Neurochem Res DOI 10.1007/s11064-014-1257-7
ORIGINAL PAPER
The Involvement of CXCL11 in Bone Marrow-Derived Mesenchymal Stem Cell Migration Through Human Brain Microvascular Endothelial Cells Yu Feng • Hong-Mei Yu • De-Shu Shang • Wen-Gang Fang • Zhi-Yi He • Yu-Hua Chen
Received: 29 August 2013 / Revised: 4 February 2014 / Accepted: 7 February 2014 Ó Springer Science+Business Media New York 2014
Abstract Bone marrow-derived mesenchymal stem cells (MSCs) transplant into the brain, where they play a potential therapeutic role in neurological diseases. However, the blood–brain barrier (BBB) is a native obstacle for MSCs entry into the brain. Little is known about the mechanism behind MSCs migration across the BBB. In the present study, we modeled the interactions between human MSCs (hMSCs) and human brain microvascular endothelial cells (HBMECs) to mimic the BBB microenvironment. Real-time PCR analysis indicated that the chemokine CXCL11 is produced by hMSCs and the chemokine receptor CXCR3 is expressed on HBMECs. Further results indicate that CXCL11 secreted by hMSCs may interact with CXCR3 on HBMECs to induce the disassembly of tight junctions through the activation of ERK1/2 signaling in the endothelium, which promotes MSCs transendothelial migration. These findings are relevant for understanding the biological responses of MSCs in BBB environments and helpful for the application of MSCs in neurological diseases. Keywords Bone marrow-derived mesenchymal stem cell Chemokine CXCL11 CXCR3 Brain microvascular endothelial cell Tight junction Blood–brain barrier
Y. Feng H.-M. Yu Z.-Y. He Department of Neurology, The First Hospital of China Medical University, 155 Nan Jing Northern Street, Shenyang 110001, Liaoning, China Y. Feng D.-S. Shang W.-G. Fang Y.-H. Chen (&) Department of Developmental Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, 92 Bei Er Road, Shenyang 110001, Liaoning, China e-mail: [email protected]
Introduction Mesenchymal stem cells (MSCs) have become a therapeutic option for several pathologies, such as myocardial infarction and wound repair [1, 2]. Similar to immune cells, MSCs can extravasate from the blood vessels into ischemic, apoptotic and inflammatory tissues, where the cells survive and promote tissue regeneration [3–5]. Several studies indicate that MSCs are a potential candidate to treat neurological diseases [6–8]. Therefore, a better understanding of the mechanisms behind MSCs migration into the brain is important to improve therapies for neurological diseases. The blood–brain barrier (BBB) is a specific vascular system that separates the blood from the brain and maintains a highly stable brain microenvironment. The BBB consists of a network of closely adjoining endothelial cells in the brain’s capillaries that are characterized by the presence of continuous tight junctions (TJ) [9, 10]. Therefore, the BBB is a native obstacle for MSCs entry into the brain. As has been previously discussed, MSCs have the ability to migrate into tissues from circulation, possibly in response to signals that are upregulated under injury conditions. It is probable that chemokines and their receptors are involved, as they are important factors known to control cell migration [11–13]. CXCL11 is a member of a family of small proteins, the chemokines (or chemoattractant cytokines). This chemokine plays a key role in immune and inflammatory responses by promoting the recruitment and activation of different subpopulations of leukocytes. A previous study reported that IL1b increased the production of CXCL11 to promote MSCs migration [14]. Chemotaxis assays indicated that CXCL11 in human serum has significant chemotactic effects on human MSCs [15]. Therefore, we wanted to
123
Neurochem Res
determine whether CXCL11 was involved in MSCs transendothelial migration. In the present paper, we found that CXCL11 secreted by MSCs may interact with CXCR3 (chemokine (C-X-C motif) receptor 3) on human brain microvascular endothelial cells (HBMEC) and activate downstream signaling cascades in the endothelium to open tight junctions, which promotes MSCs transendothelial migration.
analyzed using the 2(-Delta Delta C (T)) method. The primers used are listed in Table 1. ELISA
Materials and Methods
1 9 105 HBMECs were seeded on the bottom of a 24-well plate. After 24 h, 2 9 105 hMSCs were seeded on the HBMECs monolayer. After 4, 8, and 12 h in co-culture, the supernatants were collected and the levels of human CXCL11 were quantified by ELISA according to the manufacturer’s protocol (R&D Systems).
Cells and Culture Conditions
MSC Transendothelial Migration Assay
Human bone marrow MSCs (hMSCs) were prepared as previously described [16]. The bone marrow samples were used in accordance with the procedures approved by the human experimentation and ethics committees of China Medical University. Rat MSCs were prepared as described by Tropel et al. [17]. Briefly, male Wistar rats were sacrificed, and the femurs were aseptically dissected, repeatedly flushed with MSCs medium, and plated in a culture flask (Corning Costar). After 24 h, the adherent cells were cultured as passage 0. The use of animals in this study was approved by the Animal Care and Use Committee of China Medical University, and all procedures were carried out in accordance with institutional guidelines. Human brain microvascular endothelial cells [18] were cultured in completed RPMI 1640 medium containing 10 % FBS, 10 % Nu-serum (BD Biosciences), 2 mM glutamine, 1 mM sodium pyruvate, 19 non-essential amino acids and 19 MEM vitamins. For the co-culturing experiments, 1 9 105 HBMECs were seeded on the bottom of 24-well plate and grown in 5 % CO2 at 37 °C. After 24 h, the transwell inserts with pore sizes of 0.4 lm (Corning Costar Corp., Cambridge, MA) were put into the 24-well plate cultured with HBMECs, and 2 9 105 hMSCs were seeded on the upper chambers of transwell inserts. After 4, 8, and 12 h in co-culture, the hMSCs were collected and analyzed.
1 9 105 HBMECs were seeded on fibronectin-coated 24-well Transculture inserts with pore sizes of 8 lm (Corning Costar Corp., Cambridge, MA) and grown for 4 days in 5 % CO2 at 37 °C. The medium was replaced every day with fresh medium. The experiments were conducted when the transendothelial electrical resistance (TEER) was [200 ohm cm2. Prior to the assays, the HBMECs monolayers were washed once with medium without serum, and 1 9 105 MSCs in 100 ll medium was added to the upper chamber. After incubation for 8 h, the upper chambers were fixed with 3.7 % formaldehyde and washed extensively with PBS. To remove the non-migrating cells, the apical side of the upper chamber was scraped gently with cotton wool. Only the migrating MSCs were stained with hematoxylin and eosin (HE) and observed under a fluorescent microscope. The migrating cells were counted from 10 random fields of 2009 magnification. For the neutralization test, the MSCs were suspended in serum-free RPMI 1640 containing a CXCL11 neutralizing antibody and then incubated with the HBMECs.
Quantitative Real-Time PCR Total RNA was isolated using the Trizol reagent according to the manufacturer’s instructions, and the reverse transcriptase reaction was carried out with 1 lg of total RNA using the PrimeScript RT Master Mix Kit (Takara Bio, Tokyo, Japan) with random primers. Relative real-time PCR was performed using an ABI PRISM 7500HT Sequence Detection System (Applied Biosystems) using the SYBR Premix Ex Taq kit (Takara Bio, Tokyo, Japan) according to the manufacturer’s protocols. The relative expression levels of the chemokines were normalized to the expression level of GAPDH and
123
HRP Flux Measurement The HBMECs monolayer in the Transwell inserts (0.4 lm pore size, Costar, Cambridge, MA) were incubated with 100 ng/ml CXCL11 for the indicated time or with different concentrations of CXCL11 containing 0.4 mg/ml HRP for 1 h. The media from the lower chamber were then collected, and the HRP content of the samples was assayed colorimetrically as previously described. The HRP flux was expressed in nanograms passed per cm2 surface area per hour. Immunofluorescence The HBMECs monolayers grown on glass coverslips were fixed with 4 % paraformaldehyde and permeabilized with 0.1 % Triton X-100. After blocking with 5 % BSA in PBS, the cells were incubated with mouse anti-ZO-1 or rabbit
Neurochem Res Table 1 The primer sequences for CXCL11 and GAPDH for real-time PCR Target
Amplicon length, bp
Human CXCL11
120
Human GAPDH
197
50 -30 oligonucleotide sequences, forward, reverse
Nucleotide position
Genbank accession no. NM_005409
AGCAGTGAAAGTGGCAGAT
324-343
TTGGGATTTAGGCATCGT
425-443
GAAGGTGAAGGTCGGAGTC
108-126
GAAGATGGTGATGGGATTTC
314-333
NM_002046.3
anti-occludin antibodies to visualize the distribution of ZO1 and occludin. The glass slides were analyzed using immunofluorescence microscopy (Olympus, Japan). Cell Fractionation and Western Blot The cell fractionation experiments were performed as described previously (Li et al. 2006). In brief, confluent HBMECs were washed, extracted in Triton X-100 lysis buffer (25 mM HEPES, 150 mM NaCl, 4 mM EDTA, 1 % Triton X-100) and centrifuged to collect the soluble fraction. The pellets were dissolved in SDS lysis buffer (25 mM HEPES, 4 mM EDTA, 1 % SDS) to obtain the insoluble fraction. Equal portions of the soluble and insoluble fractions were analyzed by Western blot. For the Western blots, the cells were lysed in RIPA buffer (50 mM Tris–HCL, 150 mM NaCl, 1 % NP-40, 0.5 % deoxycholate, 0.1 % sodium dodecylsulfate) supplemented with the Complete/Mini protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentrations were determined using the BCA protein assay reagent kit (Pierce, Indianapolis, IN). 20 lg proteins were separated by 8 % SDS-PAGE, transferred electrophoretically to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA), and processed for immunoblotting with antioccludin (1:1,000) polyclonal antibody (Santa Cruz Biotechnology, CA), ERK (1:1,000) and phosphorylated ERK1/2 (1:1,000) polyclonal antibodies (Cell Signaling Technology, MA) for 2 h at room temperature. Membranes were washed with PBS and incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:10,000, Santa Cruz Biotechnology, CA) for 1 h at room temperature. The protein bands were visualized using AmershamTM ECL Plus Western Blotting Detection Reagents (GE Healthcare, Piscataway, NJ).
Results The Expression of CXCL11 is Increased in MSCs Co-cultured with HBMECs We first characterized the hMSCs by examining hMSC specific markers (data not shown). The levels of multiple chemokines in hMSCs from different passage numbers were then
Fig. 1 The expression of CXCL11 is increased in MSCs co-cultured with HBMECs. a The levels of CXCL11 in human MSCs at different passage numbers were measured by quantitative real-time PCR. b The levels of CXCL11 in rat MSCs at different passage numbers were measured by quantitative real-time PCR. c The levels of CXCL11 in human MSCs co-cultured with HBMECs were measured by quantitative real-time PCR. d The levels of CXCL11 in the supernatants derived from the co-culture experiments were detected by ELISA. All data are the mean ± SD from three independent experiments. *p \ 0.05
measured using quantitative real-time PCR. The results indicate that the mRNA levels of CXCL11 in the hMSCs and rat MSCs significantly increased with passage number (Fig. 1a, b). We co-cultured hMSCs with HBMECs to investigate the response of the MSCs to the BBB environment. The levels of CXCL11 were measured using quantitative real-time PCR. As shown in Fig. 1c, the expression level of CXCL11 was significantly increased in hMSCs (passage 6) that were incubated with the HBMECs. To verify this result, the levels of CXCL11 in the supernatants were measured by ELISA. The results indicate that CXCL11 expression was highly up-regulated in hMSCs that were co-cultured with the HBMECs (Fig. 1d). These data suggest that CXCL11 might be involved in the MSCs response to the BBB environment. CXCL11 is Involved in hMSC Transendothelial Migration To investigate whether CXCL11 is involved in hMSCs transendothelial migration, a transwell system was used.
123
Neurochem Res
Fig. 2 CXCL11 is involved in hMSCs transendothelial migration. a Treatment with a CXCL11 neutralizing antibody decreased hMSCs transendothelial migration. b Treatment with 100 ng/ml of recombinant human CXCL11 protein increased hMSCs transendothelial migration. All data are the mean ± SD from three independent experiments. *p \ 0.05
Fig. 4 CXCR3 in HBMECs mediates CXCL11-induced hMSCs transedothelial migration. a The levels of the chemokine receptor CXCR3 in HBMECs after incubation with the hMSCs were measured by quantitative real-time PCR. b Treatment with a CXCR3 neutralizing antibody decreased hMSCs transendothelial migration. All data are the mean ± SD from three independent experiments. *p \ 0.05
transendothelial migration. Therefore, the effect of CXCL11 on the integrity of the tight junctions between HBMECs was evaluated according to the previous work. The results indicate that CXCL11 significantly increased HRP flux in a time and dose-dependent manner (Fig. 3a, b). There was also an obvious shift in occludin distribution from the insoluble to soluble fractions prepared from HBMECs treated with recombinant human CXCL11 protein (Fig. 3c). In addition, the distribution of ZO-1, a TJ structural protein, was visualized by immunofluorescence. Treatment with CXCL11 disrupted the continuous lines at the cell–cell borders, making the ZO-1 staining discontinuous (Fig. 3d). Thus, these results indicate that CXCL11 induces the disassembly of the tight junctions between HBMECs to promote hMSCs transendothelial migration. CXCR3 in HBMECs Mediates CXCL11-Induced hMSCs Transedothelial Migration Fig. 3 The effects of CXCL11 on brain endothelial permeability. a A dose-dependent change in HRP flux was induced by CXCL11. b A time-dependent change in HRP flux was induced by CXCL11. c A shift in endothelial occludin from the insoluble to soluble phase in response to CXCL11 was detected by Western blot. d The changes in ZO-1 distribution in HBMECs treated with CXCL11 were visualized by immunofluorescence. All data are the mean ± SD from three independent experiments. *p \ 0.05
Treatment with a CXCL11 neutralizing antibody significantly decreased the migratory activity of the hMSCs (Fig. 2a). In contrast, treatment with 100 ng/ml of recombinant human CXCL11 protein significantly increased the transendothelial migration of the hMSCs (Fig. 2b). These results indicate that CXCL11 is involved in hMSCs transendothelial migration.
It well known that CXCL11 is a member of the ELR–CXC family and the ligand for the chemokine receptor CXCR3. Several studies have demonstrated a pathogenic role of CXCL11 and CXCR3 in many human inflammatory diseases. As shown in Fig. 4a, the expression of CXCR3 significantly increased in HBMECs that interacted with hMSCs. To determine whether CXCR3 expression in HBMECs is involved in the transendothelial migration of the hMSCs toward CXCL11, a CXCR3 neutralizing antibody was used to block the effects of CXCR3. The results showed that treatment with an anti-CXCR3 antibody significantly reduced hMSCs transedothelial migration (Fig. 4b).
CXCL11 Mediates hMSCs Transendothelial Migration by Affecting the Integrity of Tight Junctions Between HBMECs
The ERK1/2 Signaling Pathway is Required for the CXCL11-Induced Alteration of Tight Junctions in HBMECs
It has been previously reported that the disassembly of the tight junctions between HBMECs is the key step to
Previous reports have indicated that the integrity of tight junctions is regulated by several intracellular signaling
123
Neurochem Res Fig. 5 The ERK1/2 signaling pathway is required for the CXCL11-induced alteration of tight junctions in HBMECs. a The effects of inhibitors for ROCK, ERK1/2, PI3K, and PKC on CXCL11-induced HRP flux. The HBMECs were pretreated with a specific inhibitor for ERK1/2 and then treated with CXCL11. The different detergent solubilities of endothelial occludin were analyzed by Western blot (b). The changes in ZO-1 distribution were visualized by immunofluorescence (c). The activation of ERK1/2 in HBMECs treated with CXCL11 was detected by Western blot using a specific antibody for phosphorylated ERK1/2 (d). All data are the mean ± SD from three independent experiments. *p \ 0.05
pathways, such as Rho/ROCK, PI3K/Akt, protein kinase C, and ERK1/2. To define the intracellular signaling pathways downstream of CXCL11/CXCR3 in HBMECs, the HBMECs monolayers were pretreated with specific inhibitors for the above signaling molecules, and the brain endothelial barrier function was examined in the presence of CXCL11. As shown in Fig. 5a, the ERK1/2 inhibitor PD98059 blocked the CXCL11-induced increase in HRP flux, whereas the ROCK (Y27632), PI3K (LY294002), and PKC (Go¨ 6976) inhibitors had no effects. PD98059 significantly abolished the detergent solubility of occludin (Fig. 5b) and ZO-1 redistribution (Fig. 5c). We detected the activation of the ERK1/2 signaling pathway in HBMECs treated with CXCL11 using a specific antibody for phosphorylated ERK1/2. Western blot analysis revealed that phosphorylated ERK1/2 were increased in HBMECs after treatment with CXCL11 (Fig. 5d). These findings suggest that the ERK1/2 signaling pathway is associated with the CXCL11-induced alteration of TJ between HBMECs.
Discussion MSCs have been used to treat a wide variety of diseases. Although the therapeutic potential of MSCs in various pathological conditions of the CNS has been explored, the delivery of MSCs into the brain is still limited due to the existence of the BBB. Our previous findings indicated that the PI3K and ROCK signaling pathways were involved in the migration of bone marrow-derived mesenchymal stem
cells through HBMECs monolayers [18]. Here, we reveal that CXCL11 produced from hMSCs binds to CXCR3 on HBMECs, resulting in the opening of tight junctions, which promotes MSCs transendothelial migration. Because the successful application of stem cell approaches will depend on the microenvironment of the recipient tissue [19], we investigated the response of MSCs in the BBB environment. It is known that members of the CC family, such as CCL2, specifically increase vascular permeability in vivo [20]. Our previous studies indicated that CC chemokines, such as macrophage inflammatory protein1 alpha, increased the permeability of the HBMEC monolayer [21]. Therefore, we focused on the secretion of chemokines by hMSCs that increased the permeability of the HBMECs monolayer to facilitate the transendothelial migration of hMSCs. We treated hMSCs with human brain endothelial cells and used quantitative real-time PCR to measure the biological response. Our results indicated that the chemokine CXCL11 significantly increased in hMSCs, and the levels of CXCR3 on the brain endothelial cells increased after co-culturing with hMSCs. Therefore, we determined whether CXCL11 was required in hMSCs migration across the brain endothelial cell monolayers. CXCL11 is a small chemokine belonging to the CXC chemokine family and is mainly expressed in peripheral blood leukocytes [22]. It has been reported that CXCL11 binds to CXCR3 to induce the migration of activated T cells in vitro and in vivo during pathological inflammation [23]. Moreover, CXCL11 stimulates growth, migration and invasion of various tumor cell lines. In the present study we found a novel role of CXCL11 that CXCL11 was involved in
123
Neurochem Res
the transendothelial migration of hMSCs. Treatment with CXCL11 increased hMSCs transendothelial migration, whereas blockage of CXCL11 using a specific antibody for CXCL11 significantly decreased hMSCs transendothelial migration. Importantly, we found that CXCL11 altered tight junctions to increase the permeability of brain endothelial cells. This alteration required the activation of the ERK1/2 signaling pathway in brain endothelial cells. We also found that CXCL11 bound to and activated the receptor CXCR3 in brain endothelial cells. CXCR3 is mainly expressed on activated T and natural killer (NK) cells. In addition to CXCL11, CXCL10 and CXCL9 are also the ligands for CXCR3 [24]. However, in our studies, the expression of CXCL9 and CXCL10 did not increase during hMSCs and HBMECs interactions (data not shown). It is well known that different biological outcomes may also be related to the differential activation of CXCR3 by CXCL10, CXCL9, and CXCL11 [25, 26]. CXCL11 has a number of functional differences from CXCL10 and CXCL9; CXCL11 has a significantly higher receptor binding affinity than CXCL10 or CXCL9 [27]. In our present paper, we report that CXCL11 increases the permeability of the brain endothelial cells during hMSCs migration by making the junctions between the brain endothelial cells ‘porous,’ which allows for the infiltration of hMSCs into the brain tissue. In this paper, we modeled hMSCs interactions with human brain endothelial cells to mimic the BBB microenvironment. We revealed that the elevated levels of CXCL11 in hMSCs facilitated transendothelial migration by binding to CXCR3 and activating the ERK1/2 signaling pathway in brain endothelial cells. These results shed light on MSC behavior in the BBB microenvironment and suggested that chemokines like CXCL11 could trigger paracrine responses in vivo to modify the brain endothelial cells and contribute to hMSC infiltration into the brain.
5.
6.
7.
8. 9.
10.
11.
12.
13.
14.
15.
16.
References 1. Dezawa M, Ishikawa H, Itokazu Y, Yoshihara T, Hoshino M, Takeda S, Ide C, Nabeshima Y (2005) Bone marrow stromal cells generate muscle cells and repair muscle degeneration. Science 309:314–317 2. McFarlin K, Gao X, Liu YB, Dulchavsky DS, Kwon D, Arbab AS, Bansal M, Li Y, Chopp M, Dulchavsky SA, Gautam SC (2006) Bone marrow-derived mesenchymal stromal cells accelerate wound healing in the rat. Wound Repair Regen 14:471–478 3. Ru¨ster B, Go¨ttig S, Ludwig RJ, Bistrian R, Mu¨ller S, Seifried E, Gille J, Henschler R (2006) Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells. Blood 108:3938–3944 4. Sordi V, Malosio ML, Marchesi F, Mercalli A, Melzi R, Giordano T, Belmonte N, Ferrari G, Leone BE, Bertuzzi F, Zerbini G, Allavena P, Bonifacio E, Piemonti L (2005) Bone marrow
123
17.
18.
19.
20.
mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 106:419–427 Son BR, Marquez-Curtis LA, Kucia M, Wysoczynski M, Turner AR, Ratajczak J, Ratajczak MZ, Janowska-Wieczorek A (2006) Migration of bone marrow and cord blood mesenchymal stem cells in vitro is regulated by stromal-derived factor-1-CXCR4 and hepatocyte growth factor-c-Met axes and involves matrix metalloproteinases. Stem Cells 24:1254–1264 Lee JK, Jin HK, Endo S, Schuchman EH, Carter JE, Bae JS (2010) Intracerebral transplantation of bone marrowderived mesenchymal stem cells reduces amyloid-beta deposition and rescues memory deficits in Alzheimer’s disease mice by modulation of immune responses. Stem Cells 28:329–343 Danielyan L, Scha¨fer R, von Ameln-Mayerhofer A, Buadze M, Geisler J, Klopfer T, Burkhardt U, Proksch B, Verleysdonk S, Ayturan M, Buniatian GH, Gleiter CH, Frey WH 2nd (2009) Intranasal delivery of cells to the brain. Eur J Cell Biol 88:315–324 Dharmasaroja P (2009) Bone marrow-derived mesenchymal stem cells for the treatment of ischemic stroke. J Clin Neurosci 16:12–20 Abbott NJ, Patabendige AA, Dolman DE, Yusof SR, Begley DJ (2009) Structure and function of the blood–brain barrier. Neurobiol Dis 37:13–25 Liu WY, Wang ZB, Zhang LC, Wei X, Li L (2012) Tight junction in blood–brain barrier: an overview of structure, regulation, and regulator substances. CNS Neurosci Ther 18:609–615 Zhou SB, Wang J, Chiang CA, Sheng LL, Li QF (2013) Mechanical stretch upregulates Sdf-1a in skin tissue and induces migration of circulating bone marrow-derived stem cells into the expanded skin. Stem Cells. doi:10.1002/stem.1479 Augello A, Kurth TB, De Bari C (2010) Mesenchymal stem cells: a perspective from in vitro cultures to in vivo migration and niches. Eur Cell Mate 20:121–133 Chamberlain G, Smith H, Rainger GE, Middleton J (2011) Mesenchymal stem cells exhibit firm adhesion, crawling, spreading and transmigration across aortic endothelial cells: effects of chemokines and shear. PLoS ONE 6:e25663 Carrero R, Cerrada I, Lledo´ E, Dopazo J, Garcı´a-Garcı´a F, Rubio MP, Trigueros C, Dorronsoro A, Ruiz-Sauri A, Montero JA, Sepu´lveda P (2012) IL1b induces mesenchymal stem cells migration and leucocyte chemotaxis through NF-jB. Stem Cell Rev 8:905–916 Trotta T, Costantini S, Colonna G (2009) Modelling of the membrane receptor CXCR3 and its complexes with CXCL9, CXCL10 and CXCL11 chemokines: putative target for new drug design. Mol Immunol 47:332–339 Sung HJ, Hong SC, Yoo JH, Oh JH, Shin HJ, Choi IY, Ahn KH, Kim SH, Park Y, Kim BS (2010) Stemness evaluation of mesenchymal stem cells from placentas according to developmental stage: comparison to those from adult bone marrow. J Korean Med Sci 25:1418–1426 Tropel P, Noe¨l D, Platet N, Legrand P, Benabid AL, Berger F (2004) Isolation and characterisation of mesenchymal stem cells from adult mouse bone marrow. Exp Cell Res 295:395–406 Lin MN, Shang DS, Sun W, Li B, Xu X, Fang WG, Zhao WD, Cao L, Chen YH (2013) Involvement of PI3K and ROCK signaling pathways in migration of bone marrow-derived mesenchymal stem cells through human brain microvascular endothelial cell monolayers. Brain Res 1513:1–8 Greco SJ, Rameshwar P (2008) Microenvironmental considerations in the application of human mesenchymal stem cells in regenerative therapies. Biologics 2:699–705 Wolf MJ, Hoos A, Bauer J, Boettcher S, Knust M, Weber A, Simonavicius N, Schneider C, Lang M, Stu¨rzl M, Croner RS, Konrad A, Manz MG, Moch H, Aguzzi A, van Loo G, Pasparakis M, Prinz
Neurochem Res M, Borsig L, Heikenwalder M (2012) Endothelial CCR2 signaling induced by colon carcinoma cells enables extravasation via the JAK2-Stat5 and p38MAPK pathway. Cancer Cell 22:91–105 21. Man SM, Ma YR, Shang DS, Zhao WD, Li B, Guo DW, Fang WG, Zhu L, Chen YH (2007) Peripheral T cells overexpress MIP-1 a to enhance its transendothelial migration in Alzheimer’s disease. Neurobiol Aging 28:485–496 22. Lazzeri E, Romagnani P (2005) CXCR3-binding chemokines: novel multifunctional therapeutic targets. Curr Drug Targets Immune Endocr Metabol Disord 5:109–118 23. Zeremski M, Petrovic LM, Talal AH (2007) The role of chemokines as inflammatory mediators in chronic hepatitis C virus infection. J Viral Hepat 14:675–687
24. Groom JR, Luster AD (2011) CXCR3 in T cell function. Exp Cell Res 317:620–631 25. Groom JR, Luster AD (2011) CXCR3 ligands: redundant, collaborative and antagonistic functions. Immunol Cell Biol 89:207–215 26. Mu¨ller M, Carter S, Hofer MJ, Campbell IL (2010) Review: The chemokine receptor CXCR3 and its ligands CXCL9, CXCL10 and CXCL11 in neuroimmunity—a tale of conflict and conundrum. Neuropathol Appl Neurobiol 36:368–387 27. Loetscher P, Clark-Lewis I (2001) Agonistic and antagonistic activities of chemokines. J Leukoc Biol 69:881–884
123
ORIGINAL PAPER
The Involvement of CXCL11 in Bone Marrow-Derived Mesenchymal Stem Cell Migration Through Human Brain Microvascular Endothelial Cells Yu Feng • Hong-Mei Yu • De-Shu Shang • Wen-Gang Fang • Zhi-Yi He • Yu-Hua Chen
Received: 29 August 2013 / Revised: 4 February 2014 / Accepted: 7 February 2014 Ó Springer Science+Business Media New York 2014
Abstract Bone marrow-derived mesenchymal stem cells (MSCs) transplant into the brain, where they play a potential therapeutic role in neurological diseases. However, the blood–brain barrier (BBB) is a native obstacle for MSCs entry into the brain. Little is known about the mechanism behind MSCs migration across the BBB. In the present study, we modeled the interactions between human MSCs (hMSCs) and human brain microvascular endothelial cells (HBMECs) to mimic the BBB microenvironment. Real-time PCR analysis indicated that the chemokine CXCL11 is produced by hMSCs and the chemokine receptor CXCR3 is expressed on HBMECs. Further results indicate that CXCL11 secreted by hMSCs may interact with CXCR3 on HBMECs to induce the disassembly of tight junctions through the activation of ERK1/2 signaling in the endothelium, which promotes MSCs transendothelial migration. These findings are relevant for understanding the biological responses of MSCs in BBB environments and helpful for the application of MSCs in neurological diseases. Keywords Bone marrow-derived mesenchymal stem cell Chemokine CXCL11 CXCR3 Brain microvascular endothelial cell Tight junction Blood–brain barrier
Y. Feng H.-M. Yu Z.-Y. He Department of Neurology, The First Hospital of China Medical University, 155 Nan Jing Northern Street, Shenyang 110001, Liaoning, China Y. Feng D.-S. Shang W.-G. Fang Y.-H. Chen (&) Department of Developmental Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health and Key Laboratory of Medical Cell Biology, Ministry of Education, China Medical University, 92 Bei Er Road, Shenyang 110001, Liaoning, China e-mail: [email protected]
Introduction Mesenchymal stem cells (MSCs) have become a therapeutic option for several pathologies, such as myocardial infarction and wound repair [1, 2]. Similar to immune cells, MSCs can extravasate from the blood vessels into ischemic, apoptotic and inflammatory tissues, where the cells survive and promote tissue regeneration [3–5]. Several studies indicate that MSCs are a potential candidate to treat neurological diseases [6–8]. Therefore, a better understanding of the mechanisms behind MSCs migration into the brain is important to improve therapies for neurological diseases. The blood–brain barrier (BBB) is a specific vascular system that separates the blood from the brain and maintains a highly stable brain microenvironment. The BBB consists of a network of closely adjoining endothelial cells in the brain’s capillaries that are characterized by the presence of continuous tight junctions (TJ) [9, 10]. Therefore, the BBB is a native obstacle for MSCs entry into the brain. As has been previously discussed, MSCs have the ability to migrate into tissues from circulation, possibly in response to signals that are upregulated under injury conditions. It is probable that chemokines and their receptors are involved, as they are important factors known to control cell migration [11–13]. CXCL11 is a member of a family of small proteins, the chemokines (or chemoattractant cytokines). This chemokine plays a key role in immune and inflammatory responses by promoting the recruitment and activation of different subpopulations of leukocytes. A previous study reported that IL1b increased the production of CXCL11 to promote MSCs migration [14]. Chemotaxis assays indicated that CXCL11 in human serum has significant chemotactic effects on human MSCs [15]. Therefore, we wanted to
123
Neurochem Res
determine whether CXCL11 was involved in MSCs transendothelial migration. In the present paper, we found that CXCL11 secreted by MSCs may interact with CXCR3 (chemokine (C-X-C motif) receptor 3) on human brain microvascular endothelial cells (HBMEC) and activate downstream signaling cascades in the endothelium to open tight junctions, which promotes MSCs transendothelial migration.
analyzed using the 2(-Delta Delta C (T)) method. The primers used are listed in Table 1. ELISA
Materials and Methods
1 9 105 HBMECs were seeded on the bottom of a 24-well plate. After 24 h, 2 9 105 hMSCs were seeded on the HBMECs monolayer. After 4, 8, and 12 h in co-culture, the supernatants were collected and the levels of human CXCL11 were quantified by ELISA according to the manufacturer’s protocol (R&D Systems).
Cells and Culture Conditions
MSC Transendothelial Migration Assay
Human bone marrow MSCs (hMSCs) were prepared as previously described [16]. The bone marrow samples were used in accordance with the procedures approved by the human experimentation and ethics committees of China Medical University. Rat MSCs were prepared as described by Tropel et al. [17]. Briefly, male Wistar rats were sacrificed, and the femurs were aseptically dissected, repeatedly flushed with MSCs medium, and plated in a culture flask (Corning Costar). After 24 h, the adherent cells were cultured as passage 0. The use of animals in this study was approved by the Animal Care and Use Committee of China Medical University, and all procedures were carried out in accordance with institutional guidelines. Human brain microvascular endothelial cells [18] were cultured in completed RPMI 1640 medium containing 10 % FBS, 10 % Nu-serum (BD Biosciences), 2 mM glutamine, 1 mM sodium pyruvate, 19 non-essential amino acids and 19 MEM vitamins. For the co-culturing experiments, 1 9 105 HBMECs were seeded on the bottom of 24-well plate and grown in 5 % CO2 at 37 °C. After 24 h, the transwell inserts with pore sizes of 0.4 lm (Corning Costar Corp., Cambridge, MA) were put into the 24-well plate cultured with HBMECs, and 2 9 105 hMSCs were seeded on the upper chambers of transwell inserts. After 4, 8, and 12 h in co-culture, the hMSCs were collected and analyzed.
1 9 105 HBMECs were seeded on fibronectin-coated 24-well Transculture inserts with pore sizes of 8 lm (Corning Costar Corp., Cambridge, MA) and grown for 4 days in 5 % CO2 at 37 °C. The medium was replaced every day with fresh medium. The experiments were conducted when the transendothelial electrical resistance (TEER) was [200 ohm cm2. Prior to the assays, the HBMECs monolayers were washed once with medium without serum, and 1 9 105 MSCs in 100 ll medium was added to the upper chamber. After incubation for 8 h, the upper chambers were fixed with 3.7 % formaldehyde and washed extensively with PBS. To remove the non-migrating cells, the apical side of the upper chamber was scraped gently with cotton wool. Only the migrating MSCs were stained with hematoxylin and eosin (HE) and observed under a fluorescent microscope. The migrating cells were counted from 10 random fields of 2009 magnification. For the neutralization test, the MSCs were suspended in serum-free RPMI 1640 containing a CXCL11 neutralizing antibody and then incubated with the HBMECs.
Quantitative Real-Time PCR Total RNA was isolated using the Trizol reagent according to the manufacturer’s instructions, and the reverse transcriptase reaction was carried out with 1 lg of total RNA using the PrimeScript RT Master Mix Kit (Takara Bio, Tokyo, Japan) with random primers. Relative real-time PCR was performed using an ABI PRISM 7500HT Sequence Detection System (Applied Biosystems) using the SYBR Premix Ex Taq kit (Takara Bio, Tokyo, Japan) according to the manufacturer’s protocols. The relative expression levels of the chemokines were normalized to the expression level of GAPDH and
123
HRP Flux Measurement The HBMECs monolayer in the Transwell inserts (0.4 lm pore size, Costar, Cambridge, MA) were incubated with 100 ng/ml CXCL11 for the indicated time or with different concentrations of CXCL11 containing 0.4 mg/ml HRP for 1 h. The media from the lower chamber were then collected, and the HRP content of the samples was assayed colorimetrically as previously described. The HRP flux was expressed in nanograms passed per cm2 surface area per hour. Immunofluorescence The HBMECs monolayers grown on glass coverslips were fixed with 4 % paraformaldehyde and permeabilized with 0.1 % Triton X-100. After blocking with 5 % BSA in PBS, the cells were incubated with mouse anti-ZO-1 or rabbit
Neurochem Res Table 1 The primer sequences for CXCL11 and GAPDH for real-time PCR Target
Amplicon length, bp
Human CXCL11
120
Human GAPDH
197
50 -30 oligonucleotide sequences, forward, reverse
Nucleotide position
Genbank accession no. NM_005409
AGCAGTGAAAGTGGCAGAT
324-343
TTGGGATTTAGGCATCGT
425-443
GAAGGTGAAGGTCGGAGTC
108-126
GAAGATGGTGATGGGATTTC
314-333
NM_002046.3
anti-occludin antibodies to visualize the distribution of ZO1 and occludin. The glass slides were analyzed using immunofluorescence microscopy (Olympus, Japan). Cell Fractionation and Western Blot The cell fractionation experiments were performed as described previously (Li et al. 2006). In brief, confluent HBMECs were washed, extracted in Triton X-100 lysis buffer (25 mM HEPES, 150 mM NaCl, 4 mM EDTA, 1 % Triton X-100) and centrifuged to collect the soluble fraction. The pellets were dissolved in SDS lysis buffer (25 mM HEPES, 4 mM EDTA, 1 % SDS) to obtain the insoluble fraction. Equal portions of the soluble and insoluble fractions were analyzed by Western blot. For the Western blots, the cells were lysed in RIPA buffer (50 mM Tris–HCL, 150 mM NaCl, 1 % NP-40, 0.5 % deoxycholate, 0.1 % sodium dodecylsulfate) supplemented with the Complete/Mini protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentrations were determined using the BCA protein assay reagent kit (Pierce, Indianapolis, IN). 20 lg proteins were separated by 8 % SDS-PAGE, transferred electrophoretically to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA), and processed for immunoblotting with antioccludin (1:1,000) polyclonal antibody (Santa Cruz Biotechnology, CA), ERK (1:1,000) and phosphorylated ERK1/2 (1:1,000) polyclonal antibodies (Cell Signaling Technology, MA) for 2 h at room temperature. Membranes were washed with PBS and incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:10,000, Santa Cruz Biotechnology, CA) for 1 h at room temperature. The protein bands were visualized using AmershamTM ECL Plus Western Blotting Detection Reagents (GE Healthcare, Piscataway, NJ).
Results The Expression of CXCL11 is Increased in MSCs Co-cultured with HBMECs We first characterized the hMSCs by examining hMSC specific markers (data not shown). The levels of multiple chemokines in hMSCs from different passage numbers were then
Fig. 1 The expression of CXCL11 is increased in MSCs co-cultured with HBMECs. a The levels of CXCL11 in human MSCs at different passage numbers were measured by quantitative real-time PCR. b The levels of CXCL11 in rat MSCs at different passage numbers were measured by quantitative real-time PCR. c The levels of CXCL11 in human MSCs co-cultured with HBMECs were measured by quantitative real-time PCR. d The levels of CXCL11 in the supernatants derived from the co-culture experiments were detected by ELISA. All data are the mean ± SD from three independent experiments. *p \ 0.05
measured using quantitative real-time PCR. The results indicate that the mRNA levels of CXCL11 in the hMSCs and rat MSCs significantly increased with passage number (Fig. 1a, b). We co-cultured hMSCs with HBMECs to investigate the response of the MSCs to the BBB environment. The levels of CXCL11 were measured using quantitative real-time PCR. As shown in Fig. 1c, the expression level of CXCL11 was significantly increased in hMSCs (passage 6) that were incubated with the HBMECs. To verify this result, the levels of CXCL11 in the supernatants were measured by ELISA. The results indicate that CXCL11 expression was highly up-regulated in hMSCs that were co-cultured with the HBMECs (Fig. 1d). These data suggest that CXCL11 might be involved in the MSCs response to the BBB environment. CXCL11 is Involved in hMSC Transendothelial Migration To investigate whether CXCL11 is involved in hMSCs transendothelial migration, a transwell system was used.
123
Neurochem Res
Fig. 2 CXCL11 is involved in hMSCs transendothelial migration. a Treatment with a CXCL11 neutralizing antibody decreased hMSCs transendothelial migration. b Treatment with 100 ng/ml of recombinant human CXCL11 protein increased hMSCs transendothelial migration. All data are the mean ± SD from three independent experiments. *p \ 0.05
Fig. 4 CXCR3 in HBMECs mediates CXCL11-induced hMSCs transedothelial migration. a The levels of the chemokine receptor CXCR3 in HBMECs after incubation with the hMSCs were measured by quantitative real-time PCR. b Treatment with a CXCR3 neutralizing antibody decreased hMSCs transendothelial migration. All data are the mean ± SD from three independent experiments. *p \ 0.05
transendothelial migration. Therefore, the effect of CXCL11 on the integrity of the tight junctions between HBMECs was evaluated according to the previous work. The results indicate that CXCL11 significantly increased HRP flux in a time and dose-dependent manner (Fig. 3a, b). There was also an obvious shift in occludin distribution from the insoluble to soluble fractions prepared from HBMECs treated with recombinant human CXCL11 protein (Fig. 3c). In addition, the distribution of ZO-1, a TJ structural protein, was visualized by immunofluorescence. Treatment with CXCL11 disrupted the continuous lines at the cell–cell borders, making the ZO-1 staining discontinuous (Fig. 3d). Thus, these results indicate that CXCL11 induces the disassembly of the tight junctions between HBMECs to promote hMSCs transendothelial migration. CXCR3 in HBMECs Mediates CXCL11-Induced hMSCs Transedothelial Migration Fig. 3 The effects of CXCL11 on brain endothelial permeability. a A dose-dependent change in HRP flux was induced by CXCL11. b A time-dependent change in HRP flux was induced by CXCL11. c A shift in endothelial occludin from the insoluble to soluble phase in response to CXCL11 was detected by Western blot. d The changes in ZO-1 distribution in HBMECs treated with CXCL11 were visualized by immunofluorescence. All data are the mean ± SD from three independent experiments. *p \ 0.05
Treatment with a CXCL11 neutralizing antibody significantly decreased the migratory activity of the hMSCs (Fig. 2a). In contrast, treatment with 100 ng/ml of recombinant human CXCL11 protein significantly increased the transendothelial migration of the hMSCs (Fig. 2b). These results indicate that CXCL11 is involved in hMSCs transendothelial migration.
It well known that CXCL11 is a member of the ELR–CXC family and the ligand for the chemokine receptor CXCR3. Several studies have demonstrated a pathogenic role of CXCL11 and CXCR3 in many human inflammatory diseases. As shown in Fig. 4a, the expression of CXCR3 significantly increased in HBMECs that interacted with hMSCs. To determine whether CXCR3 expression in HBMECs is involved in the transendothelial migration of the hMSCs toward CXCL11, a CXCR3 neutralizing antibody was used to block the effects of CXCR3. The results showed that treatment with an anti-CXCR3 antibody significantly reduced hMSCs transedothelial migration (Fig. 4b).
CXCL11 Mediates hMSCs Transendothelial Migration by Affecting the Integrity of Tight Junctions Between HBMECs
The ERK1/2 Signaling Pathway is Required for the CXCL11-Induced Alteration of Tight Junctions in HBMECs
It has been previously reported that the disassembly of the tight junctions between HBMECs is the key step to
Previous reports have indicated that the integrity of tight junctions is regulated by several intracellular signaling
123
Neurochem Res Fig. 5 The ERK1/2 signaling pathway is required for the CXCL11-induced alteration of tight junctions in HBMECs. a The effects of inhibitors for ROCK, ERK1/2, PI3K, and PKC on CXCL11-induced HRP flux. The HBMECs were pretreated with a specific inhibitor for ERK1/2 and then treated with CXCL11. The different detergent solubilities of endothelial occludin were analyzed by Western blot (b). The changes in ZO-1 distribution were visualized by immunofluorescence (c). The activation of ERK1/2 in HBMECs treated with CXCL11 was detected by Western blot using a specific antibody for phosphorylated ERK1/2 (d). All data are the mean ± SD from three independent experiments. *p \ 0.05
pathways, such as Rho/ROCK, PI3K/Akt, protein kinase C, and ERK1/2. To define the intracellular signaling pathways downstream of CXCL11/CXCR3 in HBMECs, the HBMECs monolayers were pretreated with specific inhibitors for the above signaling molecules, and the brain endothelial barrier function was examined in the presence of CXCL11. As shown in Fig. 5a, the ERK1/2 inhibitor PD98059 blocked the CXCL11-induced increase in HRP flux, whereas the ROCK (Y27632), PI3K (LY294002), and PKC (Go¨ 6976) inhibitors had no effects. PD98059 significantly abolished the detergent solubility of occludin (Fig. 5b) and ZO-1 redistribution (Fig. 5c). We detected the activation of the ERK1/2 signaling pathway in HBMECs treated with CXCL11 using a specific antibody for phosphorylated ERK1/2. Western blot analysis revealed that phosphorylated ERK1/2 were increased in HBMECs after treatment with CXCL11 (Fig. 5d). These findings suggest that the ERK1/2 signaling pathway is associated with the CXCL11-induced alteration of TJ between HBMECs.
Discussion MSCs have been used to treat a wide variety of diseases. Although the therapeutic potential of MSCs in various pathological conditions of the CNS has been explored, the delivery of MSCs into the brain is still limited due to the existence of the BBB. Our previous findings indicated that the PI3K and ROCK signaling pathways were involved in the migration of bone marrow-derived mesenchymal stem
cells through HBMECs monolayers [18]. Here, we reveal that CXCL11 produced from hMSCs binds to CXCR3 on HBMECs, resulting in the opening of tight junctions, which promotes MSCs transendothelial migration. Because the successful application of stem cell approaches will depend on the microenvironment of the recipient tissue [19], we investigated the response of MSCs in the BBB environment. It is known that members of the CC family, such as CCL2, specifically increase vascular permeability in vivo [20]. Our previous studies indicated that CC chemokines, such as macrophage inflammatory protein1 alpha, increased the permeability of the HBMEC monolayer [21]. Therefore, we focused on the secretion of chemokines by hMSCs that increased the permeability of the HBMECs monolayer to facilitate the transendothelial migration of hMSCs. We treated hMSCs with human brain endothelial cells and used quantitative real-time PCR to measure the biological response. Our results indicated that the chemokine CXCL11 significantly increased in hMSCs, and the levels of CXCR3 on the brain endothelial cells increased after co-culturing with hMSCs. Therefore, we determined whether CXCL11 was required in hMSCs migration across the brain endothelial cell monolayers. CXCL11 is a small chemokine belonging to the CXC chemokine family and is mainly expressed in peripheral blood leukocytes [22]. It has been reported that CXCL11 binds to CXCR3 to induce the migration of activated T cells in vitro and in vivo during pathological inflammation [23]. Moreover, CXCL11 stimulates growth, migration and invasion of various tumor cell lines. In the present study we found a novel role of CXCL11 that CXCL11 was involved in
123
Neurochem Res
the transendothelial migration of hMSCs. Treatment with CXCL11 increased hMSCs transendothelial migration, whereas blockage of CXCL11 using a specific antibody for CXCL11 significantly decreased hMSCs transendothelial migration. Importantly, we found that CXCL11 altered tight junctions to increase the permeability of brain endothelial cells. This alteration required the activation of the ERK1/2 signaling pathway in brain endothelial cells. We also found that CXCL11 bound to and activated the receptor CXCR3 in brain endothelial cells. CXCR3 is mainly expressed on activated T and natural killer (NK) cells. In addition to CXCL11, CXCL10 and CXCL9 are also the ligands for CXCR3 [24]. However, in our studies, the expression of CXCL9 and CXCL10 did not increase during hMSCs and HBMECs interactions (data not shown). It is well known that different biological outcomes may also be related to the differential activation of CXCR3 by CXCL10, CXCL9, and CXCL11 [25, 26]. CXCL11 has a number of functional differences from CXCL10 and CXCL9; CXCL11 has a significantly higher receptor binding affinity than CXCL10 or CXCL9 [27]. In our present paper, we report that CXCL11 increases the permeability of the brain endothelial cells during hMSCs migration by making the junctions between the brain endothelial cells ‘porous,’ which allows for the infiltration of hMSCs into the brain tissue. In this paper, we modeled hMSCs interactions with human brain endothelial cells to mimic the BBB microenvironment. We revealed that the elevated levels of CXCL11 in hMSCs facilitated transendothelial migration by binding to CXCR3 and activating the ERK1/2 signaling pathway in brain endothelial cells. These results shed light on MSC behavior in the BBB microenvironment and suggested that chemokines like CXCL11 could trigger paracrine responses in vivo to modify the brain endothelial cells and contribute to hMSC infiltration into the brain.
5.
6.
7.
8. 9.
10.
11.
12.
13.
14.
15.
16.
References 1. Dezawa M, Ishikawa H, Itokazu Y, Yoshihara T, Hoshino M, Takeda S, Ide C, Nabeshima Y (2005) Bone marrow stromal cells generate muscle cells and repair muscle degeneration. Science 309:314–317 2. McFarlin K, Gao X, Liu YB, Dulchavsky DS, Kwon D, Arbab AS, Bansal M, Li Y, Chopp M, Dulchavsky SA, Gautam SC (2006) Bone marrow-derived mesenchymal stromal cells accelerate wound healing in the rat. Wound Repair Regen 14:471–478 3. Ru¨ster B, Go¨ttig S, Ludwig RJ, Bistrian R, Mu¨ller S, Seifried E, Gille J, Henschler R (2006) Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells. Blood 108:3938–3944 4. Sordi V, Malosio ML, Marchesi F, Mercalli A, Melzi R, Giordano T, Belmonte N, Ferrari G, Leone BE, Bertuzzi F, Zerbini G, Allavena P, Bonifacio E, Piemonti L (2005) Bone marrow
123
17.
18.
19.
20.
mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 106:419–427 Son BR, Marquez-Curtis LA, Kucia M, Wysoczynski M, Turner AR, Ratajczak J, Ratajczak MZ, Janowska-Wieczorek A (2006) Migration of bone marrow and cord blood mesenchymal stem cells in vitro is regulated by stromal-derived factor-1-CXCR4 and hepatocyte growth factor-c-Met axes and involves matrix metalloproteinases. Stem Cells 24:1254–1264 Lee JK, Jin HK, Endo S, Schuchman EH, Carter JE, Bae JS (2010) Intracerebral transplantation of bone marrowderived mesenchymal stem cells reduces amyloid-beta deposition and rescues memory deficits in Alzheimer’s disease mice by modulation of immune responses. Stem Cells 28:329–343 Danielyan L, Scha¨fer R, von Ameln-Mayerhofer A, Buadze M, Geisler J, Klopfer T, Burkhardt U, Proksch B, Verleysdonk S, Ayturan M, Buniatian GH, Gleiter CH, Frey WH 2nd (2009) Intranasal delivery of cells to the brain. Eur J Cell Biol 88:315–324 Dharmasaroja P (2009) Bone marrow-derived mesenchymal stem cells for the treatment of ischemic stroke. J Clin Neurosci 16:12–20 Abbott NJ, Patabendige AA, Dolman DE, Yusof SR, Begley DJ (2009) Structure and function of the blood–brain barrier. Neurobiol Dis 37:13–25 Liu WY, Wang ZB, Zhang LC, Wei X, Li L (2012) Tight junction in blood–brain barrier: an overview of structure, regulation, and regulator substances. CNS Neurosci Ther 18:609–615 Zhou SB, Wang J, Chiang CA, Sheng LL, Li QF (2013) Mechanical stretch upregulates Sdf-1a in skin tissue and induces migration of circulating bone marrow-derived stem cells into the expanded skin. Stem Cells. doi:10.1002/stem.1479 Augello A, Kurth TB, De Bari C (2010) Mesenchymal stem cells: a perspective from in vitro cultures to in vivo migration and niches. Eur Cell Mate 20:121–133 Chamberlain G, Smith H, Rainger GE, Middleton J (2011) Mesenchymal stem cells exhibit firm adhesion, crawling, spreading and transmigration across aortic endothelial cells: effects of chemokines and shear. PLoS ONE 6:e25663 Carrero R, Cerrada I, Lledo´ E, Dopazo J, Garcı´a-Garcı´a F, Rubio MP, Trigueros C, Dorronsoro A, Ruiz-Sauri A, Montero JA, Sepu´lveda P (2012) IL1b induces mesenchymal stem cells migration and leucocyte chemotaxis through NF-jB. Stem Cell Rev 8:905–916 Trotta T, Costantini S, Colonna G (2009) Modelling of the membrane receptor CXCR3 and its complexes with CXCL9, CXCL10 and CXCL11 chemokines: putative target for new drug design. Mol Immunol 47:332–339 Sung HJ, Hong SC, Yoo JH, Oh JH, Shin HJ, Choi IY, Ahn KH, Kim SH, Park Y, Kim BS (2010) Stemness evaluation of mesenchymal stem cells from placentas according to developmental stage: comparison to those from adult bone marrow. J Korean Med Sci 25:1418–1426 Tropel P, Noe¨l D, Platet N, Legrand P, Benabid AL, Berger F (2004) Isolation and characterisation of mesenchymal stem cells from adult mouse bone marrow. Exp Cell Res 295:395–406 Lin MN, Shang DS, Sun W, Li B, Xu X, Fang WG, Zhao WD, Cao L, Chen YH (2013) Involvement of PI3K and ROCK signaling pathways in migration of bone marrow-derived mesenchymal stem cells through human brain microvascular endothelial cell monolayers. Brain Res 1513:1–8 Greco SJ, Rameshwar P (2008) Microenvironmental considerations in the application of human mesenchymal stem cells in regenerative therapies. Biologics 2:699–705 Wolf MJ, Hoos A, Bauer J, Boettcher S, Knust M, Weber A, Simonavicius N, Schneider C, Lang M, Stu¨rzl M, Croner RS, Konrad A, Manz MG, Moch H, Aguzzi A, van Loo G, Pasparakis M, Prinz
Neurochem Res M, Borsig L, Heikenwalder M (2012) Endothelial CCR2 signaling induced by colon carcinoma cells enables extravasation via the JAK2-Stat5 and p38MAPK pathway. Cancer Cell 22:91–105 21. Man SM, Ma YR, Shang DS, Zhao WD, Li B, Guo DW, Fang WG, Zhu L, Chen YH (2007) Peripheral T cells overexpress MIP-1 a to enhance its transendothelial migration in Alzheimer’s disease. Neurobiol Aging 28:485–496 22. Lazzeri E, Romagnani P (2005) CXCR3-binding chemokines: novel multifunctional therapeutic targets. Curr Drug Targets Immune Endocr Metabol Disord 5:109–118 23. Zeremski M, Petrovic LM, Talal AH (2007) The role of chemokines as inflammatory mediators in chronic hepatitis C virus infection. J Viral Hepat 14:675–687
24. Groom JR, Luster AD (2011) CXCR3 in T cell function. Exp Cell Res 317:620–631 25. Groom JR, Luster AD (2011) CXCR3 ligands: redundant, collaborative and antagonistic functions. Immunol Cell Biol 89:207–215 26. Mu¨ller M, Carter S, Hofer MJ, Campbell IL (2010) Review: The chemokine receptor CXCR3 and its ligands CXCL9, CXCL10 and CXCL11 in neuroimmunity—a tale of conflict and conundrum. Neuropathol Appl Neurobiol 36:368–387 27. Loetscher P, Clark-Lewis I (2001) Agonistic and antagonistic activities of chemokines. J Leukoc Biol 69:881–884
123
