R E S EA R C H A R T I C L E
The Effect of Photoreceptor Degeneration on Ganglion Cell Morphology E.E. O’Brien, U. Greferath, and E.L. Fletcher* Department of Anatomy and Neuroscience, University of Melbourne, Melbourne, Victoria 3010 Australia
ABSTRACT Retinitis pigmentosa refers to a family of inherited photoreceptor degenerations resulting in blindness. During and after photoreceptor loss, neurons of the inner retina are known to undergo plastic changes. Here, we have investigated in detail whether ganglion cells are altered at late stages of degeneration, well after the total loss of photoreceptors. We used mice, rd1-Thy1, that carry a mutation in the b-subunit of phosphodiesterase 6 and a fluorescent protein that labels a subset of ganglion cells and B6-Thy1 control mice. Retinal wholemounts from mice aged 3–11 months were processed for immunohistochemistry and analyzed. Ganglion cells were classified based on soma area, dendritic field size, and branching of dendrites. The dendritic fields of
some ganglion cells were further analyzed for their length, area and quantity of branching points. There was a decrease in size and level of branching of A2, B1, and D type ganglion cells in the degenerated retina at 11 months of age. In contrast, C1 ganglion cells remained unchanged. In addition, there was a shift in the proportion of ganglion cells ramifying in the different layers of the inner plexiform layer. Careful analysis of the dendrites of ganglion cells revealed some projecting to new, more distal regions of the inner plexiform layer. We propose that these changes in ganglion cell morphology could impact the function of individual cells as well as the retinal circuitry in the degenerated retina. J. Comp. Neurol. 522:1155–1170, 2014. C 2013 Wiley Periodicals, Inc. V
INDEXING TERMS: ganglion cell; retinitis pigmentosa; plasticity; retina; inner plexiform layer
Over recent years there has been a surge of interest in vision-restoring therapies that replace the function of dead or dying photoreceptors in those with inherited retinal degenerations. For any of these treatments to succeed, a basic requirement is that ganglion cells remain functionally intact, and capable of passing visual information from the retina to higher visual centers. However, it is now known that as a consequence of photoreceptor progressive loss, neurons of the inner retina undergo considerable plastic changes or remodeling (Jones et al., 2003a; Marc et al., 2003a; Strettoi and Pignatelli, 2000; Strettoi et al., 2002, 2003). Among the changes that develop following photoreceptor death, neurons of the inner retina seek new synaptic partners, forming aberrant and/or ectopic synapses (Jones et al., 2003a; Marc et al., 2003a; Peng et al., 2000). In addition, one study has shown that there can be loss of up to 70% of ganglion cells in late stages of retinitis pigmentosa (Santos et al., 1997). Functional changes in ganglion cells have also been reported in a number of animal models of retinal degeneration from relatively early stages of degeneration C 2013 Wiley Periodicals, Inc. V
(Margolis et al., 2008; O’Hearn et al., 2006; Sekirnjak et al., 2011; Suzuki et al., 2004; Ye and Goo, 2007). In line with the remodeling and functional changes reported, several studies have evaluated ganglion morphology during degeneration (Damiani et al., 2012; Grafstei et al., 1972; Lin and Peng, 2013; Mazzoni et al., 2008). These studies used two different mouse models of retinal degeneration (rd1 and rd10) that carry mutations in the gene encoding phosphodiesterase, but that manifest photoreceptor loss at different ages. Previous work examining ganglion cell morphology in the rd1 retina have shown a 10% reduction in dendritic field size (Grafstei et al., 1972) with two particular ganglion cell
Grant sponsor: National Health and Medical Research Council; Grant number: APP1021042; Grant sponsor: Retina Australia; Grant sponsor: the Australian Research Council, through its Special Research Initiative in Bionic Vision Science and Technology grant to Bionic Vision Australia. *Address correspondence to: Erica Fletcher, Department of Anatomy and Neuroscience, University of Melbourne, Victoria, 3010 Australia. E-mail: [email protected] Received July 29, 2013; Revised September 23, 2013; Accepted October 2, 2013. DOI 10.1002/cne.23487 Published online October 31, 2013 in Wiley (wileyonlinelibrary.com)
Online
The Journal of Comparative Neurology | Research in Systems Neuroscience 522:1155–1170 (2014)
Library
1155
E.E. O’brien et al.
types showing a 50% reduction in dendritic field sizes in half of the sample size (Damiani et al., 2012). In contrast, a study examining ganglion cells in the rd10 mouse model of degeneration did not find any changes in the morphology in any of the 14 types of ganglion cells analyzed (Mazzoni et al., 2008). It should be noted, however, that these studies mostly focused on morphology of ganglion cell dendrites in a horizontal domain. Little information is available about detailed changes in morphology of ganglion cells that project to the various sublaminae of the inner plexiform layer (IPL). The aim of this study was to characterize, in detail, changes in the morphology of ganglion cells in the rd1 mouse retina well after rod photoreceptor death. We crossed a ganglion cell reporter mouse (Thy1-GFP [Feng et al., 2000]) with the rd1 mouse model of degeneration and quantified changes in ganglion dendritic morphology in the horizontal and vertical domain. Our results extend previous studies by analyzing four major cell classes of ganglion cells at three separate time points during degeneration. We show that there are changes in three of these cell classes particularly at advanced stages of degeneration (11 months of age). Evidence of remodeling of ganglion cells to new laminae within the IPL was also observed.
MATERIALS AND METHODS Animals All animal procedures were performed in accordance with the University of Melbourne Animal Experimentation Ethics Committee and with guidelines outlined by the National Health and Medical Research Council and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. rd1-Thy1 mice were obtained by crossing rd1 homozygous mice (Pde6brd1/Pde6brd1; originally obtained from Professor Debora Farber, University of California, Los Angeles, CA) with homozygous Thy1YFP/YFP mice (Line M, described by Feng et al. (2000); kindly donated by Associate Professor Anthony Hannan, Howard Florey Institute, Parkville, VIC, Australia). Control mice (Wt) were Thy1YFP/YFP mice. All mice were aged to 3, 6, or 11 months. To produce the animals for this study, Pde6brd1/ Pde6brd1 and Thy1YFP/YFP mice were backcrossed more than 10 generations onto C57Bl6J (ARC) mice obtained from the Animal Resource Centre (University of Western Australia), originally derived from C57Bl6J mice from the Jackson Laboratory (Bar Harbor, ME). These homozygous lines were intercrossed to produced heterozygous mice Pde6brd1/Pde6bwt/Thy1YFP/1 that were then further crossed to produce Pde6brd1/Pde6brd1/Thy1
1156
mice. To obtain experimental animals, Pde6brd1/ Pde6brd1/Thy1YFP/1 mice were crossed with Pde6brd1/ Pde6brd1 mice and control mice were Thy1YFP/YFP mice. We refer to these strains as rd1-Thy1 and Thy1-YFP mice. To verify that the number of labeled ganglion cells was similar in both strains of mice, we quantified the total number of labeled ganglion cells per retinal wholemount in 2-month-old Thy1YFP/YFP (n 5 8) mice and compared the number with Thy1YFP/1 mice (n 5 6). No difference in ganglion cell number was observed (Thy1YFP/YFP 5 64.1 6 8.9; Thy1YFP/1 5 59.8 6 3.8; F(1,12) 5 1.20, P 5 0.295). Genotyping was done by using primers specific for rd1 and Thy1-YFP. Three primers were used for rd1 genotyping: RDL, aagctagctgcagtaacgccat; RD2, atgtcctacagcccctctccaa; RD3 (mutant), acctgcatgtgaacccagtatt, which resulted in a 247-bp (wildtype) and 570-bp (mutant) product. For Thy1-YFP genotyping a primer pair specific to yellow fluorescent protein was used: eYFP-F: aagttcatctgcaccaccg; eYFP-R: tccttgaagaaga tggtgcg, which resulted in a 170-bp product.
Tissue collection and fixation Mice were deeply anesthetized with an intraperitoneal overdose of sodium pentobarbital (Nembutal; Merial Australia, Parramatta, NSW, Australia: 60 mg/ kg). Their eyes were removed and placed in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB), and the anterior eyecup and lens were removed. The posterior eyecup was left in 4% PFA for 30 minutes. Following fixation, the eyecup was washed in 0.1 M PB and then placed in 10% and 20% sucrose solutions in 0.1 M PB for 30 minutes each. The eyecup was placed in a 30% sucrose solution in 0.1 M PB overnight. Eyes were then snap-frozen in 30% sucrose on isopentane that was cooled by liquid nitrogen. Eyes were stored in a 280 C freezer until use.
Immunohistochemistry and antibody characterization Retinal wholemounts were incubated free floating for 3 nights at 4 C in rabbit anti-green fluorescent protein (GFP)–Alexa Fluor 488 (Invitrogen Australia, Mount Waverley, VIC, cat. #A21311) diluted at 1:500 and tyrosine hydroxylase (TH) (Millipore Australia, Kilsyth, VIC, cat. #MAB318) diluted to 1:1,000 in a buffer consisting of 3% normal goat serum, 1% bovine serum albumin, and 0.5% Triton X-100 in 0.1 M PB. Retinae were then washed in 0.1 M PB and coverslipped in mounting medium (DAKO, Carpinteria, CA). The antisera used in this study are listed in Table 1. Briefly, anti-green fluorescent protein conjugated to
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
TABLE 1. Primary Antibodies Used Antigen Green fluorescent protein (GFP) Tyrosine hydroxylase (TH)
Immunogen
Manufacturer, antibody details
Dilution
Green fluorescent protein from the jellyfish Aequorea victoria Tyrosine hydroxylase purified from PC12 cells
Invitrogen Australia, cat. #A11034, rabbit polyclonal Millipore Australia, cat. #MAB318, mouse monoclonal
1:500
Alexa Fluor 488 was used to enhance the detection of Thy1-YFP cells. This antibody targets GFP isolated directly from the jellyfish Aequorea victoria, purified by ion-exchange chromatography, and conjugated to green fluorescent Alexa Fluor 488 dye. It does not label cells in retinae from C57Bl6 mice, which lack expression of the GFP transgene (data not shown). Anti-TH was used to label dopaminergic amacrine cells and their processes (Versaux-Botteri et al., 1986; Witkovsky et al., 2006). This antibody is raised against the N-terminal region between amino acids 45 and 152 of rodent TH, and selectively recognized a single band of approximately 60 kDa by western blotting rat brain homogenates (Perez et al., 2002). Labeling for TH was used here to aid in determining the location of sublayer 1 of the IPL in retinal flatmounts.
Image capture Wholemount retinae were viewed on a confocal laser scanning microscope (LSM 510 PASCAL, Zeiss, Oberkochen, Germany), and images were captured at a resolution of 512 3 512 or 1,024 3 1,024 pixels by using Zeiss LSM image browser software and an appropriate fluorescence filter (Alexa TM 594/CY3: excitation 568 nm, emission filter 605/32 nm; Alexa TM 488/fluorescence isothiocyanate [FITC]: excitation 488 nm, emission filter 522/32 nm). Ganglion cells were assessed for inclusion in this study based on the presence on an axon and minimal dendritic interference with neighboring cells. Selected ganglion cells were imaged by obtaining a z-stack image (1 lm thickness) through the cell and processed by using either a 203 air objective or a 403 oil objective. All images were collated by using Adobe Photoshop Elements 8.0 (San Jose, CA).
Analyses Coverage analysis Ganglion cells were classed into groups based on their soma diameter, dendritic field diameter, and the morphology of their dendritic structure. The soma diameter was determined by fitting a circle to each soma and calculating the diameter of that circle. The dendritic field diameter was determined by calculating the area
1:1,000
of a polygon defined by joining the tips of each dendrite. The diameter of a circle defined by this calculated area was then the final dendritic field diameter. All calculations were performed using the software program ImageJ (an open source Java application, version 1.44p; National Institutes of Health, Bethesda, MD, available online at http://rsbweb.nih.gov/ij/). The morphology of the dendritic structure for each group was the same as that described by Sun et al. (2002b). The frequency of dendritic field sizes was analysed, and variances in the number of peaks in the rd1-Thy1 histogram distributions were determined to represent changes in dendritic field size when compared with Thy1 control retinae.
Stratification analysis The ramification of dendrites of each ganglion cell was classed into four main groups: 1) those ramifying in sublayer S1 of the IPL, “S1”; 2) those ramifying in sublayer S2–S4 of the IPL, “S2–S4”; 3) those ramifying in sublayer S5 of the IPL, “S5”; and 4) those ramifying in distinct sublayers, “bi”. Cells that had ramified in several layers, but only had one arbor, were classified based on where the majority of their dendrites were positioned. The margin of the inner nuclear layer and the IPL was determined by staining with an antibody against TH, and the sublayers of the IPL were determined from annotating the rotated z-stack images of each cell.
Fine dendritic structure analysis The fine dendritic structure of each ganglion cell was analyzed using Metamorph software (Molecular Devices, Sunnyvale, CA). Z-stack images of a single cell were compressed, and then axons were manually eliminated up to the dendritic field prior to analysis. This location was chosen so that the amount of dendritic field that would also be eliminated in the 2D compressed image was minimal. The dendritic structure of the cell was automatically traced based on the intensity of GFP labeling, and the total dendritic length, total dendritic area, and the number of branch points was calculated. Following this analysis, each ganglion cell tracing was manually checked for an unambiguous automated analysis based on the intensity of the image and dendritic
The Journal of Comparative Neurology | Research in Systems Neuroscience
1157
E.E. O’brien et al.
TABLE 2. Morphological Parameters of Retinal Ganglion Cells in the Mouse Retina1 Cell class Soma diameter Mean 6 SD (lm) Range (lm) Dendritic field diameter Mean 6 SD (lm) Range (lm)
A 22.4 6 2.2 14.5–31.4
B 16.3 6 2.3 7.9–21.9
C 18.5 6 2.6 11.1–31.2
D 17.3 6 1.9 13–25
E 22.1 6 1.1 20.5–24.2
322.9 6 55.3 193–523.8
172.1 6 24.3 97–259.8
245.7 6 39 115.4–369.7
204.7 6 39.9 111.6–355.3
188.4 6 21.1 150.9–231.2
1 The dendritic morphology descriptions given below are as previously described by Sun et al. (2002). A1 Polygonal cell body with 3–5 large primary dendrites A2 Round cell body with 4–7 primary dendrites that are branched repeatedly around the soma B1 Curvy but radially branching dendrites B2 Very small and dense dendritic field with spines B3 Curvy and recursive dendrites with a sparse dendritic field B4 Small dendritic field with many spines and protrusions C1 Smooth and recursive dendrites with medium density C2 Smooth and curved dendrites with a dense dendritic field C3 Large and sparse dendritic field C4 Curvy and spiny dendrites with a dense dendritic field C5 Medium density dendritic field that is similar to C1 C6 Smooth and curved dendrites with a dense dendritic field and all the dendrites oriented in one direction D Two distinct arbors E Curvy dendrites with medium density; large eccentricities at > 2 mm
overlapping with neighboring cells before it was included in this study.
Statistical analysis Two-way analysis of variances were used to test ganglion cell quantities and individual cell morphologies for diseased (rd1-Thy1) and not diseased (control, Thy1) mice at different ages (3, 6, and 11 months). The assumption of homogeneity in variances was assessed by using the Shapiro–Wilk test and, where violated, logarithmic or squared power transformations were performed. Differences between the mean responses were considered significant for P < 0.05. Where there were significant interaction terms, Tukey’s tests were used as post hoc pairwise comparisons to evaluate the differences between diseases at each age, as these comparisons were the most relevant to the aim of this study and when significant they are represented on the graphs using an asterisk. Where the interaction term was not significant, the main effect of disease was tested by pooling across all levels of age to determine the overall differences between control and disease and significant differences are highlighted using bold font. Statistical analyses were performed using SigmaStat (Aspire Software International, Ashburn, VA), and graphs were generated using Microsoft Excel 2007. All values are represented as mean 6 standard error of the mean.
1158
RESULTS Ganglion cell coverage We evaluated the morphological subtypes of ganglion cells in control and rd1-Thy1 retinae, using the classification of Sun et al. (2002b). Overall, there were 14 major morphological groups of ganglion cells present in the control and rd1-Thy1 retina (Table 2), and 1,060 ganglion cells were classified into these groups (Table 3). Each cell was initially classified into types A, B, C, D, or E based on their soma size, dendritic field size, and whether a cell had multiple arbors. All cells were then further divided into the 14 categories based on their dendritic appearance. This classification was independent of the stratification of processes within the IPL. Sun et al. (2002b) classified bistratified cells into groups D1 (thin and curvy dendrites) and D2 (medium density dendritic field). However, these classes were not unambiguously distinguishable in the control or rd1-Thy1 retina used for this study. Consequently, all bistratified cells were only grouped into a single class D. Similarly, Sun et al. (2002b) defined C5 cells as having medium density dendritic fields. However, in this study this class was not distinguishable from C1 in the control or rd1Thy1 retina, and ganglion cells were not classified into this group. The largest numbers of cells classified were A2, B1, C1, and D, and these groups are the main focus of this study (Table 3). An additional group, labeled E, was
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
TABLE 3. Number of Retinal Ganglion Cells Classified and Analyzed Based on Their Coverage and Stratification Over the Retina in Control (Thy1) and rd1-Thy1 Mice1 3 months Thy1 (N 5 4) Retinal ganglion cell type Coverage
Stratification
A1 A2 B1 B2 B3 B4 C1 C2 C3 C4 C5 C6 D E Total cells/age S1 S2–S4 S5 Bi Total cells/age
6 months
rd1-Thy1 (n 5 4)
Thy1 (n 5 4)
11 months
rd1-Thy1 (n 5 5)
Thy1 (n 5 4)
rd1-Thy1 (n 5 7)
C2
A3
C2
A3
C2
A3
C2
A3
C2
A3
C2
A3
4 12 28 4 6 3 56 11 14 5 – 2 36 5 186 25 100 23 36 184
3 10 21 4 2 2 37 9 7 3 – 2 23 5 128 20 65 14 23 122
6 3 8 2 2 4 42 7 9 2 – 4 38 – 127 20 59 12 38 129
5 3 3 2 2 3 24 4 6 2 – 3 25 – 82 17 28 10 25 80
6 29 24 6 10 4 27 18 13 4 – 3 22 10 176 40 86 28 22 176
3 12 11 2 4 3 14 11 5 2 – 3 7 6 83 24 39 13 7 83
9 31 15 5 5 2 27 15 17 2 – 5 39 – 167 19 68 46 39 172
6 21 5 4 3 2 11 6 4 2 – 3 20 – 87 8 37 22 20 87
16 27 27 2 4 4 52 12 13 2 – 5 46 8 218 41 99 35 46 221
7 17 13 2 3 4 24 4 3 2 – 5 26 5 115 20 49 18 26 113
9 17 23 2 6 2 68 12 19 2 – 7 19 – 186 22 101 41 19 183
9 13 14 2 2 2 38 5 7 2 – 6 10 – 110 12 55 31 10 108
Total RGCs classified for coverage 5 1,060 Total RGCs analyzed for coverage 5 605 Total RGCs classified for stratification 5 1,065 Total RGCs analyzed for stratification 5 593 1 Mice were 3, 6, and 11 months old, and whole-mount retinae were processed by using fluorescence immunohistochemistry. Ganglion cells were classified based on their coverage (soma and dendritic morphology) or stratification into the inner plexiform layer and analyzed for their dendritic structure. See Table 2 footnote. 2 C, classified; 3 A, analyzed.
identified in this study. These cells had large somata that were similar to group A, but small dendritic fields like group B. These cells were only identified in the control retina in limited quantities and were not present in the rd1-Thy1 retina at any age. All other cell types classified in the control retina were present in the rd1-Thy1 retina. Analysis of each ganglion cell was performed by examining the fine dendritic structure of each cell. Of the 1,060 classified ganglion cells, 605 were suitable for analysis as selected after automated analysis and determined by the intensity of Thy1 labeling and the extent of dendritic overlap between neighboring cells (Table 3). Overall, changes in morphology were observed at advanced stages of degeneration across the various ganglion cell types in rd1-Thy1 retinae compared with controls. Here, we describe findings for four ganglion cell types, which represent the most frequently encountered cell types. Class A2 showed significant changes in the rd1-Thy1 retina (Fig. 1). Overall, A2 cells in the
rd1-Thy1 retina had significant reductions in their coverage (total dendritic length and total dendritic area) and extent of branching (number of branch points). Statistically, the interaction of disease and age was significant for both the total dendritic length (Fig. 1C) and total dendritic area (Fig. 1D), and post hoc pairwise comparisons showed a significant reduction in these analysis parameters at 11 months. Several other cell classes were analyzed in a similar manner. Class B1 ganglion cells (Fig. 2) showed a significant decrease in their coverage in the rd1-Thy1 retina at 11 months (Fig. 2C,D) and an increase in the extent of branching at 3 months (Fig. 2E). Class C1 ganglion cells did not show any changes in the rd1-Thy1 retina compared with control retinae (Fig. 3). Class D ganglion cells showed significant changes in the rd1-Thy1 retina that were similar to classes A2 and B1 (Fig. 4). That being, the coverage and level of branching of D type ganglion cells showed a significant reduction in the rd1-Thy1 retinae at 11 months of age (Fig. 4C–E).
The Journal of Comparative Neurology | Research in Systems Neuroscience
1159
E.E. O’brien et al.
Figure 1. A2 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of A2 ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of A2 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in rd1-Thy1 retinae at 11 months of age and reduction in branch points at all ages examined. Scale bar 5 20 lm in B (applies to A,B).
Some studies have suggested that differences in ganglion cell morphology in rd1 mice compared with controls are more likely explained by developmental effects rather than photoreceptor degeneration because of the early onset of degeneration in rd1 mice (Damiani et al., 2012). To evaluate whether the morphological changes observed here could be attributed to developmental effects, we compared the dendritic field sizes for each
1160
of the four major ganglion cell types across three different ages. Figure 5 shows graphs of the frequency of cells for each dendritic field size encountered at three different ages. We reasoned that if ganglion cell morphology was affected by development, then a proportion of cells would show altered dendritic field size from 3 months of age. As shown in Figure 5, there were changes in the frequency distribution in rd1-Thy1
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 2. B1 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of B1 ganglion cells at 3 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of B1 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in B1 ganglion cells in rd1-Thy1 retinae at 11 months of age and an increase in the number of branch points at 3 months of age. Scale bar 5 20 lm (applies to A,B).
retinae at 3 and 11 months for A2 ganglion cells (Fig. 5A,C) and at 6 and 11 months for D ganglion cells (Fig. 5K,L). There were no significant changes in the frequency distributions of either B1 or C1 type ganglion cells (Fig. 5D–I). Notably, no differences in the frequency distribution in rd1-Thy1 compared with controls were noted at 3 months of age for B1, C1, or D type ganglion cells, and no difference in distribution was noted at 6 months for A2 ganglion cells. These findings
suggest that ganglion cells in the rd1-Thy1 develop normally despite the early onset of degeneration, and that the changes in ganglion cell morphology that were observed happened at a relatively late age (i. e., 11 months of age). In summary, the analysis performed here revealed that several ganglion cell classes were altered in the rd1-Thy1 retina. Specifically, A2, B1, and D type ganglion cells had a reduction in their coverage and level
The Journal of Comparative Neurology | Research in Systems Neuroscience
1161
E.E. O’brien et al.
Figure 3. C1 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of C1 ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of C1 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. Overall, there were no changes in C1 ganglion cells in rd1-Thy1 retinae at any age examined. Scale bar 5 20 lm in A,B.
of branching as animals aged. In comparison, C1 type ganglion cells did not show a significant change in their morphology.
Ganglion cell stratification in the inner plexiform layer A feature of late stages of degeneration is the formation of aberrant synapses in the inner retina (Jones et al., 2003a). Thus, we evaluated whether there was a change in the ramification of ganglion cell dendrites within the IPL.
1162
All ganglion cells (1,065 ganglion cells; Table 3) were classified based on the ramification of their processes within the IPL. In summary, ganglion cells were separated into those that ramified within S1, S2–S4, or S5 of the IPL or those that were bistratified. Each type of ganglion cell was evident in both the control retina and rd1-Thy1 retina at each age examined. However, there was a significant reduction in the number of S1 ganglion cells in the rd1-Thy1 retina compared with control retinae (Fig. 6C), and bistratified cells showed a significant increase at 6 months of age and a significant
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 4. D type ganglion cells in the control and rd1-Thy1 retina. A,B: Representative examples of D ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of D ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in D ganglion cells in rd1-Thy1 retinae at 11 months of age and a reduction in branch points at all ages examined. Scale bar 5 20 lm in A,B.
decrease in the proportion of these cells at 11 months (Fig. 6L). In contrast, there were no significant changes in the proportion of cells stratifying into S2–S4 or S5 in the rd1-Thy1 retinae (Fig. 6F,I). Next, we analyzed the dendritic morphology of each of these ganglion cells. Of the 1,065 classified ganglion cells, 593 were suitable for analysis (Table 3). Overall, ganglion cells stratifying into S1 and S2–S4 did not show significant changes in the rd1-Thy1 retina (Fig.
7A–F). The exception was the total dendritic length of S1 stratifying cells, which showed a significant increase in the rd1-Thy1 retina and may reflect active remodeling of these cells in response to the loss of inputs during degeneration. In contrast, there were significant changes in both S5 and bistratified ganglion cells in the rd1-Thy1 retina as both cell classes showed a significant decrease in their coverage across the retina at 11 months in the rd1-Thy1 retina (Fig. 7G–L).
The Journal of Comparative Neurology | Research in Systems Neuroscience
1163
E.E. O’brien et al.
Figure 5. Frequency distributions of the size of the dendritic field of ganglion cells in the control and rd1-Thy1 retina. A–L: Graphs showing the proportion of A2 (A–C), B1 (D–F), C1 (G–I), and D (J–L) ganglion cells with different dendritic field sizes in control and rd1-Thy1 retinae at 3, 6, and 11 months of age.
Changes in the processes of cells that ramified in S5 were noted at both 6 and 11 months in rd1-Thy1 retina. By definition, these cells have their dendritic arbor ramifying in strata S5 of the IPL. In control retinae, all dendrites ramify in S5, and none are located in S4 (Fig. 8A,D). In contrast, in rd1-Thy1 retinae, some ganglion cells, whose main dendritic arbor ramified in S5, also had a significant number of dendrites projecting to S4 (Fig. 8B,C,E,F). Of the 12 cells in the rd1-Thy1 retina that were identified with this stratification pattern, the mean number of ganglion cell dendrites repositioned in
1164
strata S4 was found to be 10.25 6 1.02 compared with 30.34 6 2.44, which were positioned in S5. This showed that 33.8% of ganglion cell dendrites were relocated into another strata in the IPL. In summary, analysis of the stratification of each ganglion cell revealed that changes were seen in the IPL of the degenerated retina. There was a significant reduction in ganglion cells that stratified into sublayer S1 of the rd1-Thy1 retina, and the remaining cells showed an increase in their coverage over the retina. Ganglion cells that stratified into stratum S5 showed a significant
The Journal of Comparative Neurology | Research in Systems Neuroscience
Figure 6. Ganglion cells classified by their stratification into the inner plexiform layer. Wholemount retinae were processed for fluorescence immunohistochemistry. Retinae were from control or rd1-Thy1 mice at 3, 6, and 11 months of age. A,D,G,J: Examples of each cell type. B,E,H,K: The rotated (vertical) view. C,F,I,L: The proportion of ganglion cells stratifying into each layer at 3, 6, and 11 months. A–C: Cells that stratified into S1. D–F: Cells that stratified into S2–4. G–I: Cells that stratified into S5. J–L: Cells that were bistratified. Scale bar 5 20 lm in [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.].
E.E. O’brien et al.
Figure 7. Analysis parameters of ganglion cells stratifying into the inner plexiform layer. A–L: Graphs showing the dendritic length, dendritic area, and number of branch points for cells ramifying in S1 (A–C), S2–S4 (D–F), S5 (G–I), and bistratified (J–L). In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in the total dendritic length and area of both bistratified cells and cells that ramified in S5 in rd1-Thy1 retinae at 11 months of age and a reduction in the number of branch points at all ages examined. No differences were noted in cells that ramified in layers S1–S4 of the inner plexiform layer.
reduction in coverage across the retina and some of their dendritic tips relocated into stratum S4. Bistratified ganglion cells showed significant changes particularly at 11 months with the reduction of their coverage across the retina. Interestingly, ganglion cells that stratified into strata S2–S4 had no significant changes in their quantity or morphology in the degenerated retina.
1166
DISCUSSION The results of this study indicate that there are changes in some classes of ganglion cells at advanced stages of degeneration in the rd1-Thy1 mouse model of retinal degeneration. Specifically, types A2, B1, and D ganglion cells showed a reduction in dendritic field size at 11 months of age, whereas type C1 did not show
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 8. Remodeling of ganglion cell dendrites into distal layers of the inner plexiform layer (IPL). Wholemount retinae were processed for fluorescence immunohistochemistry. A: An A-type ganglion cell from a 6-month-old control retina that has dendrites ramifying in S5. When the focus is shifted to S4 of the IPL, no processes are visible (D). B–F: Examples of an A-type ganglion cell from a 6-month and 11-month rd1-thy1 retina that is imaged in S5 and S4. In contrast to the control retina, A-type ganglion cells in the rd1-Thy1 retina have processes that ramify in both S5 and S4. G,H: Schematic representation of an A-type ganglion cell from the rd1-Thy1 retina that has dendrites ramifying in S5 (G) and S4 (H). The two schematic diagrams represent different focal planes of the same cell. I: Graph showing the number of A-type ganglion cells dendrites projecting to S4 or S5 of the IPL. Values are represented as mean 6 SEM. Scale bar 5 20 lm in A–F.
any changes. Additionally, there was a reduction in the proportion of cells stratifying in stratum S1 of the IPL as well as changes in the dendritic tips of some cells that ramified in stratum S5.
Morphological changes in subclasses of ganglion cells in aged rd1-Thy1 retinae We observed a reduction in dendritic area in rd1Thy1 at 11 months of age for A2, B1, and D type ganglion cells. Our results are consistent with those of previous studies (Damiani et al., 2012; Grafstei et al.,
1972; Mazzoni et al., 2008). Specifically, a 10% reduction in the dendritic field area was reported in 3–6month-old animals, with the 20 largest cells showing a 20% reduction (Grafstei et al., 1972). Although Grafstei et al. (1972) did not classify ganglion cells, the largest cells they describe are most likely similar to the type A ganglion cells described in our study. Damiani et al. (2012) analyzed B3 and C2 cells in rd1 and control retina, and noted a significant decrease in the total dendritic area of B3 cells from as early as 1 month of age, together with changes in their branching. Owing to differences in the classification of ganglion cells (notably,
The Journal of Comparative Neurology | Research in Systems Neuroscience
1167
E.E. O’brien et al.
the interpretation of the description of the branching features of B and C type ganglion cells reported in the study by Sun et al. [2002b]), the results of Damiani et al. (2012) should be compared with those of our study for the findings for B1 and C1 ganglion cells. Damiani et al. (2012) also showed a 50% reduction in the dendritic field size of half of the analyzed B3 and C2 type cells in animals aged 4–12 months, which the authors attributed to the early onset of degeneration in the rd1 model (Damiani et al., 2012). This finding was not replicated in our study for any of the A2, B1, C1, or D cells. It is not clear why the findings of Damiani et al. (2012) were not replicated in our study. It is possible that differences in the selective labeling of YFP in ganglion cells in the Thy1-YFP reporter mouse might contribute to these differences (Feng et al., 2000). In contrast to the results described in this study, and those of Grafstei et al. (1972) and Damiani et al. (2012), no changes in ganglion cell morphology were reported at late stages of degeneration in the rd1 (Lin and Peng, 2013) and rd10 (Mazzoni et al., 2008) mouse models of retinal degeneration. These differences might be attributed to either the method used in these studies or the genetic differences between the strains. The study with the rd1 mouse model of degeneration used relatively small samples sizes (Lin and Peng, 2013) compared with the current study. The study using the rd10 model of retinal degeneration could be impacted by genetic differences between the strains (Mazzoni et al., 2008) as the rd10 model has a later onset of degeneration and a much slower rate of photoreceptor loss than the rd1 model (Chang et al., 2007; Gargini et al., 2007). Consequently, the differences in both sampling biases and genetics in these studies may impact on the previously mentioned changes in the rd1 model of retinal degeneration. In addition to changes in the dendritic field area described here, we also noted changes in the proportion and morphology of cells ramifying in different sublayers of the IPL. In particular, there was a reduction in the proportion of cells ramifying in S1 and there were also changes in the proportion of bistratified ganglion cells at 6 and 11 months. We considered whether the change in the proportion of cells ramifying in S1 could be explained by the retraction of processes, as happens at early stages of degeneration in bipolar cells (Strettoi and Pignatelli, 2000). However, if this were the case, a commensurate increase in cells ramifying in S2–S4 or S5 where they might retract to, should have been noted. Alternatively, the reduction in the proportion of cells ramifying in different layers may also be from hypertrophic glial processes in these regions (Jones et al., 2003b; Marc et al., 2003b). Analysis of the dendrites of cells ramifying in S5 revealed that some cells
1168
extended processes into more distal layers of the IPL. These findings suggest that active remodeling of ganglion cell dendrites occurs for some ganglion cell subtypes at late stages of degeneration. A major caveat of performing any classification with a healthy and diseased model is whether the same classified groups are present in each model. In this study, as in previous reports, all subtypes of ganglion cells were observed in both control mice and those with retinal degenerations (Badea and Nathans, 2004; Damiani et al., 2012; Mazzoni et al., 2008). Indeed, the morphological changes described in our study were restricted to four classes, and on the whole were small.
What functional alterations could be associated with morphological changes in ganglion cells? Ideally, correlating the morphological changes described here with functional changes requires electrophysiological tools that use retinae at late stages of degeneration. Such studies have shown that there are functional changes in ganglion cells in terms of their excitability (Jensen and Rizzo, 2008; O’Hearn et al., 2006; Suzuki et al., 2004; Ye and Goo, 2007) as well as their spontaneous firing (Margolis et al., 2008; Sekirnjak et al., 2011). It is important to note that these studies used animals primarily at early stages of degeneration, and there are limited electrophysiology data derived from aged retinae (>3 months) due to difficulties with dissecting a very thin retina (Margolis et al., 2008). Several studies have shown that stimulating ganglion cells in the rd1 retina requires higher current levels to elicit an action potential (Jensen and Rizzo, 2008; O’Hearn et al., 2006; Suzuki et al., 2004; Ye and Goo, 2007). These changes in the degenerated retina have been attributed to both the remodeled circuitry as well as the intrinsic properties of ganglion cells (Margolis et al., 2008; Sekirnjak et al., 2011). We have observed morphological changes in the dendritic arbor at late stages of degeneration of several cell types. This change in dendritic pattern most likely directly reflects the remodeled circuitry altering the synaptic inputs of each ganglion cell. Studies have shown that ganglion cell dendrites in the normal retina have similar patterns of excitatory inputs regard1ess of ganglion cell type (Jakobs et al., 2008; Xu et al., 2008) with the density of excitatory inputs found to be 19 6 1 contacts/100 lm2 membrane in the normal guinea pig retina (Xu et al., 2008). If one assumes that excitatory synaptic inputs follow a similar pattern in the mouse retina compared with the guinea pig retina, then the decreased dendritic
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
field size described in this study could explain some of the functional changes that have been reported in electrophysiology studies (Margolis et al., 2008; Sekirnjak et al., 2011). For instance, a smaller dendritic field size may lead to less excitatory synapses on a cell, which may cause an increase in the required stimulus to elicit an action potential. Quantification of this in the rd1 retina in late stages of degeneration is an area requiring further investigation. The decrease in dendritic field size may lead to changes in intrinsic properties of each ganglion cell by altering the ion channels located along the membrane. Sodium, potassium, and calcium ion channels are known to regulate ganglion cell action potentials (Sernagor et al., 2001), and decreasing the size of dendrites, and potentially the distribution and density of ion channels, most likely explains the increase in spontaneous activity seen in the degenerated retina (Margolis et al., 2008; Sekirnjak et al., 2011). Quantification of the ion channels located on the dendrites of rd1 retina in late stages of degeneration is another area requiring further investigation. In conclusion, this study showed that there are morphological changes in some classes of ganglion cells in the rd1-Thy1 retina at an advanced stage of retinal degeneration. Overall, there was a decrease in the size and the number of branching points of A2, B1, and D type ganglion cells whereas there was a preservation of morphology of C1 cells. Changes in the ramification of ganglion cell dendrites were noted for cells ramifying in S1. There was also rearrangement of branches of cells normally stratifying into S5 that relocated their dendrites into more distal regions of the IPL. Overall, our results indicate that there are changes in the morphology of some ganglion cells at advanced stages of retinal degeneration in the rd1 mouse model that could have an impact on the function of those cells.
ACKNOWLEDGMENTS The authors are grateful to Cameron Nowell for assistance in using metamorph software and to A/Prof. Tony Hannan for donating the Thy1-YFP mice.
CONFLICT OF INTEREST STATEMENT The authors have no conflicts of interests to report.
ROLE OF AUTHORS All authors had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. EEO, UG, and ELF designed the overall study; EEO undertook data collection and core analysis; ELF and UG gener-
ated article sections, did analysis, and contributed substantial revisions; EEO, UG, and ELF generated the primary article and performed the revision.
LITERATURE CITED Badea TC, Nathans J. 2004. Quantitative analysis of neuronal morphologies in the mouse retina visualized by using a genetically directed reporter. J Comp Neurol 480:331– 351. Chang B, Hawes NL, Pardue MT, German AM, Hurd RE, Davisson MT, Nusinowitz S, Rengarajan K, Boyd AP, Sidney SS, Phillips MJ, Stewart RE, Chaudhury R, Nickerson JM, Heckenlively JR, Boatright JH. 2007. Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. Vis Res 47:624–633. Damiani D, Novelli E, Mazzoni F, Strettoi E. 2012. Undersized dendritic arborizations in retinal ganglion cells of the rd1 mutant mouse, a paradigm of early-onset photoreceptor degeneration. J Comp Neurol 520:1406–1423. Feng GP, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. 2000. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron 28:41–51. Gargini C, Terzibasi E, Mazzoni F, Strettoi E. 2007. Retinal organization in the retinal degeneration 10 (rd10) mutant mouse: a morphological and ERG study. J Comp Neurol 500:222–238. Grafstei B, Murray M, Ingoglia NA. 1972. Protein-synthesis and axonal transport in retinal ganglion-cells of mice lacking visual receptors. Brain Res 44:37–&. Jakobs TC, Koizumi A, Masland RH. 2008. The spatial distribution of glutamatergic inputs to dendrites of retinal ganglion cells. J Comp Neurol 510:221–236. Jensen RJ, Rizzo JF. 2008. Activation of retinal ganglion cells in wild-type and rd1 mice through electrical stimulation of the retinal neural network. Vis Res 48:1562–1568. Jones BW, Watt CB, Frederick JM, Baehr W, Chen CK, Levine EM, Milam AH, Lavail MM, Marc RE. 2003a. Retinal remodeling triggered by photoreceptor degenerations. J Comp Neurol 464:1–16. Jones BW, Watt CB, Frederick JM, Baehr W, Chen CK, Levine EM, Milam AH, Lavail MM, Marc RE. 2003b. Retinal remodeling triggered by photoreceptor degenerations. J Comp Neurol 464:1–16. Lin B, Peng E. 2013. Retinal ganglion cells are resistant to photoreceptor loss in retinal degeneration. PLoS One8: e68084. Marc RE, Jones BW, Watt CB, Strettoi E. 2003a. Neural remodeling in retinal degeneration. Prog Retin Eye Res 22:607–655. Marc RE, Jones BW, Watt CB, Strettoi E. 2003b. Neural remodeling in retinal degeneration. Prog Retin Eye Res 22:607–655. Margolis DJ, Newkirk G, Euler T, Detwiler PB. 2008. Functional stability of retinal ganglion cells after degeneration-induced changes in synaptic input. J Neurosci 28:6526–6536. Mazzoni F, Novelli E, Strettoi E. 2008. Retinal ganglion cells survive and maintain normal dendritic morphology in a mouse model of inherited photoreceptor degeneration. J Neurosci 28:14282–14292. O’Hearn TM, Sadda SR, Weiland JD, Maia M, Margalit E, Humayun MS. 2006. Electrical stimulation in normal and retinal degeneration (rd1) isolated mouse retina. Vis Res 46:3198–3204. Peng YW, Hao Y, Petters RM, Wong F. 2000. Ectopic synaptogenesis in the mammalian retina caused by rod
The Journal of Comparative Neurology | Research in Systems Neuroscience
1169
E.E. O’brien et al.
photoreceptor-specific mutations. Nat Neurosci 3:1121– 1127. Perez RG, Waymire JC, Lin E, Liu JJ, Guo FL, Zigmond MJ. 2002. A role for alpha-synuclein in the regulation of dopamine biosynthesis. J Neurosci 22:3090–3099. Santos A, Humayun MS, deJuan E, Greenburg RJ, Marsh MJ, Klock IB, Milam AH. 1997. Preservation of the inner retina in retinitis pigmentosa —a morphometric analysis. Arch Ophthalmol 115:511–515. Sekirnjak C, Jepson LH, Hottowy P, Sher A, Dabrowski W, Litke AM, Chichilnisky EJ. 2011. Changes in physiological properties of rat ganglion cells during retinal degeneration. J Neurophysiol 105:2560–2571. Sernagor E, Eglen SJ, Wong ROL. 2001. Development of retinal ganglion cell structure and function. Prog Retin Eye Res 20:139–174. Strettoi E, Pignatelli V. 2000. Modifications of retinal neurons in a mouse model of retinitis pigmentosa. Proc Natl Acad Sci U S A 97:11020–11025. Strettoi E, Porciatti V, Falsini B, Pignatelli V, Rossi C. 2002. Morphological and functional abnormalities in the inner retina of the rd/rd mouse. J Neurosci 22:5492–5504. Strettoi E, Pignatelli V, Rossi C, Porciatti V, Falsini B. 2003. Remodeling of second-order neurons in the retina of rd/ rd mutant mice. Vis Res 4:867–877.
1170
Sun W, Li N, He S. 2002a. Large-scale morphological survey of mouse retinal ganglion cells. Visual Neuroscience 19(4):483–449. Sun W, Li N, He S. 2002b. Large-scale morphological survey of mouse retinal ganglion cells. J Comp Neurol 451(2): 115–126. Suzuki S, Humayun MS, Weiland JD, Chen SJ, Margalit E, Piyathaisere DV, de Juan E. 2004. Comparison of electrical stimulation thresholds in normal and retinal degenerated mouse retina. Jpn J Ophthalmol 48:345–349. Versauxbotteri C, Martinmartinelli E, Nguyenlegros J, Geffard M, Vigny A, Denoroy L. 1986. Regional specialization of the rat retina: catecholamine-containing amacrine cell characterization and distribution. J Comp Neurol 243: 422–433. Witkovsky P, Shen CP, McRory J. 2006. Differential distribution of voltage-gated calcium channels in dopaminergic neurons of the rat retina. J Comp Neurol 497:384–396. Xu Y, Vasudeva V, Vardi N, Sterling P, Freed MA. 2008. Different types of ganglion cell share a synaptic pattern. J Comp Neurol 507:1871–1878. Ye JH, Goo YS. 2007. Comparison of voltage parameters for the stimulation of normal and degenerate retina. 2007 Annual International Conference of the IEEE Engineering in Medicine and Biology Society, Vols 1–16. New York: IEEE. p 5783–5786.
The Journal of Comparative Neurology | Research in Systems Neuroscience
The Effect of Photoreceptor Degeneration on Ganglion Cell Morphology E.E. O’Brien, U. Greferath, and E.L. Fletcher* Department of Anatomy and Neuroscience, University of Melbourne, Melbourne, Victoria 3010 Australia
ABSTRACT Retinitis pigmentosa refers to a family of inherited photoreceptor degenerations resulting in blindness. During and after photoreceptor loss, neurons of the inner retina are known to undergo plastic changes. Here, we have investigated in detail whether ganglion cells are altered at late stages of degeneration, well after the total loss of photoreceptors. We used mice, rd1-Thy1, that carry a mutation in the b-subunit of phosphodiesterase 6 and a fluorescent protein that labels a subset of ganglion cells and B6-Thy1 control mice. Retinal wholemounts from mice aged 3–11 months were processed for immunohistochemistry and analyzed. Ganglion cells were classified based on soma area, dendritic field size, and branching of dendrites. The dendritic fields of
some ganglion cells were further analyzed for their length, area and quantity of branching points. There was a decrease in size and level of branching of A2, B1, and D type ganglion cells in the degenerated retina at 11 months of age. In contrast, C1 ganglion cells remained unchanged. In addition, there was a shift in the proportion of ganglion cells ramifying in the different layers of the inner plexiform layer. Careful analysis of the dendrites of ganglion cells revealed some projecting to new, more distal regions of the inner plexiform layer. We propose that these changes in ganglion cell morphology could impact the function of individual cells as well as the retinal circuitry in the degenerated retina. J. Comp. Neurol. 522:1155–1170, 2014. C 2013 Wiley Periodicals, Inc. V
INDEXING TERMS: ganglion cell; retinitis pigmentosa; plasticity; retina; inner plexiform layer
Over recent years there has been a surge of interest in vision-restoring therapies that replace the function of dead or dying photoreceptors in those with inherited retinal degenerations. For any of these treatments to succeed, a basic requirement is that ganglion cells remain functionally intact, and capable of passing visual information from the retina to higher visual centers. However, it is now known that as a consequence of photoreceptor progressive loss, neurons of the inner retina undergo considerable plastic changes or remodeling (Jones et al., 2003a; Marc et al., 2003a; Strettoi and Pignatelli, 2000; Strettoi et al., 2002, 2003). Among the changes that develop following photoreceptor death, neurons of the inner retina seek new synaptic partners, forming aberrant and/or ectopic synapses (Jones et al., 2003a; Marc et al., 2003a; Peng et al., 2000). In addition, one study has shown that there can be loss of up to 70% of ganglion cells in late stages of retinitis pigmentosa (Santos et al., 1997). Functional changes in ganglion cells have also been reported in a number of animal models of retinal degeneration from relatively early stages of degeneration C 2013 Wiley Periodicals, Inc. V
(Margolis et al., 2008; O’Hearn et al., 2006; Sekirnjak et al., 2011; Suzuki et al., 2004; Ye and Goo, 2007). In line with the remodeling and functional changes reported, several studies have evaluated ganglion morphology during degeneration (Damiani et al., 2012; Grafstei et al., 1972; Lin and Peng, 2013; Mazzoni et al., 2008). These studies used two different mouse models of retinal degeneration (rd1 and rd10) that carry mutations in the gene encoding phosphodiesterase, but that manifest photoreceptor loss at different ages. Previous work examining ganglion cell morphology in the rd1 retina have shown a 10% reduction in dendritic field size (Grafstei et al., 1972) with two particular ganglion cell
Grant sponsor: National Health and Medical Research Council; Grant number: APP1021042; Grant sponsor: Retina Australia; Grant sponsor: the Australian Research Council, through its Special Research Initiative in Bionic Vision Science and Technology grant to Bionic Vision Australia. *Address correspondence to: Erica Fletcher, Department of Anatomy and Neuroscience, University of Melbourne, Victoria, 3010 Australia. E-mail: [email protected] Received July 29, 2013; Revised September 23, 2013; Accepted October 2, 2013. DOI 10.1002/cne.23487 Published online October 31, 2013 in Wiley (wileyonlinelibrary.com)
Online
The Journal of Comparative Neurology | Research in Systems Neuroscience 522:1155–1170 (2014)
Library
1155
E.E. O’brien et al.
types showing a 50% reduction in dendritic field sizes in half of the sample size (Damiani et al., 2012). In contrast, a study examining ganglion cells in the rd10 mouse model of degeneration did not find any changes in the morphology in any of the 14 types of ganglion cells analyzed (Mazzoni et al., 2008). It should be noted, however, that these studies mostly focused on morphology of ganglion cell dendrites in a horizontal domain. Little information is available about detailed changes in morphology of ganglion cells that project to the various sublaminae of the inner plexiform layer (IPL). The aim of this study was to characterize, in detail, changes in the morphology of ganglion cells in the rd1 mouse retina well after rod photoreceptor death. We crossed a ganglion cell reporter mouse (Thy1-GFP [Feng et al., 2000]) with the rd1 mouse model of degeneration and quantified changes in ganglion dendritic morphology in the horizontal and vertical domain. Our results extend previous studies by analyzing four major cell classes of ganglion cells at three separate time points during degeneration. We show that there are changes in three of these cell classes particularly at advanced stages of degeneration (11 months of age). Evidence of remodeling of ganglion cells to new laminae within the IPL was also observed.
MATERIALS AND METHODS Animals All animal procedures were performed in accordance with the University of Melbourne Animal Experimentation Ethics Committee and with guidelines outlined by the National Health and Medical Research Council and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. rd1-Thy1 mice were obtained by crossing rd1 homozygous mice (Pde6brd1/Pde6brd1; originally obtained from Professor Debora Farber, University of California, Los Angeles, CA) with homozygous Thy1YFP/YFP mice (Line M, described by Feng et al. (2000); kindly donated by Associate Professor Anthony Hannan, Howard Florey Institute, Parkville, VIC, Australia). Control mice (Wt) were Thy1YFP/YFP mice. All mice were aged to 3, 6, or 11 months. To produce the animals for this study, Pde6brd1/ Pde6brd1 and Thy1YFP/YFP mice were backcrossed more than 10 generations onto C57Bl6J (ARC) mice obtained from the Animal Resource Centre (University of Western Australia), originally derived from C57Bl6J mice from the Jackson Laboratory (Bar Harbor, ME). These homozygous lines were intercrossed to produced heterozygous mice Pde6brd1/Pde6bwt/Thy1YFP/1 that were then further crossed to produce Pde6brd1/Pde6brd1/Thy1
1156
mice. To obtain experimental animals, Pde6brd1/ Pde6brd1/Thy1YFP/1 mice were crossed with Pde6brd1/ Pde6brd1 mice and control mice were Thy1YFP/YFP mice. We refer to these strains as rd1-Thy1 and Thy1-YFP mice. To verify that the number of labeled ganglion cells was similar in both strains of mice, we quantified the total number of labeled ganglion cells per retinal wholemount in 2-month-old Thy1YFP/YFP (n 5 8) mice and compared the number with Thy1YFP/1 mice (n 5 6). No difference in ganglion cell number was observed (Thy1YFP/YFP 5 64.1 6 8.9; Thy1YFP/1 5 59.8 6 3.8; F(1,12) 5 1.20, P 5 0.295). Genotyping was done by using primers specific for rd1 and Thy1-YFP. Three primers were used for rd1 genotyping: RDL, aagctagctgcagtaacgccat; RD2, atgtcctacagcccctctccaa; RD3 (mutant), acctgcatgtgaacccagtatt, which resulted in a 247-bp (wildtype) and 570-bp (mutant) product. For Thy1-YFP genotyping a primer pair specific to yellow fluorescent protein was used: eYFP-F: aagttcatctgcaccaccg; eYFP-R: tccttgaagaaga tggtgcg, which resulted in a 170-bp product.
Tissue collection and fixation Mice were deeply anesthetized with an intraperitoneal overdose of sodium pentobarbital (Nembutal; Merial Australia, Parramatta, NSW, Australia: 60 mg/ kg). Their eyes were removed and placed in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB), and the anterior eyecup and lens were removed. The posterior eyecup was left in 4% PFA for 30 minutes. Following fixation, the eyecup was washed in 0.1 M PB and then placed in 10% and 20% sucrose solutions in 0.1 M PB for 30 minutes each. The eyecup was placed in a 30% sucrose solution in 0.1 M PB overnight. Eyes were then snap-frozen in 30% sucrose on isopentane that was cooled by liquid nitrogen. Eyes were stored in a 280 C freezer until use.
Immunohistochemistry and antibody characterization Retinal wholemounts were incubated free floating for 3 nights at 4 C in rabbit anti-green fluorescent protein (GFP)–Alexa Fluor 488 (Invitrogen Australia, Mount Waverley, VIC, cat. #A21311) diluted at 1:500 and tyrosine hydroxylase (TH) (Millipore Australia, Kilsyth, VIC, cat. #MAB318) diluted to 1:1,000 in a buffer consisting of 3% normal goat serum, 1% bovine serum albumin, and 0.5% Triton X-100 in 0.1 M PB. Retinae were then washed in 0.1 M PB and coverslipped in mounting medium (DAKO, Carpinteria, CA). The antisera used in this study are listed in Table 1. Briefly, anti-green fluorescent protein conjugated to
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
TABLE 1. Primary Antibodies Used Antigen Green fluorescent protein (GFP) Tyrosine hydroxylase (TH)
Immunogen
Manufacturer, antibody details
Dilution
Green fluorescent protein from the jellyfish Aequorea victoria Tyrosine hydroxylase purified from PC12 cells
Invitrogen Australia, cat. #A11034, rabbit polyclonal Millipore Australia, cat. #MAB318, mouse monoclonal
1:500
Alexa Fluor 488 was used to enhance the detection of Thy1-YFP cells. This antibody targets GFP isolated directly from the jellyfish Aequorea victoria, purified by ion-exchange chromatography, and conjugated to green fluorescent Alexa Fluor 488 dye. It does not label cells in retinae from C57Bl6 mice, which lack expression of the GFP transgene (data not shown). Anti-TH was used to label dopaminergic amacrine cells and their processes (Versaux-Botteri et al., 1986; Witkovsky et al., 2006). This antibody is raised against the N-terminal region between amino acids 45 and 152 of rodent TH, and selectively recognized a single band of approximately 60 kDa by western blotting rat brain homogenates (Perez et al., 2002). Labeling for TH was used here to aid in determining the location of sublayer 1 of the IPL in retinal flatmounts.
Image capture Wholemount retinae were viewed on a confocal laser scanning microscope (LSM 510 PASCAL, Zeiss, Oberkochen, Germany), and images were captured at a resolution of 512 3 512 or 1,024 3 1,024 pixels by using Zeiss LSM image browser software and an appropriate fluorescence filter (Alexa TM 594/CY3: excitation 568 nm, emission filter 605/32 nm; Alexa TM 488/fluorescence isothiocyanate [FITC]: excitation 488 nm, emission filter 522/32 nm). Ganglion cells were assessed for inclusion in this study based on the presence on an axon and minimal dendritic interference with neighboring cells. Selected ganglion cells were imaged by obtaining a z-stack image (1 lm thickness) through the cell and processed by using either a 203 air objective or a 403 oil objective. All images were collated by using Adobe Photoshop Elements 8.0 (San Jose, CA).
Analyses Coverage analysis Ganglion cells were classed into groups based on their soma diameter, dendritic field diameter, and the morphology of their dendritic structure. The soma diameter was determined by fitting a circle to each soma and calculating the diameter of that circle. The dendritic field diameter was determined by calculating the area
1:1,000
of a polygon defined by joining the tips of each dendrite. The diameter of a circle defined by this calculated area was then the final dendritic field diameter. All calculations were performed using the software program ImageJ (an open source Java application, version 1.44p; National Institutes of Health, Bethesda, MD, available online at http://rsbweb.nih.gov/ij/). The morphology of the dendritic structure for each group was the same as that described by Sun et al. (2002b). The frequency of dendritic field sizes was analysed, and variances in the number of peaks in the rd1-Thy1 histogram distributions were determined to represent changes in dendritic field size when compared with Thy1 control retinae.
Stratification analysis The ramification of dendrites of each ganglion cell was classed into four main groups: 1) those ramifying in sublayer S1 of the IPL, “S1”; 2) those ramifying in sublayer S2–S4 of the IPL, “S2–S4”; 3) those ramifying in sublayer S5 of the IPL, “S5”; and 4) those ramifying in distinct sublayers, “bi”. Cells that had ramified in several layers, but only had one arbor, were classified based on where the majority of their dendrites were positioned. The margin of the inner nuclear layer and the IPL was determined by staining with an antibody against TH, and the sublayers of the IPL were determined from annotating the rotated z-stack images of each cell.
Fine dendritic structure analysis The fine dendritic structure of each ganglion cell was analyzed using Metamorph software (Molecular Devices, Sunnyvale, CA). Z-stack images of a single cell were compressed, and then axons were manually eliminated up to the dendritic field prior to analysis. This location was chosen so that the amount of dendritic field that would also be eliminated in the 2D compressed image was minimal. The dendritic structure of the cell was automatically traced based on the intensity of GFP labeling, and the total dendritic length, total dendritic area, and the number of branch points was calculated. Following this analysis, each ganglion cell tracing was manually checked for an unambiguous automated analysis based on the intensity of the image and dendritic
The Journal of Comparative Neurology | Research in Systems Neuroscience
1157
E.E. O’brien et al.
TABLE 2. Morphological Parameters of Retinal Ganglion Cells in the Mouse Retina1 Cell class Soma diameter Mean 6 SD (lm) Range (lm) Dendritic field diameter Mean 6 SD (lm) Range (lm)
A 22.4 6 2.2 14.5–31.4
B 16.3 6 2.3 7.9–21.9
C 18.5 6 2.6 11.1–31.2
D 17.3 6 1.9 13–25
E 22.1 6 1.1 20.5–24.2
322.9 6 55.3 193–523.8
172.1 6 24.3 97–259.8
245.7 6 39 115.4–369.7
204.7 6 39.9 111.6–355.3
188.4 6 21.1 150.9–231.2
1 The dendritic morphology descriptions given below are as previously described by Sun et al. (2002). A1 Polygonal cell body with 3–5 large primary dendrites A2 Round cell body with 4–7 primary dendrites that are branched repeatedly around the soma B1 Curvy but radially branching dendrites B2 Very small and dense dendritic field with spines B3 Curvy and recursive dendrites with a sparse dendritic field B4 Small dendritic field with many spines and protrusions C1 Smooth and recursive dendrites with medium density C2 Smooth and curved dendrites with a dense dendritic field C3 Large and sparse dendritic field C4 Curvy and spiny dendrites with a dense dendritic field C5 Medium density dendritic field that is similar to C1 C6 Smooth and curved dendrites with a dense dendritic field and all the dendrites oriented in one direction D Two distinct arbors E Curvy dendrites with medium density; large eccentricities at > 2 mm
overlapping with neighboring cells before it was included in this study.
Statistical analysis Two-way analysis of variances were used to test ganglion cell quantities and individual cell morphologies for diseased (rd1-Thy1) and not diseased (control, Thy1) mice at different ages (3, 6, and 11 months). The assumption of homogeneity in variances was assessed by using the Shapiro–Wilk test and, where violated, logarithmic or squared power transformations were performed. Differences between the mean responses were considered significant for P < 0.05. Where there were significant interaction terms, Tukey’s tests were used as post hoc pairwise comparisons to evaluate the differences between diseases at each age, as these comparisons were the most relevant to the aim of this study and when significant they are represented on the graphs using an asterisk. Where the interaction term was not significant, the main effect of disease was tested by pooling across all levels of age to determine the overall differences between control and disease and significant differences are highlighted using bold font. Statistical analyses were performed using SigmaStat (Aspire Software International, Ashburn, VA), and graphs were generated using Microsoft Excel 2007. All values are represented as mean 6 standard error of the mean.
1158
RESULTS Ganglion cell coverage We evaluated the morphological subtypes of ganglion cells in control and rd1-Thy1 retinae, using the classification of Sun et al. (2002b). Overall, there were 14 major morphological groups of ganglion cells present in the control and rd1-Thy1 retina (Table 2), and 1,060 ganglion cells were classified into these groups (Table 3). Each cell was initially classified into types A, B, C, D, or E based on their soma size, dendritic field size, and whether a cell had multiple arbors. All cells were then further divided into the 14 categories based on their dendritic appearance. This classification was independent of the stratification of processes within the IPL. Sun et al. (2002b) classified bistratified cells into groups D1 (thin and curvy dendrites) and D2 (medium density dendritic field). However, these classes were not unambiguously distinguishable in the control or rd1-Thy1 retina used for this study. Consequently, all bistratified cells were only grouped into a single class D. Similarly, Sun et al. (2002b) defined C5 cells as having medium density dendritic fields. However, in this study this class was not distinguishable from C1 in the control or rd1Thy1 retina, and ganglion cells were not classified into this group. The largest numbers of cells classified were A2, B1, C1, and D, and these groups are the main focus of this study (Table 3). An additional group, labeled E, was
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
TABLE 3. Number of Retinal Ganglion Cells Classified and Analyzed Based on Their Coverage and Stratification Over the Retina in Control (Thy1) and rd1-Thy1 Mice1 3 months Thy1 (N 5 4) Retinal ganglion cell type Coverage
Stratification
A1 A2 B1 B2 B3 B4 C1 C2 C3 C4 C5 C6 D E Total cells/age S1 S2–S4 S5 Bi Total cells/age
6 months
rd1-Thy1 (n 5 4)
Thy1 (n 5 4)
11 months
rd1-Thy1 (n 5 5)
Thy1 (n 5 4)
rd1-Thy1 (n 5 7)
C2
A3
C2
A3
C2
A3
C2
A3
C2
A3
C2
A3
4 12 28 4 6 3 56 11 14 5 – 2 36 5 186 25 100 23 36 184
3 10 21 4 2 2 37 9 7 3 – 2 23 5 128 20 65 14 23 122
6 3 8 2 2 4 42 7 9 2 – 4 38 – 127 20 59 12 38 129
5 3 3 2 2 3 24 4 6 2 – 3 25 – 82 17 28 10 25 80
6 29 24 6 10 4 27 18 13 4 – 3 22 10 176 40 86 28 22 176
3 12 11 2 4 3 14 11 5 2 – 3 7 6 83 24 39 13 7 83
9 31 15 5 5 2 27 15 17 2 – 5 39 – 167 19 68 46 39 172
6 21 5 4 3 2 11 6 4 2 – 3 20 – 87 8 37 22 20 87
16 27 27 2 4 4 52 12 13 2 – 5 46 8 218 41 99 35 46 221
7 17 13 2 3 4 24 4 3 2 – 5 26 5 115 20 49 18 26 113
9 17 23 2 6 2 68 12 19 2 – 7 19 – 186 22 101 41 19 183
9 13 14 2 2 2 38 5 7 2 – 6 10 – 110 12 55 31 10 108
Total RGCs classified for coverage 5 1,060 Total RGCs analyzed for coverage 5 605 Total RGCs classified for stratification 5 1,065 Total RGCs analyzed for stratification 5 593 1 Mice were 3, 6, and 11 months old, and whole-mount retinae were processed by using fluorescence immunohistochemistry. Ganglion cells were classified based on their coverage (soma and dendritic morphology) or stratification into the inner plexiform layer and analyzed for their dendritic structure. See Table 2 footnote. 2 C, classified; 3 A, analyzed.
identified in this study. These cells had large somata that were similar to group A, but small dendritic fields like group B. These cells were only identified in the control retina in limited quantities and were not present in the rd1-Thy1 retina at any age. All other cell types classified in the control retina were present in the rd1-Thy1 retina. Analysis of each ganglion cell was performed by examining the fine dendritic structure of each cell. Of the 1,060 classified ganglion cells, 605 were suitable for analysis as selected after automated analysis and determined by the intensity of Thy1 labeling and the extent of dendritic overlap between neighboring cells (Table 3). Overall, changes in morphology were observed at advanced stages of degeneration across the various ganglion cell types in rd1-Thy1 retinae compared with controls. Here, we describe findings for four ganglion cell types, which represent the most frequently encountered cell types. Class A2 showed significant changes in the rd1-Thy1 retina (Fig. 1). Overall, A2 cells in the
rd1-Thy1 retina had significant reductions in their coverage (total dendritic length and total dendritic area) and extent of branching (number of branch points). Statistically, the interaction of disease and age was significant for both the total dendritic length (Fig. 1C) and total dendritic area (Fig. 1D), and post hoc pairwise comparisons showed a significant reduction in these analysis parameters at 11 months. Several other cell classes were analyzed in a similar manner. Class B1 ganglion cells (Fig. 2) showed a significant decrease in their coverage in the rd1-Thy1 retina at 11 months (Fig. 2C,D) and an increase in the extent of branching at 3 months (Fig. 2E). Class C1 ganglion cells did not show any changes in the rd1-Thy1 retina compared with control retinae (Fig. 3). Class D ganglion cells showed significant changes in the rd1-Thy1 retina that were similar to classes A2 and B1 (Fig. 4). That being, the coverage and level of branching of D type ganglion cells showed a significant reduction in the rd1-Thy1 retinae at 11 months of age (Fig. 4C–E).
The Journal of Comparative Neurology | Research in Systems Neuroscience
1159
E.E. O’brien et al.
Figure 1. A2 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of A2 ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of A2 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in rd1-Thy1 retinae at 11 months of age and reduction in branch points at all ages examined. Scale bar 5 20 lm in B (applies to A,B).
Some studies have suggested that differences in ganglion cell morphology in rd1 mice compared with controls are more likely explained by developmental effects rather than photoreceptor degeneration because of the early onset of degeneration in rd1 mice (Damiani et al., 2012). To evaluate whether the morphological changes observed here could be attributed to developmental effects, we compared the dendritic field sizes for each
1160
of the four major ganglion cell types across three different ages. Figure 5 shows graphs of the frequency of cells for each dendritic field size encountered at three different ages. We reasoned that if ganglion cell morphology was affected by development, then a proportion of cells would show altered dendritic field size from 3 months of age. As shown in Figure 5, there were changes in the frequency distribution in rd1-Thy1
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 2. B1 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of B1 ganglion cells at 3 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of B1 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in B1 ganglion cells in rd1-Thy1 retinae at 11 months of age and an increase in the number of branch points at 3 months of age. Scale bar 5 20 lm (applies to A,B).
retinae at 3 and 11 months for A2 ganglion cells (Fig. 5A,C) and at 6 and 11 months for D ganglion cells (Fig. 5K,L). There were no significant changes in the frequency distributions of either B1 or C1 type ganglion cells (Fig. 5D–I). Notably, no differences in the frequency distribution in rd1-Thy1 compared with controls were noted at 3 months of age for B1, C1, or D type ganglion cells, and no difference in distribution was noted at 6 months for A2 ganglion cells. These findings
suggest that ganglion cells in the rd1-Thy1 develop normally despite the early onset of degeneration, and that the changes in ganglion cell morphology that were observed happened at a relatively late age (i. e., 11 months of age). In summary, the analysis performed here revealed that several ganglion cell classes were altered in the rd1-Thy1 retina. Specifically, A2, B1, and D type ganglion cells had a reduction in their coverage and level
The Journal of Comparative Neurology | Research in Systems Neuroscience
1161
E.E. O’brien et al.
Figure 3. C1 type ganglion cells in control and rd1-Thy1 retinae. A,B: Representative examples of C1 ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of C1 ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. Overall, there were no changes in C1 ganglion cells in rd1-Thy1 retinae at any age examined. Scale bar 5 20 lm in A,B.
of branching as animals aged. In comparison, C1 type ganglion cells did not show a significant change in their morphology.
Ganglion cell stratification in the inner plexiform layer A feature of late stages of degeneration is the formation of aberrant synapses in the inner retina (Jones et al., 2003a). Thus, we evaluated whether there was a change in the ramification of ganglion cell dendrites within the IPL.
1162
All ganglion cells (1,065 ganglion cells; Table 3) were classified based on the ramification of their processes within the IPL. In summary, ganglion cells were separated into those that ramified within S1, S2–S4, or S5 of the IPL or those that were bistratified. Each type of ganglion cell was evident in both the control retina and rd1-Thy1 retina at each age examined. However, there was a significant reduction in the number of S1 ganglion cells in the rd1-Thy1 retina compared with control retinae (Fig. 6C), and bistratified cells showed a significant increase at 6 months of age and a significant
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 4. D type ganglion cells in the control and rd1-Thy1 retina. A,B: Representative examples of D ganglion cells at 11 months in a whole-mounted (A) control and (B) rd1-Thy1 retina. C–E: Graphs showing the (C) total dendritic length, (D) total dendritic area, and (E) number of branch points of D ganglion cells in Thy1 and rd1-Thy1 retinae at 3, 6, and 11 months of age. In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in total dendritic length and area in D ganglion cells in rd1-Thy1 retinae at 11 months of age and a reduction in branch points at all ages examined. Scale bar 5 20 lm in A,B.
decrease in the proportion of these cells at 11 months (Fig. 6L). In contrast, there were no significant changes in the proportion of cells stratifying into S2–S4 or S5 in the rd1-Thy1 retinae (Fig. 6F,I). Next, we analyzed the dendritic morphology of each of these ganglion cells. Of the 1,065 classified ganglion cells, 593 were suitable for analysis (Table 3). Overall, ganglion cells stratifying into S1 and S2–S4 did not show significant changes in the rd1-Thy1 retina (Fig.
7A–F). The exception was the total dendritic length of S1 stratifying cells, which showed a significant increase in the rd1-Thy1 retina and may reflect active remodeling of these cells in response to the loss of inputs during degeneration. In contrast, there were significant changes in both S5 and bistratified ganglion cells in the rd1-Thy1 retina as both cell classes showed a significant decrease in their coverage across the retina at 11 months in the rd1-Thy1 retina (Fig. 7G–L).
The Journal of Comparative Neurology | Research in Systems Neuroscience
1163
E.E. O’brien et al.
Figure 5. Frequency distributions of the size of the dendritic field of ganglion cells in the control and rd1-Thy1 retina. A–L: Graphs showing the proportion of A2 (A–C), B1 (D–F), C1 (G–I), and D (J–L) ganglion cells with different dendritic field sizes in control and rd1-Thy1 retinae at 3, 6, and 11 months of age.
Changes in the processes of cells that ramified in S5 were noted at both 6 and 11 months in rd1-Thy1 retina. By definition, these cells have their dendritic arbor ramifying in strata S5 of the IPL. In control retinae, all dendrites ramify in S5, and none are located in S4 (Fig. 8A,D). In contrast, in rd1-Thy1 retinae, some ganglion cells, whose main dendritic arbor ramified in S5, also had a significant number of dendrites projecting to S4 (Fig. 8B,C,E,F). Of the 12 cells in the rd1-Thy1 retina that were identified with this stratification pattern, the mean number of ganglion cell dendrites repositioned in
1164
strata S4 was found to be 10.25 6 1.02 compared with 30.34 6 2.44, which were positioned in S5. This showed that 33.8% of ganglion cell dendrites were relocated into another strata in the IPL. In summary, analysis of the stratification of each ganglion cell revealed that changes were seen in the IPL of the degenerated retina. There was a significant reduction in ganglion cells that stratified into sublayer S1 of the rd1-Thy1 retina, and the remaining cells showed an increase in their coverage over the retina. Ganglion cells that stratified into stratum S5 showed a significant
The Journal of Comparative Neurology | Research in Systems Neuroscience
Figure 6. Ganglion cells classified by their stratification into the inner plexiform layer. Wholemount retinae were processed for fluorescence immunohistochemistry. Retinae were from control or rd1-Thy1 mice at 3, 6, and 11 months of age. A,D,G,J: Examples of each cell type. B,E,H,K: The rotated (vertical) view. C,F,I,L: The proportion of ganglion cells stratifying into each layer at 3, 6, and 11 months. A–C: Cells that stratified into S1. D–F: Cells that stratified into S2–4. G–I: Cells that stratified into S5. J–L: Cells that were bistratified. Scale bar 5 20 lm in [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.].
E.E. O’brien et al.
Figure 7. Analysis parameters of ganglion cells stratifying into the inner plexiform layer. A–L: Graphs showing the dendritic length, dendritic area, and number of branch points for cells ramifying in S1 (A–C), S2–S4 (D–F), S5 (G–I), and bistratified (J–L). In all graphs, asterisk indicates P < 0.05. Overall, there was a reduction in the total dendritic length and area of both bistratified cells and cells that ramified in S5 in rd1-Thy1 retinae at 11 months of age and a reduction in the number of branch points at all ages examined. No differences were noted in cells that ramified in layers S1–S4 of the inner plexiform layer.
reduction in coverage across the retina and some of their dendritic tips relocated into stratum S4. Bistratified ganglion cells showed significant changes particularly at 11 months with the reduction of their coverage across the retina. Interestingly, ganglion cells that stratified into strata S2–S4 had no significant changes in their quantity or morphology in the degenerated retina.
1166
DISCUSSION The results of this study indicate that there are changes in some classes of ganglion cells at advanced stages of degeneration in the rd1-Thy1 mouse model of retinal degeneration. Specifically, types A2, B1, and D ganglion cells showed a reduction in dendritic field size at 11 months of age, whereas type C1 did not show
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
Figure 8. Remodeling of ganglion cell dendrites into distal layers of the inner plexiform layer (IPL). Wholemount retinae were processed for fluorescence immunohistochemistry. A: An A-type ganglion cell from a 6-month-old control retina that has dendrites ramifying in S5. When the focus is shifted to S4 of the IPL, no processes are visible (D). B–F: Examples of an A-type ganglion cell from a 6-month and 11-month rd1-thy1 retina that is imaged in S5 and S4. In contrast to the control retina, A-type ganglion cells in the rd1-Thy1 retina have processes that ramify in both S5 and S4. G,H: Schematic representation of an A-type ganglion cell from the rd1-Thy1 retina that has dendrites ramifying in S5 (G) and S4 (H). The two schematic diagrams represent different focal planes of the same cell. I: Graph showing the number of A-type ganglion cells dendrites projecting to S4 or S5 of the IPL. Values are represented as mean 6 SEM. Scale bar 5 20 lm in A–F.
any changes. Additionally, there was a reduction in the proportion of cells stratifying in stratum S1 of the IPL as well as changes in the dendritic tips of some cells that ramified in stratum S5.
Morphological changes in subclasses of ganglion cells in aged rd1-Thy1 retinae We observed a reduction in dendritic area in rd1Thy1 at 11 months of age for A2, B1, and D type ganglion cells. Our results are consistent with those of previous studies (Damiani et al., 2012; Grafstei et al.,
1972; Mazzoni et al., 2008). Specifically, a 10% reduction in the dendritic field area was reported in 3–6month-old animals, with the 20 largest cells showing a 20% reduction (Grafstei et al., 1972). Although Grafstei et al. (1972) did not classify ganglion cells, the largest cells they describe are most likely similar to the type A ganglion cells described in our study. Damiani et al. (2012) analyzed B3 and C2 cells in rd1 and control retina, and noted a significant decrease in the total dendritic area of B3 cells from as early as 1 month of age, together with changes in their branching. Owing to differences in the classification of ganglion cells (notably,
The Journal of Comparative Neurology | Research in Systems Neuroscience
1167
E.E. O’brien et al.
the interpretation of the description of the branching features of B and C type ganglion cells reported in the study by Sun et al. [2002b]), the results of Damiani et al. (2012) should be compared with those of our study for the findings for B1 and C1 ganglion cells. Damiani et al. (2012) also showed a 50% reduction in the dendritic field size of half of the analyzed B3 and C2 type cells in animals aged 4–12 months, which the authors attributed to the early onset of degeneration in the rd1 model (Damiani et al., 2012). This finding was not replicated in our study for any of the A2, B1, C1, or D cells. It is not clear why the findings of Damiani et al. (2012) were not replicated in our study. It is possible that differences in the selective labeling of YFP in ganglion cells in the Thy1-YFP reporter mouse might contribute to these differences (Feng et al., 2000). In contrast to the results described in this study, and those of Grafstei et al. (1972) and Damiani et al. (2012), no changes in ganglion cell morphology were reported at late stages of degeneration in the rd1 (Lin and Peng, 2013) and rd10 (Mazzoni et al., 2008) mouse models of retinal degeneration. These differences might be attributed to either the method used in these studies or the genetic differences between the strains. The study with the rd1 mouse model of degeneration used relatively small samples sizes (Lin and Peng, 2013) compared with the current study. The study using the rd10 model of retinal degeneration could be impacted by genetic differences between the strains (Mazzoni et al., 2008) as the rd10 model has a later onset of degeneration and a much slower rate of photoreceptor loss than the rd1 model (Chang et al., 2007; Gargini et al., 2007). Consequently, the differences in both sampling biases and genetics in these studies may impact on the previously mentioned changes in the rd1 model of retinal degeneration. In addition to changes in the dendritic field area described here, we also noted changes in the proportion and morphology of cells ramifying in different sublayers of the IPL. In particular, there was a reduction in the proportion of cells ramifying in S1 and there were also changes in the proportion of bistratified ganglion cells at 6 and 11 months. We considered whether the change in the proportion of cells ramifying in S1 could be explained by the retraction of processes, as happens at early stages of degeneration in bipolar cells (Strettoi and Pignatelli, 2000). However, if this were the case, a commensurate increase in cells ramifying in S2–S4 or S5 where they might retract to, should have been noted. Alternatively, the reduction in the proportion of cells ramifying in different layers may also be from hypertrophic glial processes in these regions (Jones et al., 2003b; Marc et al., 2003b). Analysis of the dendrites of cells ramifying in S5 revealed that some cells
1168
extended processes into more distal layers of the IPL. These findings suggest that active remodeling of ganglion cell dendrites occurs for some ganglion cell subtypes at late stages of degeneration. A major caveat of performing any classification with a healthy and diseased model is whether the same classified groups are present in each model. In this study, as in previous reports, all subtypes of ganglion cells were observed in both control mice and those with retinal degenerations (Badea and Nathans, 2004; Damiani et al., 2012; Mazzoni et al., 2008). Indeed, the morphological changes described in our study were restricted to four classes, and on the whole were small.
What functional alterations could be associated with morphological changes in ganglion cells? Ideally, correlating the morphological changes described here with functional changes requires electrophysiological tools that use retinae at late stages of degeneration. Such studies have shown that there are functional changes in ganglion cells in terms of their excitability (Jensen and Rizzo, 2008; O’Hearn et al., 2006; Suzuki et al., 2004; Ye and Goo, 2007) as well as their spontaneous firing (Margolis et al., 2008; Sekirnjak et al., 2011). It is important to note that these studies used animals primarily at early stages of degeneration, and there are limited electrophysiology data derived from aged retinae (>3 months) due to difficulties with dissecting a very thin retina (Margolis et al., 2008). Several studies have shown that stimulating ganglion cells in the rd1 retina requires higher current levels to elicit an action potential (Jensen and Rizzo, 2008; O’Hearn et al., 2006; Suzuki et al., 2004; Ye and Goo, 2007). These changes in the degenerated retina have been attributed to both the remodeled circuitry as well as the intrinsic properties of ganglion cells (Margolis et al., 2008; Sekirnjak et al., 2011). We have observed morphological changes in the dendritic arbor at late stages of degeneration of several cell types. This change in dendritic pattern most likely directly reflects the remodeled circuitry altering the synaptic inputs of each ganglion cell. Studies have shown that ganglion cell dendrites in the normal retina have similar patterns of excitatory inputs regard1ess of ganglion cell type (Jakobs et al., 2008; Xu et al., 2008) with the density of excitatory inputs found to be 19 6 1 contacts/100 lm2 membrane in the normal guinea pig retina (Xu et al., 2008). If one assumes that excitatory synaptic inputs follow a similar pattern in the mouse retina compared with the guinea pig retina, then the decreased dendritic
The Journal of Comparative Neurology | Research in Systems Neuroscience
Ganglion cells in retinal degeneration
field size described in this study could explain some of the functional changes that have been reported in electrophysiology studies (Margolis et al., 2008; Sekirnjak et al., 2011). For instance, a smaller dendritic field size may lead to less excitatory synapses on a cell, which may cause an increase in the required stimulus to elicit an action potential. Quantification of this in the rd1 retina in late stages of degeneration is an area requiring further investigation. The decrease in dendritic field size may lead to changes in intrinsic properties of each ganglion cell by altering the ion channels located along the membrane. Sodium, potassium, and calcium ion channels are known to regulate ganglion cell action potentials (Sernagor et al., 2001), and decreasing the size of dendrites, and potentially the distribution and density of ion channels, most likely explains the increase in spontaneous activity seen in the degenerated retina (Margolis et al., 2008; Sekirnjak et al., 2011). Quantification of the ion channels located on the dendrites of rd1 retina in late stages of degeneration is another area requiring further investigation. In conclusion, this study showed that there are morphological changes in some classes of ganglion cells in the rd1-Thy1 retina at an advanced stage of retinal degeneration. Overall, there was a decrease in the size and the number of branching points of A2, B1, and D type ganglion cells whereas there was a preservation of morphology of C1 cells. Changes in the ramification of ganglion cell dendrites were noted for cells ramifying in S1. There was also rearrangement of branches of cells normally stratifying into S5 that relocated their dendrites into more distal regions of the IPL. Overall, our results indicate that there are changes in the morphology of some ganglion cells at advanced stages of retinal degeneration in the rd1 mouse model that could have an impact on the function of those cells.
ACKNOWLEDGMENTS The authors are grateful to Cameron Nowell for assistance in using metamorph software and to A/Prof. Tony Hannan for donating the Thy1-YFP mice.
CONFLICT OF INTEREST STATEMENT The authors have no conflicts of interests to report.
ROLE OF AUTHORS All authors had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. EEO, UG, and ELF designed the overall study; EEO undertook data collection and core analysis; ELF and UG gener-
ated article sections, did analysis, and contributed substantial revisions; EEO, UG, and ELF generated the primary article and performed the revision.
LITERATURE CITED Badea TC, Nathans J. 2004. Quantitative analysis of neuronal morphologies in the mouse retina visualized by using a genetically directed reporter. J Comp Neurol 480:331– 351. Chang B, Hawes NL, Pardue MT, German AM, Hurd RE, Davisson MT, Nusinowitz S, Rengarajan K, Boyd AP, Sidney SS, Phillips MJ, Stewart RE, Chaudhury R, Nickerson JM, Heckenlively JR, Boatright JH. 2007. Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. Vis Res 47:624–633. Damiani D, Novelli E, Mazzoni F, Strettoi E. 2012. Undersized dendritic arborizations in retinal ganglion cells of the rd1 mutant mouse, a paradigm of early-onset photoreceptor degeneration. J Comp Neurol 520:1406–1423. Feng GP, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. 2000. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron 28:41–51. Gargini C, Terzibasi E, Mazzoni F, Strettoi E. 2007. Retinal organization in the retinal degeneration 10 (rd10) mutant mouse: a morphological and ERG study. J Comp Neurol 500:222–238. Grafstei B, Murray M, Ingoglia NA. 1972. Protein-synthesis and axonal transport in retinal ganglion-cells of mice lacking visual receptors. Brain Res 44:37–&. Jakobs TC, Koizumi A, Masland RH. 2008. The spatial distribution of glutamatergic inputs to dendrites of retinal ganglion cells. J Comp Neurol 510:221–236. Jensen RJ, Rizzo JF. 2008. Activation of retinal ganglion cells in wild-type and rd1 mice through electrical stimulation of the retinal neural network. Vis Res 48:1562–1568. Jones BW, Watt CB, Frederick JM, Baehr W, Chen CK, Levine EM, Milam AH, Lavail MM, Marc RE. 2003a. Retinal remodeling triggered by photoreceptor degenerations. J Comp Neurol 464:1–16. Jones BW, Watt CB, Frederick JM, Baehr W, Chen CK, Levine EM, Milam AH, Lavail MM, Marc RE. 2003b. Retinal remodeling triggered by photoreceptor degenerations. J Comp Neurol 464:1–16. Lin B, Peng E. 2013. Retinal ganglion cells are resistant to photoreceptor loss in retinal degeneration. PLoS One8: e68084. Marc RE, Jones BW, Watt CB, Strettoi E. 2003a. Neural remodeling in retinal degeneration. Prog Retin Eye Res 22:607–655. Marc RE, Jones BW, Watt CB, Strettoi E. 2003b. Neural remodeling in retinal degeneration. Prog Retin Eye Res 22:607–655. Margolis DJ, Newkirk G, Euler T, Detwiler PB. 2008. Functional stability of retinal ganglion cells after degeneration-induced changes in synaptic input. J Neurosci 28:6526–6536. Mazzoni F, Novelli E, Strettoi E. 2008. Retinal ganglion cells survive and maintain normal dendritic morphology in a mouse model of inherited photoreceptor degeneration. J Neurosci 28:14282–14292. O’Hearn TM, Sadda SR, Weiland JD, Maia M, Margalit E, Humayun MS. 2006. Electrical stimulation in normal and retinal degeneration (rd1) isolated mouse retina. Vis Res 46:3198–3204. Peng YW, Hao Y, Petters RM, Wong F. 2000. Ectopic synaptogenesis in the mammalian retina caused by rod
The Journal of Comparative Neurology | Research in Systems Neuroscience
1169
E.E. O’brien et al.
photoreceptor-specific mutations. Nat Neurosci 3:1121– 1127. Perez RG, Waymire JC, Lin E, Liu JJ, Guo FL, Zigmond MJ. 2002. A role for alpha-synuclein in the regulation of dopamine biosynthesis. J Neurosci 22:3090–3099. Santos A, Humayun MS, deJuan E, Greenburg RJ, Marsh MJ, Klock IB, Milam AH. 1997. Preservation of the inner retina in retinitis pigmentosa —a morphometric analysis. Arch Ophthalmol 115:511–515. Sekirnjak C, Jepson LH, Hottowy P, Sher A, Dabrowski W, Litke AM, Chichilnisky EJ. 2011. Changes in physiological properties of rat ganglion cells during retinal degeneration. J Neurophysiol 105:2560–2571. Sernagor E, Eglen SJ, Wong ROL. 2001. Development of retinal ganglion cell structure and function. Prog Retin Eye Res 20:139–174. Strettoi E, Pignatelli V. 2000. Modifications of retinal neurons in a mouse model of retinitis pigmentosa. Proc Natl Acad Sci U S A 97:11020–11025. Strettoi E, Porciatti V, Falsini B, Pignatelli V, Rossi C. 2002. Morphological and functional abnormalities in the inner retina of the rd/rd mouse. J Neurosci 22:5492–5504. Strettoi E, Pignatelli V, Rossi C, Porciatti V, Falsini B. 2003. Remodeling of second-order neurons in the retina of rd/ rd mutant mice. Vis Res 4:867–877.
1170
Sun W, Li N, He S. 2002a. Large-scale morphological survey of mouse retinal ganglion cells. Visual Neuroscience 19(4):483–449. Sun W, Li N, He S. 2002b. Large-scale morphological survey of mouse retinal ganglion cells. J Comp Neurol 451(2): 115–126. Suzuki S, Humayun MS, Weiland JD, Chen SJ, Margalit E, Piyathaisere DV, de Juan E. 2004. Comparison of electrical stimulation thresholds in normal and retinal degenerated mouse retina. Jpn J Ophthalmol 48:345–349. Versauxbotteri C, Martinmartinelli E, Nguyenlegros J, Geffard M, Vigny A, Denoroy L. 1986. Regional specialization of the rat retina: catecholamine-containing amacrine cell characterization and distribution. J Comp Neurol 243: 422–433. Witkovsky P, Shen CP, McRory J. 2006. Differential distribution of voltage-gated calcium channels in dopaminergic neurons of the rat retina. J Comp Neurol 497:384–396. Xu Y, Vasudeva V, Vardi N, Sterling P, Freed MA. 2008. Different types of ganglion cell share a synaptic pattern. J Comp Neurol 507:1871–1878. Ye JH, Goo YS. 2007. Comparison of voltage parameters for the stimulation of normal and degenerate retina. 2007 Annual International Conference of the IEEE Engineering in Medicine and Biology Society, Vols 1–16. New York: IEEE. p 5783–5786.
The Journal of Comparative Neurology | Research in Systems Neuroscience
