Nucleic Acids Research, Vol. 19, No. 17 4785
The IGLJ6 joining segment as a STS in the human immunoglobulin lambda light chain constant region gene locus (located at 22q11) M.-A.Poul, X.-M.Zhang, F.Ducret and M.-P.Lefranc* Laboratoire d'lmmunogenetique Moleculaire LIGM, URA CNRS 1191, Universite Montpellier 11, CC 012, Place Eugene Bataillon, 34095 Montpellier Cedex 5, France Submitted April 9, 1991 The human immunoglobulin lambda light chain gene locus (IGL) is located at 22ql 1. The C-lambda gene locus IGLC is complex, with a number of cross-hybridizing IGLC genes that vary from 7 to 10 per haploid genome (1-5). Furthermore, three C-lambda like genes have been identified which cross-hybridize with the genes of the major IGLC locus (1-3). It was therefore of interest to identify the IGU6 segment (3) as a unique sequence. This segment is located at 1.5 kb upstream of the CX6 gene and has a translatable open reading frame (3). This is in contrast with data from ref. S in which four separate misreadings of the IGLJ6 sequence created an artefactual deletion. We report the sequence of the 595 bp SacI-BglII fragment which contains the J6 segment (positions 517 to 553), (EMBL accession number X5818 1), from the CX3 -6 clone (3). We have defined this information fragment as a sequence tagged site (STS), designated as IGLJ6 [/22q1 1], for inclusion in the human genome map. Using the polymerase chain reaction (PCR) described below, a fragment of expected size 574 bp was amplified from the positions 21 to 594 of the SacI-Bglm fragment. The amplified fragment was purified, uniformly radiolabelled, and used to probe thirteen genomic DNAs by Southern. As anticipated, a single 5.9 kb BamHI, 6.6 kb BglIl, 6.2 kb SacI and 7 kb TaqI fragment was detected, demonstrating both the unique character of the amplified sequence, and the direct utility of the PCR product as a probe for retrieving clones containing this STS from libraries. PCR primers: GGTCTGTGTCCCTGTGGTCA Forward (21-40) GATCTCACCCTAGACCCAAA Reverse (594-575) PCR Components: 2 ytg of human genomic DNA, 40 pmoles of each oligonucleotide, 200 ,uM dNTPs, and 2.5 U Taq polymerase (Perkin Elmer Cetus) in 100 td of 1 xPCR buffer (50 mM KCI, 10 mM Tris-HCl, pH 8.3 at room temperature, 1.5 mM MgCl2, 0.1% w/v gelatin).
*
To whom correspondence should be addressed
EMBL accession no. X58181 PCR Profile: 94°C for 3 minutes; 55°C for 10 minutes. 30 cycles each: 72°C for 1 minute; 94°C for 1 minute; 55°C for 1 minute. Anticipated sequence of the PCR product: GGTIc&AC TGTGGTCAArC
TTCCCACAACCCCCAATTCCCAITCCAAGCC
CATCCCA¶CATAACCTCCAGTCTGAGGATGrGGGGGATCAAGGACCCTCCCCACCAT TCCCAACTTCTCAAGAGG¶TCCAGCTGCACCATGTAGTGGCGTCACCCAGCCGCTCAC CTCCCCTTrCCITCCTGGCATICCTGACACCAGCIGATCCAGGCCACCCAACTCCICAGAA ATGCAATTACC[GGGAGACAATCCACACACAGACCTGTCAACCCTTCCCATGACTGAGG TGGATGAACCCCTAAGCCCCCAGGAAGTGATATTCAGGTCAGTAGAAGTGACCCCCTTC
ACCCCACCTATGGCTCACCCACCCATGAGAAAAGGGGCTGGACCCTGGGCCTTGTGAGCA GCTGCAGGGGGT CGGGGGGGG WCCG GCGG7GTATCAGGAGGGTTTGTGTCAG GGTTATA7CACAGT TAATl CGGCAGTGGCACCAAGGTGACCGTCCXMGGTGAGTC CCCTrIs£TATTVv
REFERENCES 1. 2. 3. 4. 5.
Hieter,P.A et al. (1981) Nature 294, 536-540. Taub,R.A et al. (1983) Nature 304, 172-174. Dariavach,P. et al. (1987) Proc. Natl. Acad. Sci. USA 84, 9074-9078. Ghanem,N. et al. (1988) Exp. Clin. Immunogenet. 5, 186-195. Vasicek,T.J and Leder,P. (1990) J. Exp. Med. 172, 609-620.
kh
BamEill
*o..o
**w.- *0_
_m*
5.9