Gene 540 (2014) 171–177
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
The effect of leader peptide mutations on the biological function of bovine myostatin gene Feng Gao a,1, Boxing Sun a,1, Shenyang Xing a, Xianzhong Yu a,b, Chunyan Lu a, Aonan Li a, Zhihui Zhao a, Runjun Yang a,⁎ a b
College of Animal Science, Jilin University, Xi An Road 5333, Changchun, Jilin 130062, P.R. China College of Agriculture, Forestry and Life Sciences, Clemson University, Clemson, SC 29634, USA
a r t i c l e
i n f o
Article history: Accepted 25 February 2014 Available online 26 February 2014 Keywords: Myostatin gene Cattle Gene optimization Cell proliferation
a b s t r a c t The growth of muscle fibers can be negatively regulated by bovine myostatin. The first two exons of myostatin gene code for the N-propeptide and its third exon codes for the C-polypeptide. Myostatin is secreted as a latent configuration formed by dimerization of two matured C peptides non-covalently linked with the N terminal propeptide. Pro-peptide has two distinct functions in guiding protein folding and regulating biological activity of myostatin. When the structure of the leader peptide is altered via mutations resulting in more tight binding with the mature peptide, myostatin function is inhibited, resulting in the changes of P21 and CDK2 expression levels which are relatedto the regulation of cell cycle. In the present study, the coding region of bMSTN (bovine myostatin) gene was amplified and mutated (A224C and G938A) through fusion PCR, and the mutated bMSTN gene (bMSTN-mut) was inserted in frame into the pEF1a-IRES-DsRed-Express2 vector and transfected into bovine fibroblast cells. The expression levels of bMSTN-mut, P21 and CDK2 (cyclin dependent kinase 2) were examined with qPCR and Western-blotting. Changes in cell cycle after transfection were also analyzed with flow cytometry. The results indicated that leader peptide mutation resulted in down-regulation of P21 expression levels and up-regulation of CDK2 expression levels. The flow cytometry results showed that the proportion of cells in the G0/G1-phase was lower and that of cells in the S-phase was higher in bMSTN-mut transfected group than that in the control group. The proliferation rate of bMSTN-mut transfected cells was also significantly higher than that of the control cells. In conclusion, the studies have shown that the pEF1a-IRES-DsRed-Express2– bMSTN-mut recombinant plasmid could effectively promote the proliferation of bovine fibroblast cells. The sitedirected mutagenesis of bMSTN gene leader peptide and in vitro expression in bovine fibroblast cells could be helpful to further the studies of bMSTN in regulating bovine muscle cell growth and development. © 2014 Elsevier B.V. All rights reserved.
1. Introduction MSTN gene, also known as GDF-8 (Growth Differentiation Factor-8), is a member of the TGF-β (Transforming Growth Factor β) superfamily. However, MSTN gene has low homology with other members of its family (McPherron et al., 1997). MSTN gene is the primary negative regulatory factor in the growth and development of skeletal muscle (Lee and McPherron, 1999; Sharma et al., 1999; Wehling et al., 2000) and is considered a highly polymorphic gene at interspecific and intraspecific levels (Nunez-Acuna and Gallardo-Escarate, 2014). Muscle mass and strength are both highly correlated with the expression level (Hulmi
Abbreviations: MSTN, myostatin; GDF-8, growth differentiation factor-8; CDK2, cyclin dependent kinase 2; qPCR, quantitative real-time PCR; FBS, fetal bovine serum; BSA, bovine serum albumin. ⁎ Corresponding author. E-mail address: [email protected] (R. Yang). 1 These two authors contributed equally to this work, and share the first authorship.
http://dx.doi.org/10.1016/j.gene.2014.02.052 0378-1119/© 2014 Elsevier B.V. All rights reserved.
et al., 2007; Roth et al., 2003) and polymorphism (Ferrell et al., 1999; Saunders et al., 2006) of MSTN gene. The mouse line with MSTN gene knockout developed muscular hypertrophy and hyperplasia with a significant increase in skeletal muscle mass; mutations of the bovine MSTN (bMSTN) gene coding region could lead to a “double muscle” phenotype (McPherron et al., 1997). Similar phenomena have also been observed in other species (Grobet et al., 1997; McPherron et al., 1997; Mosher et al., 2007; Schuelke et al., 2004). A great deal of current research is attempting to increase the production and quality of meat using gene knockout and transgenic technology. Mice homozygous for the knockout of the biologically active region of the MSTN C-terminal have been shown to develop muscular hypertrophy in the chest and buttock (McPherron et al., 1997). These mice, which possess a missense mutation in MSTN gene, provide a model for the development of double-muscled cattle using transgenic technology (Nishi et al., 2002), as the muscular hyperplasia in these mice is both significant and independent of thickening. However, the commercialization of such cattle will require significant effort, and genetically
172
F. Gao et al. / Gene 540 (2014) 171–177
modified products are still met with distrust by the majority of consumers. Therefore, a new genetic immunization method, which is more reliable and more acceptable, has been developed. Recent work has demonstrated (Kambadur et al., 1997) that a G → A transition at nucleotide position 938 results in the substitution of a highly conserved cysteine by a tyrosine (C313Y), as reported in the Belgian Blue and Piedmontese breeds; a C → T transition at nucleotide position 610 yields a premature stop codon in the N-terminal latency-associated peptide at amino-acid position 204 (Q204X), as observed in the Charolais and Limousine breeds; and a G → T transversion at nucleotide position 676 also causes a premature stop codon in the same N-terminal latencyassociated peptide at amino-acid position 226 (E226X), as identified in the Maine-Anjou breed. These mutations may lead to the functional inactivation of MSTN gene and promote muscle growth. In recent years, research on MSTN gene leader peptide has also yielded promising results. A transgenic mouse line containing a D76A mutation in the MSTN gene leader peptide exhibited a thicker muscular fiber diameter and a significantly increased number of muscle fibers in comparison with control mice (Lee, 2008). When fragments of the MSTN gene leader peptide containing a D76A mutation were injected into malnourished newborn rat pups, significant increases in skeletal muscle and muscle fiber thickness were observed, which greatly reduced the symptoms of malnutrition (Qiao et al., 2008). The double muscle phenotype has been reported in 14 different bovine breeds, such as Ford, Friesians, Angus, Charolais, etc. An analysis of MSTN gene in the Piedmont breed, which possesses the double muscle phenotype, found a C → A mutation in exon 1, which caused the 94th amino acid leucine to be replaced by a phenylalanine; a G → A mutation was also found in exon 3, which caused the 313th amino acid cysteine to be replaced by a tyrosine (Lee and McPherron, 1999). These discoveries provided the theoretical basis for research into the treatment of muscle atrophy. In the present study, site-directed mutagenesis of the coding region of the leader peptide was conducted using fusion PCR (Cha-Aim et al., 2012), and the effect of bMSTN-mut gene on bovine fibroblast cells was investigated. 2. Materials and methods
as MSTN-S and MSTN-P (Table 1). PCR was performed in a 25 μl reaction under the following procedures: 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 3 min; and a final extension period at 72 °C for 10 min. The PCR product was purified and recovered using an agarose gel DNA recovery kit (Tiangen, Beijing, China). The sense and antisense primers of the second pair were designated as MSTN-F and MSTN-R (Table 1). The product recovered from the first PCR was used as the template in the second PCR for fragment amplification in a 50 μl reaction under the same procedure as the first PCR except for the annealing temperature reduced to 55 °C. The purified second PCR fragments were ligated into the pMD18-T vector (Takara, Dalian, China) and the inserts were sequenced by Shanghai Sangon Company (Shanghai, China). 2.3. bMSTN double mutations by fusion PCR The fusion PCR method (Cha-Aim et al., 2012) is depicted in Fig. 1-A. The specific primers (Cadwell and Joyce, 1994) for the mutations (Table 2) were designed in reference to the coding sequence of bMSTN gene. All of the PCR amplifications were performed in 50 μl reaction and the procedure was listed in Table 3. The PMD-18T-bMSTN recombinant plasmid was used as template for PCR amplification to obtain the full-length 1128 bp product with the A224C mutation. The PCR product was used as template for the second mutation PCR resulting in mutated bMSTN gene containing both A224C and G938A mutations. The second PCR product was designated as bMSTN-mut and ligated into the pMD18-T-Simple vector (Takara, Dalian, China). The inserts were sequenced by Shanghai Sangon Company (Shanghai, China) after identification by digestion with the Nhe I and EcoR I enzymes (Takara, Dalian, China). 2.4. Construction of the pEF1a-IRES-DsRed-Express2–bMSTN-mut vector The bMSTN-mut insert from PMD18-T-Simple–bMSTN-mut plasmid was cloned into the pEF1a-IRES-DsRed-Express2 recombinant vector (Clontech, USA) at the Nhe I and EcoR I sites to obtain the pEF1a-IRESDsRed-Express2–bMSTN-mut recombinant plasmid and sequence was confirmed by Shanghai Sangon Company (Shanghai, China).
2.1. Ethics statement Animal experiments were done under the guidance of Jilin University Animal Care and Use Committee (Permit number: SYXK (Ji) 2008-0010/0011). 2.2. Nested PCR amplification for bovine MSTN gene Muscle tissue samples from healthy bovine specimen were frozen in liquid nitrogen, and Trizol reagent was used to extract total RNA. The cDNA was synthesized by reverse transcription with an RT-PCR Kit (Takara, Dalian, China) according to the instruction. Based on the full-length sequence of bMSTN gene, two pairs of specific primers were designed for nested PCR amplification (Yao et al., 2005). The sense and antisense primers of the first pair were designated
Table 1 The primer sequences and the expected lengths of PCR amplification fragments. Primer sequence
Length of product (bp)
Annealing temperature (°C)
MSTN-S: 5′ CGTTTGGCTTGGCGTTACTC 3′ MSTN-P: 5′ AGGAATGGTAACCTGCGTATGG 3′ MSTN-F: 5′ ATGCAAAAACTGCAAATCTCTGT 3′ MSTN-R: 5′ TCATGAACACCCACAGCGA 3′
1736
58
1128
55
2.5. Bovine fibroblast cell culture and transfection Bovine fibroblast cells were provided by Professor Lichun Zhang from the Institute of Animal Science, the Academy of Agricultural Science in Jilin Province. Twenty-four hours before transfection, the bovine fibroblast cells were plated at a concentration of approximately 1 × 106/well into six-well culture plates with DMEM/F12 (GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; PAA, Pasching, Austria) and 1% penicillin–streptomycin. The DMEM/F12 medium was replaced by Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) when the cell fusion level reached more than 80%. For transfection, 250 μl Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) was mixed with 6 μl of Lipofectamine™ 2000 (Invitrogen, USA) and 1.8 μg of the recombinant plasmid pEF1a-IRES-DsRed-Express2–bMSTNmut, and the transfection mixture was added to each well containing the cells in Opti-MEM serum-free medium after incubation at room temperature for 30 min. The medium was changed to regular cell culture medium after 3–5 h. Twenty-four hours after transfection, the cell morphology and the expression level of red fluorescent protein were observed under a fluorescence microscope (Nikon TE2000, Japan). 2.6. Analysis of bMSTN-mut gene expression The mRNA expression level of the bMSTN-mut gene was analyzed using semi-quantitative PCR and qPCR, and Western blotting was conducted to detect its protein expression.
F. Gao et al. / Gene 540 (2014) 171–177
173
Fig. 1. A: The fusion PCR allows fusing together any two DNA pieces in a precise way. The special primers were designed: in the fused area, the primer has a complementary area for the DNA piece and also a complementary area for the second DNA piece; normal primer for the non-fused end. (I) Normal PCR amplification for each of the DNA pieces; (II) the second step was to elongate both DNA pieces in the same PCR reaction, no primers. (III) The third step is to amplify the full length of the fusion fragments (added normal primers on the basis of the second step). B: The coding region of bovine bMSTN gene was amplified by nested PCR. P1: PCR1 for 1176 bp (DL2000 Marker); bMSTN: PCR2 for coding region of bMSTN gene; M: DL2000 Marker. The A224C and G938A mutations were conducted using fusion PCR. F1: PCR1 for 223 bp; F2: PCR2 for 925 bp; bMSTN-mut: PCR3 for fusion fragments with A224C mutation (1128 bp); M: DL2000 Marker. L1: PCR1 for 937 bp; L2: PCR2 for 213 bp; bMSTN-mut: PCR3 for fusion fragments with A224C and G938A mutations; M: DL2000 Marker. (C) The sequencing results of bMSTN-mut.
Total RNA was extracted from the cultured cells after the cell fusion level reached more than 80%, and the cDNA was synthesized using the Superscript First Strand Synthesis Kit (Invitrogen, USA) following the manufacturer's protocol. The semi-quantitative PCR amplification of bMSTN-mut gene was performed in a 20 μl reaction, with the β-actin gene as the control, under the following procedure: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final extension period at 72 °C for 7 min. The primers used in the semiquantitative PCR and qPCR were as follows: bMSTN-mut sense primer M1 and antisense primer M2; β-actin sense primer β1 and antisense primer β2 (Table 4). The Eppendorf Mastercycler ep realplex System was used for all amplifications with SYBR Green Reagent (BIOER, Hangzhou, China) for the qPCR. The qPCR was conducted in a 25 μl reaction under the following procedures: 95 °C for 5 min; 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final extension period at 72 °C for 7 min. Cells transfected with an empty vector served as the negative control. Total protein was extracted using RIPA buffer (Boster, Wuhan, China) following the manufacturer's instructions. Protein concentration was determined using the BCA Protein Assay Kit (Boster, Wuhan, China). Total protein (35 μg per sample) was resolved by SDS-PAGE and transferred onto PVDF membrane (Bio-Rad Laboratories Inc., USA). Immunoblotting was conducted using the following primary antibodies with the suggested dilutions from the manufacturer: anti-MSTN (Abcam, USA); and anti-β-actin (Abcam, USA). The antibodies were diluted with 5% BSA (bovine serum albumin) and the suggested dilutions were 1:200 and
1:1000. The immunoblots were developed using an ECL Advanced Western Blotting Detection Kit (Invitrogen, USA). 2.7. The functional verification of bMSTN-mut gene The bMSTN-mut gene can negatively regulate the P21 gene expression level and increase the expression level of CDK2 to promote the transition of cells from the G1 phase to the S phase. The mRNA and protein expression levels of P21 and CDK2 were examined with the same methods as those used for bMSTN-mut. The primers used for semi-quantitative PCR and qPCR were as follows: P21 sense primer P21-F and antisense primer P21-R; CDK2 sense primer CDK2-F and antisense primer CDK2-R; β-actin sense primer β1 and antisense primer β2 (Table 4). The following primary antibodies were used for Western blotting analysis with the suggested dilutions from the manufacturer: anti-P21 (Biosynthesis, Beijing, China), anti-CDK2 (Biosynthesis, Beijing, China), and anti-β-actin (Abcam, USA). The antibodies were diluted with 5% BSA and the suggested dilutions were 1:200, 1:200 and 1:1000. 2.8. Cell cycle phase analysis by flow cytometry Forty-eight hours after transfection, bovine fibroblast cells in the logarithmic growth phase were collected from the positive group and the control group, washed twice with cold PBS, and fixed with 70% cold ethanol at 4 °C overnight. After washing twice with cold PBS, the cells were
Table 2 The primer sequences for fragment amplifications.
Primer sequence (5´-3´) F1:ctaGCTAGCGCCACCATGCAAAAACTGCAAATCTCTGT
F2:CTTTGCTGATGTTAGGAGCT
P1:AGCTCCTAACATCAGCAAAGCTGCTATCAGACAAC
P2:ccgGAATTCTCATGAACACCCACAGCGATCTACT
S1:GCCAATTACTGCTCTGGAGAATATGAATTTGTATTTTTG
S2:ATTCTCCAGAGCAGTAATTGGCCTT
The sequence in the box of primer F1 was the Nhe I restriction site, Kozak sequence was underlined and the front-end sequence was the protective bases; the sequence in the box of primer P2 was the EcoR I restriction site and the front-end sequence was the protective bases.
174
F. Gao et al. / Gene 540 (2014) 171–177
Table 3 The conditions of PCR amplification and lengths of products. Type of mutations
PCR names
Primers
Conditions
A224C mutation
PCR1 PCR2 PCR3(1) PCR3(2) PCR1 PCR2 PCR3(1) PCR3(2)
F1, F2 P1, P2
35 35 15 35 35 35 15 35
G938A mutation
F1, P2 F1, S2 S1, P2 F1, P2
mixed with 500 μl PI (50 μg·ml−1) dye and 10 μl RNase A (50 μg·ml−1) and incubated for 30 min at 37 °C in the dark. Flow cytometry (Szeberenyl, 2007) was used to analyze the cell cycle. 2.9. Statistical analysis Data of qPCR results were reported as mean ± S.D. and the relative fold change in the expression of mRNA was calculated using the method of 2−ΔΔct. Statistical analysis of qPCR results was done using one-way ANOVA (Analysis of Variance) of SPSS 13.0 for Windows. 3. Results 3.1. Nested PCR amplification and double mutations of bMSTN The full length of bMSTN sequence was amplified from total RNA as a 1736 bp fragment (Fig. 1-B), and this product was served as the template for the nested PCR amplification for an 1128 bp fragment (Fig. 1-B). The PCR products were ligated into the pMD18-T vector and bMSTN sequence was analyzed using DNAStar and BLAST. The results of the sequencing showed that the vector construction was successful. The A224C and G938A mutations in bMSTN-mut gene were introduced by fusion PCR amplification (Fig. 1-B). A pair of specific primers with a Kozak sequence and the Nhe I and EcoR I sites were used for PCR amplification for the coding region of the bovine bMSTN-mut gene with a sequence length of approximately 1128 bp. The products were ligated into the pMD18-T-Simple vector and confirmed with Nhe I/EcoR I digestion (Fig. 2-A). The mutations were confirmed by sequencing (Fig. 1-C). 3.2. The construction of the pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector and its expression in bovine fibroblast cells The bMSTN-mut insert from PMD18-T-Simple–bMSTN-mut plasmid was cloned into pEF1a-IRES-DsRed-Express2 vector at Nhe I and EcoR I sites to form pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector and confirmed by the Nhe I and EcoR I digestion and sequencing (Fig. 2-A, B).
Table 4 The primer sequences for fragment amplifications. Primer sequences
Lengths of products (bp)
Anneal temperatures (°C)
M1:5′ TGTAACCTTCCCAGAACCAG 3′ M2: 5′ GCAATAATCCAATCCCATCC 3′ P21-F: 5′ GAGACCGTGGTTGGGAGA 3′ P21-R: 5′ CCACTGGACCAAAGAGGC 3′ CDK2-F: 5′ CAAGTTGACGGGAGAAGTGGT 3′ CDK2-R: 5′ CTTTATGAGCGGAAGAGGAAT 3′ β1: 5′ AGAGCAAGAGAGGCATCC 3′ β2: 5′ TCGTTGTAGAAGGTGTGGT 3′
186
60
155
60
247
60
103
60
cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95
Lengths °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s, 61 s, 67 s, 68 s, 68 s, 65 s, 65 s, 68 s, 68
°C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s, 72 s, 72 s, 72 s, 72 s, 72 s, 72 s, 72 s, 72
°C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s) s) s) s) s) s) s) s)
223 bp 925 bp 1128 bp 937 bp 213 bp 1128 bp
Red fluorescence could be observed in bovine fibroblast cells 24 h after transfection with pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid. The percentage of positive cells were approximately 45%. Normal cells did not exhibit any red fluorescence, while both the bovine fibroblast cells transfected with the pEF1a-IRESDsRed-Express2 empty vector and those transfected with the recombinant plasmid showed strong red fluorescence (Fig. 3-A). The expression of the bMSTN-mut mRNA was detected using semi-quantitative PCR (Fig. 3-B-I). The results showed that the PCR band of the positive group was brighter than that of the control group. The relative fold change in the expression of bMSTN-mut mRNA was examined by qPCR and the results showed that positive group had a significant increase in bMSTN-mut transcript levels (50.57 fold, p b 0.01) (Fig. 3-B-II). The results of the Western blotting analysis indicated that the bMSTN protein expression in the positive cells was up-regulated compared with that in the control group cells (Fig. 3-B-III). The results of the Western blotting analysis were consistent with the qPCR results. 3.3. Analysis of P21 and CDK2 gene expression and detection of cell cycle by flow cytometry The measurement of the P21 gene expression level was conducted using the same methods as those for bMSTN-mut gene expression. The P21 gene mRNA in the pEF1a-IRES-DsRed-Express2–bMSTN-mut transfection group was significantly reduced compared to that in the control group (Fig. 4-A-I, A-II, p b 0.05). The Western blotting result for P21 showed that the protein expression of the positive cells was downregulated in comparison to that of the control group cells (Fig. 4-A-III), which was consistent with the qPCR results. The CDK2 gene expression was examined using semi-quantitative PCR and qPCR. The CDK2 gene mRNAs were nearly identical in both the positive group and the control group (Fig. 4-B-I, B-II, p N 0.05). The Western blotting analysis results for CDK2 indicated that the protein expression level in the positive cells was up-regulated in comparison with that in the control group cells (Fig. 4-B-III). Forty-eight hours after transfection, the ratio of bovine fibroblast cells in each cell cycle phase was determined using flow cytometry. The G0/G1-phase ratio in the positive group was lower, and the proportion of cells in the S-phase was higher, in comparison with that in the control group. These results indicated that the number of cells in active DNA synthesis stage in the positive group was significantly higher than that in the control group (Fig. 4-C). 4. Discussion In the present study, we took full advantage of directional cloning in the construction of the eukaryotic expression vector pEF1a-IRES-DsRedExpress2–bMSTN and A224C and G938A mutations were successfully introduced into bMSTN gene using fusion PCR. Meanwhile, the Kozak sequence (GCCACC) (Xu et al., 2010) was added to the sense primer for bMSTN amplification to ensure the efficient expression of the optimized plasmid. Transfection of bMSTN-mut into bovine fibroblast cells showed that this mutated myostatin could inhibit the expression of P21 but
F. Gao et al. / Gene 540 (2014) 171–177
175
Fig. 2. A: The digestion identification results of the pMD18-T-Simple–bMSTN-mut recombinant plasmid and pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector. P1: Double digestion by Nhe I and EcoR I; P2: single digestion by Nhe I; P3: single digestion by EcoR I; P4: the pMD18-T-Simple–bMSTN-mut plasmid; M1: DL2000 Marker; F1: double digestion by Nhe I and EcoR I; F2: single digestion by Nhe I; F3: single digestion by EcoR I; F4: the pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid; M2:DL15000 Marker; B: the sequencing results of pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid.
increase the expression of CDK2 when analyzed with Western blot and qPCR. P21 and CDK2 genes were the factors associated with cell cycle (La Thangue, 1996; Langley et al., 2004). Therefore, we believed that bMSTN-mut might have a role in the regulation of cell cycle. The cell
cycle was detected after transfection, the results showed that the transfection of bMSTN-mut also resulted in changes of cell cycle phase in transfected cells with a lower G0/G1-phase ratio and a higher S-phase ratio, which indicated that the number of cells in active DNA synthesis
Fig. 3. A: Red fluorescence could be observed under a fluorescence microscope 24 h after the transfection. The expression rate of red fluorescence in bovine fibroblast cells was 45%. Positive group: transfecting bovine fibroblast cells with pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid, the fluorescence was observed under a fluorescence microscope (I: ray fluorescence, II: normal light); control group: transfecting bovine fibroblast cells with pEF1a-IRES-DsRed-Express2 empty vector, the fluorescence was observed under a fluorescence microscope (III: ray fluorescence, IV: normal light) (×100). B: The expression of bMSTN-mut gene in bovine fibroblast cells. I: The detection results using semi-quantitative PCR, the PCR band of the positive group was stronger than that of the control group; II: the relative fold change in the expression of bMSTN-mut mRNA was examined by qPCR. Bovine fibroblast cells transfected with the recombinant plasmid had a significant 50.5667 ± 0.7-fold increase in bMSTN-mut and intracellular bMSTN transcript levels (p b 0.01); III: Western blotting analysis indicated that the total bMSTN-mut and intracellular bMSTN protein expressions in the positive cells were up-regulated compared with those in the control group cells.
176
F. Gao et al. / Gene 540 (2014) 171–177
Fig. 4. A: Analysis of P21 and CDK2 gene expressions. I: The detection results using semi-quantitative PCR, the PCR strip of the cells transfected with the empty vector was stronger than that of the positive group in P21 group; II: the relative fold change in the expression of P21 mRNA in bovine fibroblast cells after transfection. The fibroblast cells transfected with pEF1a-IRESDsRed-Express2 vector displayed a significant 1.3875 ± 0.1404-fold increase in P21 transcript levels compared with the positive group cells. (p b 0.05); III: Western blot analysis for P21. The results indicated that the protein expression of the positive cells was down-regulated in comparison to that of the control group cells. B: The detection of cell cycle by flow cytometry. I: The detection results using semi-quantitative PCR, the PCR strips in both positive group and control group were basically consistent in CDK2 group. II: The relative fold change in expression of CDK2 mRNA in fibroblast cells after transfection. The fibroblast cells treated with pEF1a-IRES-DsRed-Express2 empty vector displayed a 0.9295 ± 0.1751-fold decrease in CDK2 transcript levels. (p N 0.05); III: Western blot analysis for CDK2. The protein expression level in the positive cells was up-regulated in comparison with that in the control group cells. C: The detection of cell cycle by flow cytometry. The G0/G1-phase ratio in the positive group was lower, and the proportion of cells in the S-phase was higher, in comparison with that in the control group.
stage in the transfected group was significantly higher than that in the control group. Previous studies have shown that the transgenic mice with D76A mutation in MSTN gene leader peptide resulted in a thicker muscle fiber diameter and a significant increase in the number of muscle fibers (Lee, 2008). Injection of these fragments with the D76A mutation into newborn rat pups significantly increased their skeletal muscle and the muscle fiber of malnourished pups became thicker, and the symptoms of malnutrition were also reduced (Qiao et al., 2008). In the present study, site-directed mutagenesis was conducted on the coding region of bMSTN leader peptide and the mutant myostatin gene was used for immunization. This approach may be used as an alternative to the comparatively difficult and lengthy transgenic technique for muscle growth manipulation. We would take the method of gene immunization for further validation in vivo in order to find a more safe and convenient way to improve the quality of bovine muscle. The transition of cell cycle from G1 to S phase was prevented by MSTN in cultured myoblasts (Saltis, 1996). The activity of CDK2 kinase was reduced due to bMSTN-mut transfection, which in turn lead to the accumulation of non-phosphorylated Rb protein binding with E2F transcription factor, resulting in the prevention of transcription from G1 to S phase (Nevins, 1992). It has been reported that the 76th aspartic acid of mice myostatin propeptide was the specific cutting site of BMP-1/TLD metalloproteinase family. The MSTN precursors could release the Cterminal dimer after being cut by metalloproteinase. The released Cterminal dimer could then bind with corresponding receptors to activate downstream signaling pathways. Although it could still bind with C-terminal dimer after the aspartic acid mutation into alanine, the C-terminal could not be released from the complex by BMP-1/TLD protease, thus inhibited the function of MSTN gene (Wolfman et al., 2003). In our results, the lower expression level of P21 gene was correlated with an increase of CDK2 gene expression level in bovine fibroblast cells transfected with bMSTN-mut, and the number of cells in active DNA synthesis stage was significantly higher. These results indicated that the mature peptide encoded by the mutated bMSTN gene was inactive due to the mutations introduced into the structure of the leader
peptide, which resulted in tighter bindings of the pro-peptide with the C-terminal dimers. In conclusion, site-directed mutagenesis of the coding region of the leader peptide was conducted using fusion PCR and the effect of bMSTN-mut gene on bovine fibroblast cells was investigated. The final results showed that the pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid could effectively promote the proliferation of bovine fibroblast cells. It should be helpful for further study on the role of bMSTN gene in regulating of bovine muscle growth. Conflict of interest The authors declare no conflict of interest. Acknowledgments This work was supported by the Jilin Scientific and Technological Development Program (Nos. 20110229, 20130522084JH and 20120226), the National Natural Science Foundation of China (no. 31372278), the National R.&D. Project of Transgenic Organisms of Ministry of Science and Technology of China (2013ZX08007-001), and the National High Technology Research and Development Program (863 Program, no. 2013AA102505). References Cadwell, R.C., Joyce, G.F., 1994. Mutagenic PCR. PCR Methods Appl 3, S136–S140. Cha-Aim, K., Hoshida, H., Fukunaga, T., Akada, R., 2012. Fusion PCR via novel overlap sequences. Methods in Molecular Biology 852, 97–110. Ferrell, R.E., Conte, V., Lawrence, E.C., Roth, S.M., Hagberg, J.M., Hurley, B.F., 1999. Frequent sequence variation in the human myostatin (GDF8) gene as a marker for analysis of muscle-related phenotypes. Genomics 62, 203–207. Grobet, L., Martin, L.J., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner, S., Menissier, F., Massabanda, J., Fries, R., Hanset, R., Georges, M., 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics 17, 71–74. Hulmi, J.J., Ahtiainen, J.P., Kaasalainen, T., Pollanen, E., Hakkinen, K., Alen, M., Selanne, H., Kovanen, V., Mero, A.A., 2007. Postexercise myostatin and activin IIb mRNA levels: effects of strength training. Medicine and Science in Sports and Exercise 39, 289–297.
F. Gao et al. / Gene 540 (2014) 171–177 Kambadur, R., Sharma, M., Smith, T.P., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research 7, 910–916. La Thangue, N.B., 1996. E2F and the molecular mechanisms of early cell-cycle control. Biochemical Society Transactions 24, 54–59. Langley, B., Thomas, M., McFarlane, C., Gilmour, S., Sharma, M., Kambadur, R., 2004. Myostatin inhibits rhabdomyosarcoma cell proliferation through an Rb-independent pathway. Oncogene 23, 524–534. Lee, S.J., 2008. Genetic analysis of the role of proteolysis in the activation of latent myostatin. PLoS One 3, e1628. Lee, S.J., McPherron, A.C., 1999. Myostatin and the control of skeletal muscle mass. Current Opinion in Genetics and Development 9, 604–607. McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83–90. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genetics 3, e79. Nevins, J.R., 1992. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science 258, 424–429. Nishi, M., Yasue, A., Nishimatu, S., Nohno, T., Yamaoka, T., Itakura, M., Moriyama, K., Ohuchi, H., Noji, S., 2002. A missense mutant myostatin causes hyperplasia without hypertrophy in the mouse muscle. Biochemical and Biophysical Research Communications 293, 247–251. Nunez-Acuna, G., Gallardo-Escarate, C., 2014. The myostatin gene of Mytilus chilensis evidences a high level of polymorphism and ubiquitous transcript expression. Gene 536, 207–212. Qiao, C., Li, J., Jiang, J., Zhu, X., Wang, B., Li, J., Xiao, X., 2008. Myostatin propeptide gene delivery by adeno-associated virus serotype 8 vectors enhances muscle growth and ameliorates dystrophic phenotypes in mdx mice. Human Gene Therapy 19, 241–254.
177
Roth, S.M., Martel, G.F., Ferrell, R.E., Metter, E.J., Hurley, B.F., Rogers, M.A., 2003. Myostatin gene expression is reduced in humans with heavy-resistance strength training: a brief communication. Experimental Biology and Medicine (Maywood, N.J.) 228, 706–709. Saltis, J., 1996. TGF-beta: receptors and cell cycle arrest. Molecular and Cellular Endocrinology 116, 227–232. Saunders, M.A., Good, J.M., Lawrence, E.C., Ferrell, R.E., Li, W.H., Nachman, M.W., 2006. Human adaptive evolution at myostatin (GDF8), a regulator of muscle growth. American Journal of Human Genetics 79, 1089–1097. Schuelke, M., Wagner, K.R., Stolz, L.E., Hubner, C., Riebel, T., Komen, W., Braun, T., Tobin, J.F., Lee, S.J., 2004. Myostatin mutation associated with gross muscle hypertrophy in a child. New England Journal of Medicine 350, 2682–2688. Sharma, M., Kambadur, R., Matthews, K.G., Somers, W.G., Devlin, G.P., Conaglen, J.V., Fowke, P.J., Bass, J.J., 1999. Myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. Journal of Cellular Physiology 180, 1–9. Szeberenyl, J., 2007. Analysis of the cell cycle by flow cytometry. Biochemistry and Molecular Biology Education 35, 153–154. Wehling, M., Cai, B., Tidball, J.G., 2000. Modulation of myostatin expression during modified muscle use. FASEB Journal 14, 103–110. Wolfman, N.M., McPherron, A.C., Pappano, W.N., Davies, M.V., Song, K., Tomkinson, K.N., Wright, J.F., Zhao, L., Sebald, S.M., Greenspan, D.S., Lee, S.J., 2003. Activation of latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proceedings of the National Academy of Sciences of the United States of America 100, 15842–15846. Xu, H., Wang, P., Fu, Y., Zheng, Y., Tang, Q., Si, L., You, J., Zhang, Z., Zhu, Y., Zhou, L., Wei, Z., Lin, B., Hu, L., Kong, X., 2010. Length of the ORF, position of the first AUG and the Kozak motif are important factors in potential dual-coding transcripts. Cell Research 20, 445–457. Yao, E., Tavis, J.E., Virahep, C.S.G., 2005. A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame. Virology Journal 2, 88.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
The effect of leader peptide mutations on the biological function of bovine myostatin gene Feng Gao a,1, Boxing Sun a,1, Shenyang Xing a, Xianzhong Yu a,b, Chunyan Lu a, Aonan Li a, Zhihui Zhao a, Runjun Yang a,⁎ a b
College of Animal Science, Jilin University, Xi An Road 5333, Changchun, Jilin 130062, P.R. China College of Agriculture, Forestry and Life Sciences, Clemson University, Clemson, SC 29634, USA
a r t i c l e
i n f o
Article history: Accepted 25 February 2014 Available online 26 February 2014 Keywords: Myostatin gene Cattle Gene optimization Cell proliferation
a b s t r a c t The growth of muscle fibers can be negatively regulated by bovine myostatin. The first two exons of myostatin gene code for the N-propeptide and its third exon codes for the C-polypeptide. Myostatin is secreted as a latent configuration formed by dimerization of two matured C peptides non-covalently linked with the N terminal propeptide. Pro-peptide has two distinct functions in guiding protein folding and regulating biological activity of myostatin. When the structure of the leader peptide is altered via mutations resulting in more tight binding with the mature peptide, myostatin function is inhibited, resulting in the changes of P21 and CDK2 expression levels which are relatedto the regulation of cell cycle. In the present study, the coding region of bMSTN (bovine myostatin) gene was amplified and mutated (A224C and G938A) through fusion PCR, and the mutated bMSTN gene (bMSTN-mut) was inserted in frame into the pEF1a-IRES-DsRed-Express2 vector and transfected into bovine fibroblast cells. The expression levels of bMSTN-mut, P21 and CDK2 (cyclin dependent kinase 2) were examined with qPCR and Western-blotting. Changes in cell cycle after transfection were also analyzed with flow cytometry. The results indicated that leader peptide mutation resulted in down-regulation of P21 expression levels and up-regulation of CDK2 expression levels. The flow cytometry results showed that the proportion of cells in the G0/G1-phase was lower and that of cells in the S-phase was higher in bMSTN-mut transfected group than that in the control group. The proliferation rate of bMSTN-mut transfected cells was also significantly higher than that of the control cells. In conclusion, the studies have shown that the pEF1a-IRES-DsRed-Express2– bMSTN-mut recombinant plasmid could effectively promote the proliferation of bovine fibroblast cells. The sitedirected mutagenesis of bMSTN gene leader peptide and in vitro expression in bovine fibroblast cells could be helpful to further the studies of bMSTN in regulating bovine muscle cell growth and development. © 2014 Elsevier B.V. All rights reserved.
1. Introduction MSTN gene, also known as GDF-8 (Growth Differentiation Factor-8), is a member of the TGF-β (Transforming Growth Factor β) superfamily. However, MSTN gene has low homology with other members of its family (McPherron et al., 1997). MSTN gene is the primary negative regulatory factor in the growth and development of skeletal muscle (Lee and McPherron, 1999; Sharma et al., 1999; Wehling et al., 2000) and is considered a highly polymorphic gene at interspecific and intraspecific levels (Nunez-Acuna and Gallardo-Escarate, 2014). Muscle mass and strength are both highly correlated with the expression level (Hulmi
Abbreviations: MSTN, myostatin; GDF-8, growth differentiation factor-8; CDK2, cyclin dependent kinase 2; qPCR, quantitative real-time PCR; FBS, fetal bovine serum; BSA, bovine serum albumin. ⁎ Corresponding author. E-mail address: [email protected] (R. Yang). 1 These two authors contributed equally to this work, and share the first authorship.
http://dx.doi.org/10.1016/j.gene.2014.02.052 0378-1119/© 2014 Elsevier B.V. All rights reserved.
et al., 2007; Roth et al., 2003) and polymorphism (Ferrell et al., 1999; Saunders et al., 2006) of MSTN gene. The mouse line with MSTN gene knockout developed muscular hypertrophy and hyperplasia with a significant increase in skeletal muscle mass; mutations of the bovine MSTN (bMSTN) gene coding region could lead to a “double muscle” phenotype (McPherron et al., 1997). Similar phenomena have also been observed in other species (Grobet et al., 1997; McPherron et al., 1997; Mosher et al., 2007; Schuelke et al., 2004). A great deal of current research is attempting to increase the production and quality of meat using gene knockout and transgenic technology. Mice homozygous for the knockout of the biologically active region of the MSTN C-terminal have been shown to develop muscular hypertrophy in the chest and buttock (McPherron et al., 1997). These mice, which possess a missense mutation in MSTN gene, provide a model for the development of double-muscled cattle using transgenic technology (Nishi et al., 2002), as the muscular hyperplasia in these mice is both significant and independent of thickening. However, the commercialization of such cattle will require significant effort, and genetically
172
F. Gao et al. / Gene 540 (2014) 171–177
modified products are still met with distrust by the majority of consumers. Therefore, a new genetic immunization method, which is more reliable and more acceptable, has been developed. Recent work has demonstrated (Kambadur et al., 1997) that a G → A transition at nucleotide position 938 results in the substitution of a highly conserved cysteine by a tyrosine (C313Y), as reported in the Belgian Blue and Piedmontese breeds; a C → T transition at nucleotide position 610 yields a premature stop codon in the N-terminal latency-associated peptide at amino-acid position 204 (Q204X), as observed in the Charolais and Limousine breeds; and a G → T transversion at nucleotide position 676 also causes a premature stop codon in the same N-terminal latencyassociated peptide at amino-acid position 226 (E226X), as identified in the Maine-Anjou breed. These mutations may lead to the functional inactivation of MSTN gene and promote muscle growth. In recent years, research on MSTN gene leader peptide has also yielded promising results. A transgenic mouse line containing a D76A mutation in the MSTN gene leader peptide exhibited a thicker muscular fiber diameter and a significantly increased number of muscle fibers in comparison with control mice (Lee, 2008). When fragments of the MSTN gene leader peptide containing a D76A mutation were injected into malnourished newborn rat pups, significant increases in skeletal muscle and muscle fiber thickness were observed, which greatly reduced the symptoms of malnutrition (Qiao et al., 2008). The double muscle phenotype has been reported in 14 different bovine breeds, such as Ford, Friesians, Angus, Charolais, etc. An analysis of MSTN gene in the Piedmont breed, which possesses the double muscle phenotype, found a C → A mutation in exon 1, which caused the 94th amino acid leucine to be replaced by a phenylalanine; a G → A mutation was also found in exon 3, which caused the 313th amino acid cysteine to be replaced by a tyrosine (Lee and McPherron, 1999). These discoveries provided the theoretical basis for research into the treatment of muscle atrophy. In the present study, site-directed mutagenesis of the coding region of the leader peptide was conducted using fusion PCR (Cha-Aim et al., 2012), and the effect of bMSTN-mut gene on bovine fibroblast cells was investigated. 2. Materials and methods
as MSTN-S and MSTN-P (Table 1). PCR was performed in a 25 μl reaction under the following procedures: 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 3 min; and a final extension period at 72 °C for 10 min. The PCR product was purified and recovered using an agarose gel DNA recovery kit (Tiangen, Beijing, China). The sense and antisense primers of the second pair were designated as MSTN-F and MSTN-R (Table 1). The product recovered from the first PCR was used as the template in the second PCR for fragment amplification in a 50 μl reaction under the same procedure as the first PCR except for the annealing temperature reduced to 55 °C. The purified second PCR fragments were ligated into the pMD18-T vector (Takara, Dalian, China) and the inserts were sequenced by Shanghai Sangon Company (Shanghai, China). 2.3. bMSTN double mutations by fusion PCR The fusion PCR method (Cha-Aim et al., 2012) is depicted in Fig. 1-A. The specific primers (Cadwell and Joyce, 1994) for the mutations (Table 2) were designed in reference to the coding sequence of bMSTN gene. All of the PCR amplifications were performed in 50 μl reaction and the procedure was listed in Table 3. The PMD-18T-bMSTN recombinant plasmid was used as template for PCR amplification to obtain the full-length 1128 bp product with the A224C mutation. The PCR product was used as template for the second mutation PCR resulting in mutated bMSTN gene containing both A224C and G938A mutations. The second PCR product was designated as bMSTN-mut and ligated into the pMD18-T-Simple vector (Takara, Dalian, China). The inserts were sequenced by Shanghai Sangon Company (Shanghai, China) after identification by digestion with the Nhe I and EcoR I enzymes (Takara, Dalian, China). 2.4. Construction of the pEF1a-IRES-DsRed-Express2–bMSTN-mut vector The bMSTN-mut insert from PMD18-T-Simple–bMSTN-mut plasmid was cloned into the pEF1a-IRES-DsRed-Express2 recombinant vector (Clontech, USA) at the Nhe I and EcoR I sites to obtain the pEF1a-IRESDsRed-Express2–bMSTN-mut recombinant plasmid and sequence was confirmed by Shanghai Sangon Company (Shanghai, China).
2.1. Ethics statement Animal experiments were done under the guidance of Jilin University Animal Care and Use Committee (Permit number: SYXK (Ji) 2008-0010/0011). 2.2. Nested PCR amplification for bovine MSTN gene Muscle tissue samples from healthy bovine specimen were frozen in liquid nitrogen, and Trizol reagent was used to extract total RNA. The cDNA was synthesized by reverse transcription with an RT-PCR Kit (Takara, Dalian, China) according to the instruction. Based on the full-length sequence of bMSTN gene, two pairs of specific primers were designed for nested PCR amplification (Yao et al., 2005). The sense and antisense primers of the first pair were designated
Table 1 The primer sequences and the expected lengths of PCR amplification fragments. Primer sequence
Length of product (bp)
Annealing temperature (°C)
MSTN-S: 5′ CGTTTGGCTTGGCGTTACTC 3′ MSTN-P: 5′ AGGAATGGTAACCTGCGTATGG 3′ MSTN-F: 5′ ATGCAAAAACTGCAAATCTCTGT 3′ MSTN-R: 5′ TCATGAACACCCACAGCGA 3′
1736
58
1128
55
2.5. Bovine fibroblast cell culture and transfection Bovine fibroblast cells were provided by Professor Lichun Zhang from the Institute of Animal Science, the Academy of Agricultural Science in Jilin Province. Twenty-four hours before transfection, the bovine fibroblast cells were plated at a concentration of approximately 1 × 106/well into six-well culture plates with DMEM/F12 (GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; PAA, Pasching, Austria) and 1% penicillin–streptomycin. The DMEM/F12 medium was replaced by Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) when the cell fusion level reached more than 80%. For transfection, 250 μl Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) was mixed with 6 μl of Lipofectamine™ 2000 (Invitrogen, USA) and 1.8 μg of the recombinant plasmid pEF1a-IRES-DsRed-Express2–bMSTNmut, and the transfection mixture was added to each well containing the cells in Opti-MEM serum-free medium after incubation at room temperature for 30 min. The medium was changed to regular cell culture medium after 3–5 h. Twenty-four hours after transfection, the cell morphology and the expression level of red fluorescent protein were observed under a fluorescence microscope (Nikon TE2000, Japan). 2.6. Analysis of bMSTN-mut gene expression The mRNA expression level of the bMSTN-mut gene was analyzed using semi-quantitative PCR and qPCR, and Western blotting was conducted to detect its protein expression.
F. Gao et al. / Gene 540 (2014) 171–177
173
Fig. 1. A: The fusion PCR allows fusing together any two DNA pieces in a precise way. The special primers were designed: in the fused area, the primer has a complementary area for the DNA piece and also a complementary area for the second DNA piece; normal primer for the non-fused end. (I) Normal PCR amplification for each of the DNA pieces; (II) the second step was to elongate both DNA pieces in the same PCR reaction, no primers. (III) The third step is to amplify the full length of the fusion fragments (added normal primers on the basis of the second step). B: The coding region of bovine bMSTN gene was amplified by nested PCR. P1: PCR1 for 1176 bp (DL2000 Marker); bMSTN: PCR2 for coding region of bMSTN gene; M: DL2000 Marker. The A224C and G938A mutations were conducted using fusion PCR. F1: PCR1 for 223 bp; F2: PCR2 for 925 bp; bMSTN-mut: PCR3 for fusion fragments with A224C mutation (1128 bp); M: DL2000 Marker. L1: PCR1 for 937 bp; L2: PCR2 for 213 bp; bMSTN-mut: PCR3 for fusion fragments with A224C and G938A mutations; M: DL2000 Marker. (C) The sequencing results of bMSTN-mut.
Total RNA was extracted from the cultured cells after the cell fusion level reached more than 80%, and the cDNA was synthesized using the Superscript First Strand Synthesis Kit (Invitrogen, USA) following the manufacturer's protocol. The semi-quantitative PCR amplification of bMSTN-mut gene was performed in a 20 μl reaction, with the β-actin gene as the control, under the following procedure: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final extension period at 72 °C for 7 min. The primers used in the semiquantitative PCR and qPCR were as follows: bMSTN-mut sense primer M1 and antisense primer M2; β-actin sense primer β1 and antisense primer β2 (Table 4). The Eppendorf Mastercycler ep realplex System was used for all amplifications with SYBR Green Reagent (BIOER, Hangzhou, China) for the qPCR. The qPCR was conducted in a 25 μl reaction under the following procedures: 95 °C for 5 min; 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final extension period at 72 °C for 7 min. Cells transfected with an empty vector served as the negative control. Total protein was extracted using RIPA buffer (Boster, Wuhan, China) following the manufacturer's instructions. Protein concentration was determined using the BCA Protein Assay Kit (Boster, Wuhan, China). Total protein (35 μg per sample) was resolved by SDS-PAGE and transferred onto PVDF membrane (Bio-Rad Laboratories Inc., USA). Immunoblotting was conducted using the following primary antibodies with the suggested dilutions from the manufacturer: anti-MSTN (Abcam, USA); and anti-β-actin (Abcam, USA). The antibodies were diluted with 5% BSA (bovine serum albumin) and the suggested dilutions were 1:200 and
1:1000. The immunoblots were developed using an ECL Advanced Western Blotting Detection Kit (Invitrogen, USA). 2.7. The functional verification of bMSTN-mut gene The bMSTN-mut gene can negatively regulate the P21 gene expression level and increase the expression level of CDK2 to promote the transition of cells from the G1 phase to the S phase. The mRNA and protein expression levels of P21 and CDK2 were examined with the same methods as those used for bMSTN-mut. The primers used for semi-quantitative PCR and qPCR were as follows: P21 sense primer P21-F and antisense primer P21-R; CDK2 sense primer CDK2-F and antisense primer CDK2-R; β-actin sense primer β1 and antisense primer β2 (Table 4). The following primary antibodies were used for Western blotting analysis with the suggested dilutions from the manufacturer: anti-P21 (Biosynthesis, Beijing, China), anti-CDK2 (Biosynthesis, Beijing, China), and anti-β-actin (Abcam, USA). The antibodies were diluted with 5% BSA and the suggested dilutions were 1:200, 1:200 and 1:1000. 2.8. Cell cycle phase analysis by flow cytometry Forty-eight hours after transfection, bovine fibroblast cells in the logarithmic growth phase were collected from the positive group and the control group, washed twice with cold PBS, and fixed with 70% cold ethanol at 4 °C overnight. After washing twice with cold PBS, the cells were
Table 2 The primer sequences for fragment amplifications.
Primer sequence (5´-3´) F1:ctaGCTAGCGCCACCATGCAAAAACTGCAAATCTCTGT
F2:CTTTGCTGATGTTAGGAGCT
P1:AGCTCCTAACATCAGCAAAGCTGCTATCAGACAAC
P2:ccgGAATTCTCATGAACACCCACAGCGATCTACT
S1:GCCAATTACTGCTCTGGAGAATATGAATTTGTATTTTTG
S2:ATTCTCCAGAGCAGTAATTGGCCTT
The sequence in the box of primer F1 was the Nhe I restriction site, Kozak sequence was underlined and the front-end sequence was the protective bases; the sequence in the box of primer P2 was the EcoR I restriction site and the front-end sequence was the protective bases.
174
F. Gao et al. / Gene 540 (2014) 171–177
Table 3 The conditions of PCR amplification and lengths of products. Type of mutations
PCR names
Primers
Conditions
A224C mutation
PCR1 PCR2 PCR3(1) PCR3(2) PCR1 PCR2 PCR3(1) PCR3(2)
F1, F2 P1, P2
35 35 15 35 35 35 15 35
G938A mutation
F1, P2 F1, S2 S1, P2 F1, P2
mixed with 500 μl PI (50 μg·ml−1) dye and 10 μl RNase A (50 μg·ml−1) and incubated for 30 min at 37 °C in the dark. Flow cytometry (Szeberenyl, 2007) was used to analyze the cell cycle. 2.9. Statistical analysis Data of qPCR results were reported as mean ± S.D. and the relative fold change in the expression of mRNA was calculated using the method of 2−ΔΔct. Statistical analysis of qPCR results was done using one-way ANOVA (Analysis of Variance) of SPSS 13.0 for Windows. 3. Results 3.1. Nested PCR amplification and double mutations of bMSTN The full length of bMSTN sequence was amplified from total RNA as a 1736 bp fragment (Fig. 1-B), and this product was served as the template for the nested PCR amplification for an 1128 bp fragment (Fig. 1-B). The PCR products were ligated into the pMD18-T vector and bMSTN sequence was analyzed using DNAStar and BLAST. The results of the sequencing showed that the vector construction was successful. The A224C and G938A mutations in bMSTN-mut gene were introduced by fusion PCR amplification (Fig. 1-B). A pair of specific primers with a Kozak sequence and the Nhe I and EcoR I sites were used for PCR amplification for the coding region of the bovine bMSTN-mut gene with a sequence length of approximately 1128 bp. The products were ligated into the pMD18-T-Simple vector and confirmed with Nhe I/EcoR I digestion (Fig. 2-A). The mutations were confirmed by sequencing (Fig. 1-C). 3.2. The construction of the pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector and its expression in bovine fibroblast cells The bMSTN-mut insert from PMD18-T-Simple–bMSTN-mut plasmid was cloned into pEF1a-IRES-DsRed-Express2 vector at Nhe I and EcoR I sites to form pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector and confirmed by the Nhe I and EcoR I digestion and sequencing (Fig. 2-A, B).
Table 4 The primer sequences for fragment amplifications. Primer sequences
Lengths of products (bp)
Anneal temperatures (°C)
M1:5′ TGTAACCTTCCCAGAACCAG 3′ M2: 5′ GCAATAATCCAATCCCATCC 3′ P21-F: 5′ GAGACCGTGGTTGGGAGA 3′ P21-R: 5′ CCACTGGACCAAAGAGGC 3′ CDK2-F: 5′ CAAGTTGACGGGAGAAGTGGT 3′ CDK2-R: 5′ CTTTATGAGCGGAAGAGGAAT 3′ β1: 5′ AGAGCAAGAGAGGCATCC 3′ β2: 5′ TCGTTGTAGAAGGTGTGGT 3′
186
60
155
60
247
60
103
60
cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95 cycles (95
Lengths °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s, 61 s, 67 s, 68 s, 68 s, 65 s, 65 s, 68 s, 68
°C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s, 72 s, 72 s, 72 s, 72 s, 72 s, 72 s, 72 s, 72
°C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30 °C 30
s) s) s) s) s) s) s) s)
223 bp 925 bp 1128 bp 937 bp 213 bp 1128 bp
Red fluorescence could be observed in bovine fibroblast cells 24 h after transfection with pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid. The percentage of positive cells were approximately 45%. Normal cells did not exhibit any red fluorescence, while both the bovine fibroblast cells transfected with the pEF1a-IRESDsRed-Express2 empty vector and those transfected with the recombinant plasmid showed strong red fluorescence (Fig. 3-A). The expression of the bMSTN-mut mRNA was detected using semi-quantitative PCR (Fig. 3-B-I). The results showed that the PCR band of the positive group was brighter than that of the control group. The relative fold change in the expression of bMSTN-mut mRNA was examined by qPCR and the results showed that positive group had a significant increase in bMSTN-mut transcript levels (50.57 fold, p b 0.01) (Fig. 3-B-II). The results of the Western blotting analysis indicated that the bMSTN protein expression in the positive cells was up-regulated compared with that in the control group cells (Fig. 3-B-III). The results of the Western blotting analysis were consistent with the qPCR results. 3.3. Analysis of P21 and CDK2 gene expression and detection of cell cycle by flow cytometry The measurement of the P21 gene expression level was conducted using the same methods as those for bMSTN-mut gene expression. The P21 gene mRNA in the pEF1a-IRES-DsRed-Express2–bMSTN-mut transfection group was significantly reduced compared to that in the control group (Fig. 4-A-I, A-II, p b 0.05). The Western blotting result for P21 showed that the protein expression of the positive cells was downregulated in comparison to that of the control group cells (Fig. 4-A-III), which was consistent with the qPCR results. The CDK2 gene expression was examined using semi-quantitative PCR and qPCR. The CDK2 gene mRNAs were nearly identical in both the positive group and the control group (Fig. 4-B-I, B-II, p N 0.05). The Western blotting analysis results for CDK2 indicated that the protein expression level in the positive cells was up-regulated in comparison with that in the control group cells (Fig. 4-B-III). Forty-eight hours after transfection, the ratio of bovine fibroblast cells in each cell cycle phase was determined using flow cytometry. The G0/G1-phase ratio in the positive group was lower, and the proportion of cells in the S-phase was higher, in comparison with that in the control group. These results indicated that the number of cells in active DNA synthesis stage in the positive group was significantly higher than that in the control group (Fig. 4-C). 4. Discussion In the present study, we took full advantage of directional cloning in the construction of the eukaryotic expression vector pEF1a-IRES-DsRedExpress2–bMSTN and A224C and G938A mutations were successfully introduced into bMSTN gene using fusion PCR. Meanwhile, the Kozak sequence (GCCACC) (Xu et al., 2010) was added to the sense primer for bMSTN amplification to ensure the efficient expression of the optimized plasmid. Transfection of bMSTN-mut into bovine fibroblast cells showed that this mutated myostatin could inhibit the expression of P21 but
F. Gao et al. / Gene 540 (2014) 171–177
175
Fig. 2. A: The digestion identification results of the pMD18-T-Simple–bMSTN-mut recombinant plasmid and pEF1a-IRES-DsRed-Express2–bMSTN-mut eukaryotic expression vector. P1: Double digestion by Nhe I and EcoR I; P2: single digestion by Nhe I; P3: single digestion by EcoR I; P4: the pMD18-T-Simple–bMSTN-mut plasmid; M1: DL2000 Marker; F1: double digestion by Nhe I and EcoR I; F2: single digestion by Nhe I; F3: single digestion by EcoR I; F4: the pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid; M2:DL15000 Marker; B: the sequencing results of pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid.
increase the expression of CDK2 when analyzed with Western blot and qPCR. P21 and CDK2 genes were the factors associated with cell cycle (La Thangue, 1996; Langley et al., 2004). Therefore, we believed that bMSTN-mut might have a role in the regulation of cell cycle. The cell
cycle was detected after transfection, the results showed that the transfection of bMSTN-mut also resulted in changes of cell cycle phase in transfected cells with a lower G0/G1-phase ratio and a higher S-phase ratio, which indicated that the number of cells in active DNA synthesis
Fig. 3. A: Red fluorescence could be observed under a fluorescence microscope 24 h after the transfection. The expression rate of red fluorescence in bovine fibroblast cells was 45%. Positive group: transfecting bovine fibroblast cells with pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid, the fluorescence was observed under a fluorescence microscope (I: ray fluorescence, II: normal light); control group: transfecting bovine fibroblast cells with pEF1a-IRES-DsRed-Express2 empty vector, the fluorescence was observed under a fluorescence microscope (III: ray fluorescence, IV: normal light) (×100). B: The expression of bMSTN-mut gene in bovine fibroblast cells. I: The detection results using semi-quantitative PCR, the PCR band of the positive group was stronger than that of the control group; II: the relative fold change in the expression of bMSTN-mut mRNA was examined by qPCR. Bovine fibroblast cells transfected with the recombinant plasmid had a significant 50.5667 ± 0.7-fold increase in bMSTN-mut and intracellular bMSTN transcript levels (p b 0.01); III: Western blotting analysis indicated that the total bMSTN-mut and intracellular bMSTN protein expressions in the positive cells were up-regulated compared with those in the control group cells.
176
F. Gao et al. / Gene 540 (2014) 171–177
Fig. 4. A: Analysis of P21 and CDK2 gene expressions. I: The detection results using semi-quantitative PCR, the PCR strip of the cells transfected with the empty vector was stronger than that of the positive group in P21 group; II: the relative fold change in the expression of P21 mRNA in bovine fibroblast cells after transfection. The fibroblast cells transfected with pEF1a-IRESDsRed-Express2 vector displayed a significant 1.3875 ± 0.1404-fold increase in P21 transcript levels compared with the positive group cells. (p b 0.05); III: Western blot analysis for P21. The results indicated that the protein expression of the positive cells was down-regulated in comparison to that of the control group cells. B: The detection of cell cycle by flow cytometry. I: The detection results using semi-quantitative PCR, the PCR strips in both positive group and control group were basically consistent in CDK2 group. II: The relative fold change in expression of CDK2 mRNA in fibroblast cells after transfection. The fibroblast cells treated with pEF1a-IRES-DsRed-Express2 empty vector displayed a 0.9295 ± 0.1751-fold decrease in CDK2 transcript levels. (p N 0.05); III: Western blot analysis for CDK2. The protein expression level in the positive cells was up-regulated in comparison with that in the control group cells. C: The detection of cell cycle by flow cytometry. The G0/G1-phase ratio in the positive group was lower, and the proportion of cells in the S-phase was higher, in comparison with that in the control group.
stage in the transfected group was significantly higher than that in the control group. Previous studies have shown that the transgenic mice with D76A mutation in MSTN gene leader peptide resulted in a thicker muscle fiber diameter and a significant increase in the number of muscle fibers (Lee, 2008). Injection of these fragments with the D76A mutation into newborn rat pups significantly increased their skeletal muscle and the muscle fiber of malnourished pups became thicker, and the symptoms of malnutrition were also reduced (Qiao et al., 2008). In the present study, site-directed mutagenesis was conducted on the coding region of bMSTN leader peptide and the mutant myostatin gene was used for immunization. This approach may be used as an alternative to the comparatively difficult and lengthy transgenic technique for muscle growth manipulation. We would take the method of gene immunization for further validation in vivo in order to find a more safe and convenient way to improve the quality of bovine muscle. The transition of cell cycle from G1 to S phase was prevented by MSTN in cultured myoblasts (Saltis, 1996). The activity of CDK2 kinase was reduced due to bMSTN-mut transfection, which in turn lead to the accumulation of non-phosphorylated Rb protein binding with E2F transcription factor, resulting in the prevention of transcription from G1 to S phase (Nevins, 1992). It has been reported that the 76th aspartic acid of mice myostatin propeptide was the specific cutting site of BMP-1/TLD metalloproteinase family. The MSTN precursors could release the Cterminal dimer after being cut by metalloproteinase. The released Cterminal dimer could then bind with corresponding receptors to activate downstream signaling pathways. Although it could still bind with C-terminal dimer after the aspartic acid mutation into alanine, the C-terminal could not be released from the complex by BMP-1/TLD protease, thus inhibited the function of MSTN gene (Wolfman et al., 2003). In our results, the lower expression level of P21 gene was correlated with an increase of CDK2 gene expression level in bovine fibroblast cells transfected with bMSTN-mut, and the number of cells in active DNA synthesis stage was significantly higher. These results indicated that the mature peptide encoded by the mutated bMSTN gene was inactive due to the mutations introduced into the structure of the leader
peptide, which resulted in tighter bindings of the pro-peptide with the C-terminal dimers. In conclusion, site-directed mutagenesis of the coding region of the leader peptide was conducted using fusion PCR and the effect of bMSTN-mut gene on bovine fibroblast cells was investigated. The final results showed that the pEF1a-IRES-DsRed-Express2–bMSTN-mut recombinant plasmid could effectively promote the proliferation of bovine fibroblast cells. It should be helpful for further study on the role of bMSTN gene in regulating of bovine muscle growth. Conflict of interest The authors declare no conflict of interest. Acknowledgments This work was supported by the Jilin Scientific and Technological Development Program (Nos. 20110229, 20130522084JH and 20120226), the National Natural Science Foundation of China (no. 31372278), the National R.&D. Project of Transgenic Organisms of Ministry of Science and Technology of China (2013ZX08007-001), and the National High Technology Research and Development Program (863 Program, no. 2013AA102505). References Cadwell, R.C., Joyce, G.F., 1994. Mutagenic PCR. PCR Methods Appl 3, S136–S140. Cha-Aim, K., Hoshida, H., Fukunaga, T., Akada, R., 2012. Fusion PCR via novel overlap sequences. Methods in Molecular Biology 852, 97–110. Ferrell, R.E., Conte, V., Lawrence, E.C., Roth, S.M., Hagberg, J.M., Hurley, B.F., 1999. Frequent sequence variation in the human myostatin (GDF8) gene as a marker for analysis of muscle-related phenotypes. Genomics 62, 203–207. Grobet, L., Martin, L.J., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner, S., Menissier, F., Massabanda, J., Fries, R., Hanset, R., Georges, M., 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics 17, 71–74. Hulmi, J.J., Ahtiainen, J.P., Kaasalainen, T., Pollanen, E., Hakkinen, K., Alen, M., Selanne, H., Kovanen, V., Mero, A.A., 2007. Postexercise myostatin and activin IIb mRNA levels: effects of strength training. Medicine and Science in Sports and Exercise 39, 289–297.
F. Gao et al. / Gene 540 (2014) 171–177 Kambadur, R., Sharma, M., Smith, T.P., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research 7, 910–916. La Thangue, N.B., 1996. E2F and the molecular mechanisms of early cell-cycle control. Biochemical Society Transactions 24, 54–59. Langley, B., Thomas, M., McFarlane, C., Gilmour, S., Sharma, M., Kambadur, R., 2004. Myostatin inhibits rhabdomyosarcoma cell proliferation through an Rb-independent pathway. Oncogene 23, 524–534. Lee, S.J., 2008. Genetic analysis of the role of proteolysis in the activation of latent myostatin. PLoS One 3, e1628. Lee, S.J., McPherron, A.C., 1999. Myostatin and the control of skeletal muscle mass. Current Opinion in Genetics and Development 9, 604–607. McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83–90. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genetics 3, e79. Nevins, J.R., 1992. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science 258, 424–429. Nishi, M., Yasue, A., Nishimatu, S., Nohno, T., Yamaoka, T., Itakura, M., Moriyama, K., Ohuchi, H., Noji, S., 2002. A missense mutant myostatin causes hyperplasia without hypertrophy in the mouse muscle. Biochemical and Biophysical Research Communications 293, 247–251. Nunez-Acuna, G., Gallardo-Escarate, C., 2014. The myostatin gene of Mytilus chilensis evidences a high level of polymorphism and ubiquitous transcript expression. Gene 536, 207–212. Qiao, C., Li, J., Jiang, J., Zhu, X., Wang, B., Li, J., Xiao, X., 2008. Myostatin propeptide gene delivery by adeno-associated virus serotype 8 vectors enhances muscle growth and ameliorates dystrophic phenotypes in mdx mice. Human Gene Therapy 19, 241–254.
177
Roth, S.M., Martel, G.F., Ferrell, R.E., Metter, E.J., Hurley, B.F., Rogers, M.A., 2003. Myostatin gene expression is reduced in humans with heavy-resistance strength training: a brief communication. Experimental Biology and Medicine (Maywood, N.J.) 228, 706–709. Saltis, J., 1996. TGF-beta: receptors and cell cycle arrest. Molecular and Cellular Endocrinology 116, 227–232. Saunders, M.A., Good, J.M., Lawrence, E.C., Ferrell, R.E., Li, W.H., Nachman, M.W., 2006. Human adaptive evolution at myostatin (GDF8), a regulator of muscle growth. American Journal of Human Genetics 79, 1089–1097. Schuelke, M., Wagner, K.R., Stolz, L.E., Hubner, C., Riebel, T., Komen, W., Braun, T., Tobin, J.F., Lee, S.J., 2004. Myostatin mutation associated with gross muscle hypertrophy in a child. New England Journal of Medicine 350, 2682–2688. Sharma, M., Kambadur, R., Matthews, K.G., Somers, W.G., Devlin, G.P., Conaglen, J.V., Fowke, P.J., Bass, J.J., 1999. Myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. Journal of Cellular Physiology 180, 1–9. Szeberenyl, J., 2007. Analysis of the cell cycle by flow cytometry. Biochemistry and Molecular Biology Education 35, 153–154. Wehling, M., Cai, B., Tidball, J.G., 2000. Modulation of myostatin expression during modified muscle use. FASEB Journal 14, 103–110. Wolfman, N.M., McPherron, A.C., Pappano, W.N., Davies, M.V., Song, K., Tomkinson, K.N., Wright, J.F., Zhao, L., Sebald, S.M., Greenspan, D.S., Lee, S.J., 2003. Activation of latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proceedings of the National Academy of Sciences of the United States of America 100, 15842–15846. Xu, H., Wang, P., Fu, Y., Zheng, Y., Tang, Q., Si, L., You, J., Zhang, Z., Zhu, Y., Zhou, L., Wei, Z., Lin, B., Hu, L., Kong, X., 2010. Length of the ORF, position of the first AUG and the Kozak motif are important factors in potential dual-coding transcripts. Cell Research 20, 445–457. Yao, E., Tavis, J.E., Virahep, C.S.G., 2005. A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame. Virology Journal 2, 88.
