localization of the mink IGLC gene. Under the hybridization conditions used, it did not cross react with Chinese hamster DNA, thus simplifying gene localization. The results for the hybridization of the EcoR I digests of the DNAs from mink (cell line MV), Chinese hamster (cell line V79) and some mink-Chinese hamster hybrid clones with the fragment of cDNA from
TC&TACT CTCAGCCCCCA TT&TG CA&TG6CTC G
................
CAGACAGCCCGAGTCACCTGTGGGGGCJ~kC;kACATTGGA~T~3%-ATGTTCACT GGTAC
20 40
II
CDRI
C GCAGhGCeG&Gec &cTce iTACTG TC TC AT& / C C CC CCeTC J FR2
J [ ~
60
CDR2
&~ATTCCT~AGC~ATTTTeAGGeAec~eTeTGsS~eATG&TTACeCTGAeTATCAGT 80 [
FR3
i00 GG~GeeCGGGCTGAG&ATGAGGCTGACTaT~AeT~TC~GT~T~SG~T~ceASTTCr~T ][ CDR3
A & G TC&GC&G & CCCA C &CC%TCC & TC CCOC C&TCC C CC C120 9
I
J
II
&GC.C&C CCCGCCCCCCT&AGGCC&C&CC,GC-b-&CC-CCC & C140 . G G.C A G.A C G G C A iG C. T C A. T C A. G T .G A T.T T C. T A C. C C C. A G C. G G .C G T.G A C. G G T. G G C. C T G. G A A C-region
&cc
160
Tc cc AG GC TG;Ac cciccL G cc ceL AG;GcL cL cL G Ac;cG;cc 180 GC GC AC TG GC TG CA&T ACL G G& CT&C GC GC TC GC GC G GTCACACACGAGGGC~uMAACCGTGGAGAAG/%-AGGTGGTCCCCTCACAGTGCTCT~GTC 3 CCTGAGACTTCCAGGGATGGGGGCCTTCCTCTCCCAGATACCCCTTTGCCAGCTCACCAT 3'- u n t r a n s l a t e d region
GCCCCCCTGAGTCCCCACCCAGGTTCTGCTCAGAGCAGGCAGGTCACAATGCCATCCCTG TTTATTATTTGCT~ATCTCATCATTTATCATCTG
200 218
Fig. 1. A nucleotide sequence of a cDNA for the mink k light immunoglobulin polypeptide. The positions of FRs, CDRs, the J-region, the C-region and 3'-untrans!ated regions are indicated. The codon position is numbered according to that reported in Kabat and co-workers (1983). The TAG termination codon and polyadenylation site are boxed. Arrow designates the sequence of the plGL-21 clone,
98
T.M. Khlebodarova et al.: Mink gene for h light chain
in all the positive hybrid clones (Fig. 2). In our previous study of mink-mouse hybridoma cells, we have observed that this concomitant appearance of EcoR I digests is a feature of clones secreting mink h light immunoglobulin chains (unpublished data). This pattern of EcoR I fragments may possibly be a reflection of the structure of the mature IGL gene. Clone K02-1 was exceptional. It did not contain the major mink IGL fragment 19 kb long, yet it contained a 17 kb fragment (Fig. 2). A point to be considered is that bone marrow cells and leukocytes from several animals were used to prepare the mink-Chinese h a m s t e r cell hybrids (Rubtsov et al. 1981). The modified IGLC pattern in K02-1 may be due to intraspecific polymorphism (RFLP) for the EcoR I sites of this gene in mink. Table 1 presents the segregation data for the IGLC fragments and mink chromosomes in the clone panel. The presence of the IGLC fragments shows concordance with the presence of mink Chr 4. Thus, the resuits obtained allowed us to assign the gene encoding the structure of IGLC on mink Chr 4. Mink Chr 4 carries the genes for isocitrate dehydrogenase-1 (IDH1) and peptidase A (PEPA; Serov et al. 1987). The human counterparts of the IDH1, PEPA and IGLC genes lie on chrs 2, 18, and 22, respectively (Creagan et al. 1973, 1974; Hamerton et al. 1975; Erikson et al. 1981), and those of mouse lie on Chrs 1, 16, and 18, respectively (Hutton and Roderick 1970; Franke et al. 1977; D'Eustachio et al. 1981). Thus, three genes that are all on mink Chr 4 reside on three different chromosomes in human and mouse. According to comparative mapping data (Nadeau 1989), however, the IDH1 gene is a member of a syntenic group occurring in the proximal part of mouse Chr 1. This 20 cM long region is marked by the genes acetylcholin receptor (Acrg) and alkaline phosphatase (Akp-3). The syntenic group of homologous genes in human is on the long arm of Chr 2 (Nadeau et al. 1989). Comparative analysis of G-banded chromosomes (Graphodatsky and Biltueva 1987) revealed that a major por-
I hydrolysates from mink, Chinese Fig. 2. Hybridization of E c o R hamster and some mink-Chinese hamster hybrid cells to a fragment of cloned mink cDNA IGL containing the C-region only. Lanes: 1 and 3, clones K 0 2 - 1 and R 0 1 - 1 , respectively, positive for the mink IGLC gene; 2 and 4, clones D 1 3 M and D 3 M , respectively, negative for the mink I G L C gene; 5, mink MV cells; and 6, Chinese hamster V79 cells. Fragment sizes are given in kb.
mink IGL gene are illustrated in Fig. 2. Hybridization to Chinese hamster DNA is not apparent (Fig. 2). In contrast, mink IGL C-region DNA hybridizes to genomic mink DNA, revealing at least four fragments of different sizes (19.0, 16.0, 5.5 and 4.6 kb). The hybrid clones containing DNA which hybridized to this probe were K02-1, L22-1, LI5-1, F12B-1, RO.I, and D12M. All the members of the set of restriction fragments, which we have described for the mink MV cells, were present in F12B-1. In the others, only three mink fragments appeared consistently together; their sizes were 19.0, 5.5 and 4.6 kb, that is, the 16 kb fragment was missing. However, the 2.3 kb was consistently present
Table 1. Segregation of the
sequence and mink chromosomes in mink-Chinese hamster cell hybrids.
IGLC
Mink Chr b Clone
Mink
1
2
3
4
5
6
7
8
9
10
11
12
13
14
K02-1
+
+
-
+
+
-
+
-
-
+
+
-
+
+
+
L22-1
+
+
-
-
+
+
+
-
-
+
-
-
+
+
-
+
F12B-1
+
-
+
+
+
+
-
-
+
+
+
-
+
-
+
+
L15-1
+
-
-
-
+
-
-
-
+
-
+
+
-
+
+
+
D7B-1
+
-
-
+
+
+
-
-
+
+
+
+
+
-
-
+
ROI-1
+
+
+
+
+
-
+
-
-
+
+
+
-
+
+
+
DI2M
+
-
+
+
+
+
-
-
+
+
+
-
+
-
+
+
F3M
-
+
-
+
-
+
+
+
-
+
-
-
-
+
+
+
K12-1
-
+
-
+
-
+
+
+
-
-
+
+
+
-
+
+
+
-
IGLC
a
L25-1
.
.
.
.
.
DllB-1
.
.
.
.
.
+
.
.
.
.
.
-
-
+
+
-
+
.
+
+
-
+
+
+
-
-
-
+
-
+
-
+
.
D3M
-
+
-
+
-
-
-
+
-
-
+
D13M
-
+
-
+
-
-
+
-
+
+
.
53
33
33
26
26
.
.
-
FD9M
.
+
+ +
R14-1
Discordancy (%)
+
. .
.
sequence present: yes (+)/no ( - ) . " Mink I G L C b Mink Chr present: yes (+)/no ( - ) .
0
33
60
73
33
.
.
.
.
40
+
-
+
+
+
+
+
+
+
-
+
-
-
+
+
+
46
53
.
.
46
X
40
T.M. Khlebodarova et al.: Mink gene for X light chain
tion of the long arm of mouse Chr 1 is homologous in G-banding to the distal part of the long arm of human chr 2 and the long arm of mink Chr 4. A stipulation should be made that the homology may be incomplete because, as judged by the more recent comparative data (Nadeau et al. 1989), the region in question may be smaller than previously thought (Graphodatsky and Biltueva 1987). However, it would appear that the IDH1 gene is located on the long arm of mink Chr 4, while the PEPA and IGLC genes lie outside the region. It remains to determined whether or not the assumption made here is correct. The answer will expand our knowledge of the evolution of mammalian chromosomes. Acknowledgments. The authors are indebted to A. Fadeeva for translation of this paper from Russian into English.
References Auffray, C. and Rougeon, F.: Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor. Eur J Biochem 107: 303-312, 1980. Aviv, H. and Leder, P.: Purification of biologically active globulin messenger RNA by chromatography on oligothymidylic acid cellulose. Proc Natl Acad Sci USA 69: 1418-1428, 1972. Bernard, O., Hozumi, N., and Tonegawa, S.: Sequences of mouse immunoglobulin light chain genes before and after somatic changes. Cell 15:1133-1136, 1978. Creagan, R., Tischfield, J., McMorris, F.A., Chen, S., Hirschi, M., Chen, T.R., Riccinti, F., and Ruddle, F.H.: Assignment of the genes for human peptidase A to chromosome 18 and cytoplasmic glutamic oxaloacetate transaminase to chromosome 10 using somatic cell hybrids. Cytogenet Cell Genet 12: 187-198, 1973. Creagan, R.P., Carritt, B., Chen, S., Kucherlapati, R., McMorris, F.A., Riccinti, F., Tan, Y.H., Tischfield, J.A., and Ruddle, F.H.: Chromosome assignments of genes in man using mouse-human somatic cell hybrids: Cytoplasmic isocitrate dehydrogenase (IDH1) and malate dehydrogenase (MDH1) to chromosome 2. Am J Hum Genet 26: 604-613, 1974. Croce, C.M., Shander, M., Martinis, J., Cicurel, L., D'Amona, G.G., Dolby, T.W., and Koprowski, H.: Chromosomal location of the genes for human immunoglobulin heavy chains. Proc Natl Acad Sci USA 76: 3416-3419, 1979. D'Eustachio, P., Bothwell, A., Takaro, T., Baltimore, D., and Ruddie, F.H.: Chromosomal locations of structural genes encoding murine immunoglobulin h light chains. J Exp Med 153: 793-800, 1981. Erikson, J., Martinis, J., and Croce, C.M.: Assignment of the genes for human X immunoglobulin chains to chromosome 22. Nature 294: 173-175, 1981. Francke, U., Lalley, P.A., Moss, W., Ivy, J., and Minna, J.D.: Gene mapping in Mus muscutus by interspecific cell hybridization: Assignment of the genes for tripeptidase-1 to chromosome 10, dipeptidase-2 to chromosome 18, acid phosphatase-1 to chromosome 12 and adenylate kinase-1 to chromosome 2. Cytogenet Cell Genet 19: 57-84, 1977. Graphodatsky, A.S. and Biltueva, L.S.: G-banding homeology of mammalian chromosomes. Genetika (Russia) 23: 93-102, 1987. Hamerton, J.L., Mohandas, T., McAlpine, P.J., and Douglas, G.: Localization of human gene loci using spontaneous chromosome rearrangements in human-Chinese hamster somatic cell hybrids. A m J Hum Genet 27: 595-608, 1975. Hayzer, D.J., Duvoisin, R.M., and Jaton, J.-C.: cDNA clones en-
99 coding rabbit immunoglobulin chains. Biochem J 245: 693--699, 1987. Henikoff, S.: Undirectional digestion with exonuclease III created targeted breakpoints for DNA sequencing. Gene 28: 351-359, 1984. Hengartner, M., Met, T., and Mfiller, E.: Assignment of genes for immunoglobulin K and heavy chains to chromosome 6 and 12 in the mouse. Proc Natl Acad Sci USA 75: 4494-4498, 1978. Hieter, P.A., Hollis, G.F., Korsmeyer, S.J., Waldmann, T.A., and Leder, P.: Clustered arrangement of immunoglobulin constant region genes in man. Nature 294: 536--538, 1981. Hodson, C.P. and Fisk, R.Z.: Hybridization probe size control: Optomized "oligolabelling." Nuct Acids Res 15: 6295--6306, 1987. Hutton, J.J. and Roderick, T.H.: Linkage analyses using biochemical variants in mice. III. Linkage relationships of eleven biochemical markers. Biochem Genet 4: 339-350, 1970. Kabat, E.A., Wu, T.T., Bilofsky, H., Reid-Miller, M., and Perry, H.: Sequences of proteins of immunological interest. U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, MD, 1983. Khlebodarova, T.M., Karasik, G.I., Lapteva, S.E., Matveeva, N.M., Serov, O.L., Sverdlov, E.D., Broude, N.E., Modyanov, N.N., and Monastyrskaya, G.S.: Chromosomal localization of the gene coding for the 13-subunit of Na + , K+-ATPase in the American mink (Mustela vison). FEBS Lett 236: 240-242, 1988. Malcolm, S., Barton, P., Murphy, C., Ferguson-Smith, M.A., Bentley, D.L., and Rabbitts, T.H.: Localization of human Klight chain variable region genes to the short arm of chromosome 2 by in situ hybridization. Proc Natl Acad Sci USA 79: 4957-4961, 1982. Maniatis, T., Fritsch, E.F., and Sambrook, J.: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1982. Matveeva, N.M., Khlebodarova, T.M., Karasik, G.I., Rubtsov, N.B., Serov, O.L., Sverdlov, E.D., Broude, N.E., Modyanov, N.N., Monastyrskaya, G.S., and Ovchinnikov, Y.A.: Chromosomal localization of the gene coding for a-subunit of Na + , K +ATPase in the American mink (Mustela vison). FEBS Lett 217: 42-44, 1987. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with base specific chemical cleavages. In L. Grossman and K. Moldave (eds.); Methods in Enzymology, Vol. 65, pp. 499-560, Academic Press, New York, 1980. Nadeau, J.H.: Maps of linkage and syntenic homologies between mouse and man. Trends Genet 5: 82-86, 1989. Nadeau, J.H., Eppig, J.T., and Reiner, A.H.: Linkage and synteny homologies between mouse and man. The Jackson Laboratory, Bar Harbor, ME, 1989. Reed, K.C. and Mann, D.A.: Rapid transfer of DNA from agarose gels to nylon membranes. Nucl Acids Res 13: 7207-7221, 1985. Rubtsov, N.B., Radjabli, S.I., Gradov, A.A., and Serov, O.L.: Chinese hamster • American mink somatic cell hybrids: Characterization of a clone panel and assignment of the mink genes for malate dehydrogenase, NADP-I, and malate dehydrogenase, NAD-1. Theor Appl Genet 60: 99-106, 1981. Serov, O.L., Gradov, A.A., Rubtsov, N.B., Zhdanova, M.S., Pack, S.D., Sukoyan, M.A., Mullakandov, M.R., and Zakijan, S.M.: Genetic map of the American mink: Gene conservation and organization of chromosomes. In M.C. Rattazzi, J.G. Scandalios, G.S. Whitt and C.L. Markert (eds.); Isozymes: Current Topics in Biological and Medical Research, Vol. 15, pp. 179--215, A.R. Liss, New York, 1987. Sukoyan, M.A., Matveeva, N.M., Belyaev, N.D., Pack, S.D., Gradov, A.A., Shilov, A.G., Zhdanova, N.S., and Serov, O.L.: Cotransfer and phenotypic stabilisation of syntenic and asyntenic mink genes into mouse cells by chromosome-mediated gene transfer. Mof Gen Genet 196: 97-104, 1984. Tonegawa, S.: Somatic generation of antibody diversity. Nature 302: 575-581, 1983. Young, R.A. and Davis, R.W.: Yeast RNA polymerase II genes: Isolation with antibody probes. Science 222: 778-782, 1983.
