The Drosophila Chmp1 protein determines wing cell fate through regulation of epidermal growth factor receptor signaling.

Research Article

Developmental Dynamics DOI 10.1002/dvdy.24140

Title: The Drosophila Chmp1 protein determines wing cell fate through regulation of Epidermal Growth Factor Receptor signaling. Authors: Meagan Valentine1, Justin Hogan2§ and Simon Collier123* Author affiliations: 1. Department of Biomedical Sciences, Marshall University, Huntington, West Virginia, USA 2. Department of Biological Sciences, Marshall University, Huntington, West Virginia, USA 3. Department of Genetics, University of Cambridge, Cambridge, UK Grant sponsor: NSF award 0843028

Developmental Dynamics

§ Justin Hogan’s present address is Division of Rheumatology and Pathology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA Correspondence to: Simon Collier, University of Cambridge, Department of Genetics, Downing Site, Cambridge, CB2 3EH, UK. E-mail: [email protected] Running Title: Drosophila Chmp1 regulates cell fate Key Words: ESCRT, DER, EGFR, multivesicular body Key Findings: Chmp1 is an essential gene for Drosophila development Chmp1 knockdown in the Drosophila wing causes a fate change from intervein to vein cell, and genetic interactions suggest that Chmp1 negatively regulates DER signaling Chmp1 localizes to the late endosome, compatible with its role in MVB generation. Fly lines were generated that can express wild-type or epitope-tagged Chmp1 under Gal4 control. The Drosophila wing provides a model for investigating the activity of other ESCRT components

Accepted Articles are accepted, unedited articles for future issues, temporarily published online in advance of the final edited version. © 2014 Wiley Periodicals, Inc. Received: Nov 19, 2013; Revised: Apr 11, 2014; Accepted: Apr 12, 2014


Abstract Background: Receptor down-regulation by the multivesicular body (MVB) pathway is critical for many cellular signaling events. MVB generation is mediated by the highly conserved ESCRT (0, I, II, and III) protein complexes. Chmp1 is an ESCRT-III component and a putative tumor suppressor in humans. However, published data on Chmp1 activity are conflicting and its role during tissue development is not well defined. Results: We investigated the function of Drosophila Chmp1 and found that it is an essential gene. In the wing, loss of Chmp1 activity causes a cell fate change from intervein to vein, and


interactions between Chmp1 and Drosophila Epidermal Growth Factor Receptor (DER) regulators suggest that Chmp1 negatively regulates DER signaling. Chmp1 knockdown also decreases Blistered expression, which is repressed by DER signaling. We find that Chmp1 protein localizes to the late endosome in Drosophila embryos, which is consistent with its effects on DER signaling resulting from its function in the ESCRT-III complex. Conclusions: Drosophila Chmp1 negatively regulates DER signaling, likely through its role in MVB formation. Loss of Chmp1 activity in the Drosophila wing induces a cell fate change from intervein to vein that should provide a useful tool for future studies of ESCRT protein activity.

2 John Wiley & Sons, Inc.

Page 2 of 34

Page 3 of 34


Introduction A critical event for cellular signaling is the down-regulation of transmembrane receptors through the multivesicular body (MVB) pathway. At the cell membrane, activated receptors are ubiquitinated, endoytosed, and incorporated into the MVB. The ESCRT (Endosomal Sorting Complexes Required for Transport) complexes and associated proteins form a highly conserved pathway that mediates MVB generation (Hurley, 2010). The ESCRT machinery aids in the formation of the MVB from the endosome by mediating the invagination of the endosomal membrane to form intralumenal vesicles (ILVs). This separates the receptors from the


cytoplasm, thereby silencing the signals. The ILVs are then delivered to the lysosome where the receptors are degraded. There are four ESCRT protein complexes (0, I, II, and III), all of which are required for MVB generation. ESCRT-0, -I and -II recognize ubiquitinated cargo on the endosomal membrane and incorporate it into forming ILVs. The ESCRT-III complex then provides the core function of the ESCRT machinery: the scission activity or ‘pinching off’ of the endosomal membrane to generate the ILVs of the MVB (Wollert et al., 2009; Hurley and Hanson, 2010). Chmp1 (Chromatin Modifying Protein, Charged Multivesicular Protein; also called Sal1 in maize, Did2 in yeast) is a component of the ESCRT-III complex. As an ESCRT-III component, Chmp1 binds the MIT (microtubule interaction and transport) domain of Vps4 through its MIT-interacting motif (MIM) (Obita et al., 2007). This binding mediates the ATP-dependent dissociation and recycling of ESCRT-III proteins, and so completes MVB formation (Nickerson et al., 2006). In addition to its role in ESCRT-III, Chmp1 functions in the cell nucleus as well, where it may be involved in gene silencing (Stauffer et al., 2001; Mochida et al., 2012). Most studies on Chmp1 have investigated its role in single cells, with few studies on its role in developing tissues. The results described in these studies are conflicting. For instance, in the model plant Arabidopsis thaliana (Spitzer et al., 2009) and the filamentous fungus Aspergillus nidulans (Hervas-Aguilar et al., 2010), loss of Chmp1 activity caused faulty protein 3 John Wiley & Sons, Inc.


sorting and defects in MVB generation. While protein sorting defects were also observed when Chmp1 was mutated in yeast, it was not required for ILV formation at the MVB (Nickerson et al., 2006; Obita et al., 2007). The MVB and protein sorting phenotypes associated with loss of Chmp1 are not necessarily lethal to the organism. For example, a study in Nicotiana benthamiana, a close relative of the tobacco plant, showed that loss of Chmp1 activity is not lethal and caused only slight changes in leaf color and morphology (Yang et al., 2004). Chmp1 was also found to be non-essential for Aspergillus nidulans (Hervas-Aguilar et al., 2010). However, in some cases


loss of Chmp1 is lethal. For example, a study in Arabidopsis, which carries two Chmp1 genes, Chmp1A and Chmp1B, found that loss of all Chmp1 activity caused lethal defects, such as failure to establish bilateral symmetry (Spitzer et al., 2009). Chmp1 was also essential in Zea mays, as loss of Chmp1 resulted in lethal embryonic defects (Shen et al., 2003). This implies that the phenotypes associated with loss of Chmp1 are species specific. Chmp1 also regulates growth. Cultured human cells showed severe mitotic defects occur in the absence of Chmp1 function (Bajorek et al., 2009; Morita et al., 2010), and studies in Aspergillus nidulans (Hervas-Aguilar et al., 2010), zebrafish, and human cell culture (Mochida et al., 2012) showed that loss of Chmp1 activity is associated with reduced growth. In contrast, Chmp1 behaved as a tumor suppressor in mammalian cell culture, and reduced Chmp1 expression has been linked to pancreatic and renal cancer in humans (Li et al., 2008; You et al., 2012). Clearly, the phenotypes caused by loss of Chmp1 vary between different organisms and cell types. This might be expected as these phenotypes will depend upon the specific pathways impacted by reduced MVB biogenesis in these systems. In addition, some phenotypes may result from loss of the nuclear function of Chmp1. For example, studies show that Chmp1 regulates the activity of Ataxia Telangiectasia Mutated (ATM) (Manohar et al., 2011) and p53 (Li


Page 4 of 34

Page 5 of 34


et al., 2008), as well as the expression of BMI1/INK4 (Mochida et al., 2012) in mammalian cells through its nuclear function. Most studies on Chmp1 have been completed in single cell culture, so the function and significance of Chmp1 during tissue development is not well understood. We have used Drosophila melanogaster as a model in what we believe is the first investigation of Chmp1 function in invertebrates. Using fly lines expressing RNAi targeted at Chmp1 mRNA, and novel lines that allow for over-expression of wild-type or epitope-tagged Chmp1, we investigated the localization and function of Chmp1 in developing wings. Our results suggest that Chmp1


negatively regulates Drosophila Epidermal Growth Factor Receptor (DER) signaling, most likely through its involvement in the MVB pathway as a component of the ESCRT-III complex. We anticipate that the fate choice between intervein and vein cells in the wing, which is mediated by DER signaling, may prove to be a sensitive assay to explore the activity of other ESCRT components in the future. Results Drosophila Chmp1 is highly conserved and essential The Drosophila Chmp1 protein (Flybase ID: FBgn0036805) is encoded by the Chmp1 gene (CG4108), which is located in region 75D6 on the left arm of the third chromosome (Figure 1A). The Drosophila genome carries a single Chmp1 gene, whereas the genomes of many model organisms contain two highly homologous Chmp1 genes: Chmp1A and Chmp1B. This makes Drosophila an ideal model to study Chmp1 function because there is not the complication of genetic redundancy arising from a duplicated Chmp1 gene. Alignment of the Drosophila Chmp1 protein sequence with human Chmp1A and Chmp1B reveals that they share a conserved nuclear localization signal (NLS) as well as a MIM domain, (D/E/Q)-XX-L-XX(Q/R)L-XX-L(K/R) (Figure 1B). Drosophila and human Chmp1 proteins also share a Snf-7 domain, which is commonly found in proteins that are involved in protein sorting, as well as a Vps24 domain, which is found in proteins involved in secretion (Figure 1B). In sequence, 5 John Wiley & Sons, Inc.


Drosophila Chmp1 is most like human Chmp1B; they are 74% identical and 90% similar in amino acid sequence (Figure 1B). Human Chmp1A and 1B share most known binding partners; however Spastin, a microtubule severing enzyme linked to hereditary spastic paraplegia, is reported to bind Chmp1B but not Chmp1A, suggesting that Chmp1A and 1B have overlapping but not identical functions (Reid et al., 2005; Yang et al., 2008; Yorikawa et al., 2008). Through co-immunoprecipitation assays and mass spectroscopy, Drosophila Chmp1 has been shown to bind many proteins, including Vps4 and the Drosophila homologue of Increased Sodium Tolerance-1 (Ist1), CG10103 (Guruharsha et al., 2011; Marygold et al., 2013). Reports show


that Chmp1 also binds Ist1 and Vps4 in both yeast (Obita et al., 2007; Xiao et al., 2009) and human cultured cells (Howard et al., 2001; Bajorek et al., 2009). This suggests that Chmp1 function is conserved between yeast, humans, and Drosophila. In summary, because Drosophila expresses only one Chmp1 protein that shares functional domains and multiple binding partners with Chmp1 in other species, we believe it provides a good model to study the Chmp1 function. Most information on the activity of Chmp1 has been inferred from biochemical studies in single cells, so little is known about its role in tissue development and differentiation. Drosophila Chmp1 is expressed throughout development and in all larval and adult tissues assayed (Graveley et al., 2011; Marygold et al., 2013). We assessed the effects of loss of Chmp1 using fly lines that allowed for targeted knockdown of Chmp1 expression (UAS-Chmp1-RNAi). These lines expressed hpRNA under the control of the Gal4 UAS system. We used two independent lines, HM05117 from the Transgenic RNAi Project (TRiP) at Harvard Medical School (Ni et al., 2008) and 21788GD from the Vienna Drosophila RNAi Center (VDRC) (Dietzl et al., 2007) that targeted different regions of the Chmp1 mRNA. Ubiquitous knockdown of Chmp1 throughout fly development using tubulin-Gal4 or actin5c-Gal4 drivers using both RNAi lines was lethal at or before the pupal stage. Occasional female escapers were observed when knockdown was performed with the 21788GD Chmp1-RNAi line, which might indicate a lower level of 6 John Wiley & Sons, Inc.

Page 6 of 34

Page 7 of 34


knockdown activity in the VDRC line. The phenotypes of these escapers included thickened wing veins, rough eyes, and a general failure to thrive. These results suggest that Chmp1 is essential for viability in Drosophila. Chmp1 knockdown produces cell fate changes in the wing Because ubiquitous Chmp1 knockdown was lethal we used the Gal4 UAS system to limit knockdown to the wing, a well-characterized tissue that is not essential for Drosophila development. Knockdown of Chmp1 using the 21788GD Chmp1-RNAi line in combination with the MS1096-Gal4 driver, which expresses primarily on the dorsal side of the wing, caused


thickening of all the dorsal wing veins (L3, L5, and distal L4) when flies were cultured at 28oC (Figure 2B). A similar, but stronger, vein phenotype was also observed using the HM05117 Chmp1-RNAi line also at 28oC (Figure 2C). Since both Chmp1-RNAi lines produced vein thickening, it follows that this phenotype was due to Chmp1 knockdown rather than to off target effects. The stronger vein phenotype associated with the HM05117 line supports the idea that this line provides more effective Chmp1 knockdown than the 21788GD line. The strength of vein phenotype associated with Chmp1 knockdown increased with culture temperature, most likely due to the temperature-sensitivity of the Gal4-UAS system (Duffy, 2002). At 30oC it became difficult to differentiate between vein and intervein tissue (Figure 2D), implying that Chmp1 plays a fundamental role in determining wing vein differentiation. We chose a culture temperature of 28oC for this study as this produced a moderate vein phenotype that allowed us to observe both enhancement and suppression of the phenotype by candidate genetic interactors, The Chmp1 knockdown vein phenotype at 28oC was enhanced by concomitant heterozygosity for chromosomal deletions [Df(3L)BSC416 and Df(3L)BSC832] that remove the Chmp1 gene, further supporting the finding that the thick veins observed were due to reduced Chmp1 (Figures 1A, 2E, 2F and 2K). Thickened wing veins are classically associated with cell fate changes in the wing (De Celis, 2003), so it is likely that the thickened veins observed under Chmp1 knockdown are due to a change in cell fate, rather than increased proliferation of vein cells. 7 John Wiley & Sons, Inc.


Supporting this, we observe that when Chmp1-RNAi is expressed under the control of the ptcGal4 driver, which drives expression between the L3 and L4 wing veins, the L3 and L4 veins remain parallel, but the amount of vein tissue between them varies from proximal to distal on the wing (Figure 2G). Therefore, we conclude that Chmp1 negatively regulates wing vein size and favors an intervein cell fate over a vein fate. To further evaluate Chmp1 function in Drosophila, transgenic fly lines were generated that allowed for over-expression of either the wild-type Chmp1 protein (UAS-Chmp1) or an Nterminally his-myc (HM) tagged Chmp1 (UAS-HM-Chmp1). Lines were recovered with


independent transgene insertions into either the second or third chromosome. Expression of wild-type Chmp1 concomitant with Chmp1-RNAi both under the MS1096-Gal4 driver completely rescued the thick wing vein phenotype in over 60% of wings, while partial rescue was observed in 34% of wings (Figures 2H-2K). Expression of HM-Chmp1 fully rescued the Chmp1 knockdown vein phenotype in 13% of wings, and partial rescue was achieved in over 80% of wings analyzed (Figures 2H-2K). The rescue observed in these experiments was not simply the result of reduced Gal4 binding to the Chmp1-RNAi promoter due to the presence of a second UAS promoter, as expression of a gratuitous protein (UAS-GFP) concomitant with Chmp1-RNAi never fully rescued the wing vein phenotype and provided partial rescue in only 30% of wings. These results suggest that the UAS-Chmp1 and UAS-HM-Chmp1 transgenes express functional Chmp1 protein, though the HM-Chmp1 protein may be less active or less stable than the wild-type Chmp1 protein. Moreover, the finding that over-expressed Chmp1 can rescue the thick vein phenotype further supports our conclusion that this phenotype results specifically from Chmp1 knockdown, rather than through off-target effects, and therefore our proposal that Chmp1 promotes intervein cell fate over vein cell fate. When Chmp1 was knocked down in the posterior wing under the control of the en-Gal4 driver, only the posterior wing veins, L4 and L5 were thickened. Interestingly, cells carrying additional hairs and with altered hair polarity were also observed in these wings, although they 8 John Wiley & Sons, Inc.

Page 8 of 34

Page 9 of 34


were not observed when Chmp1 was knocked down throughout the dorsal wing with MS1096Gal4 (Figures 2N and 2O).The additional hairs and polarity defects were only present adjacent to the anterior boundary of en-Gal4 expression, while the wing hairs in the rest of the wing remained wild-type, suggesting that a gradient of Chmp1 expression is required to disrupt wing hair patterning,. This may indicate a role for Chmp1 in the regulation of pathways that establish planar polarity in wing cells, such as the Frizzled (Fz) Planar Cell Polarity (PCP) pathway. Driving Chmp1 knockdown on the dorsal wing with MS1096-Gal4 produced an upward curving of the wing at the margin, resulting in a concave wing. This phenotype is likely caused


by a reduction in the area of the dorsal wing surface, perhaps due to smaller cell size. During normal wing development, each wing cell produces a single hair. This means that hair density on the wing surface gives an indication of the apical surface size of wing cells (Dobzhansky, 1929; Fristrom et al., 1994). When Chmp1 knockdown was driven by MS1096-Gal4 or en-Gal4, intervein regions displayed increased wing hair density (Figures 2L and 2M). Since the hairs were still regularly spaced, we conclude that the increased hair density arose from smaller wing cell size rather than from normal sized cells carrying additional hairs. The Chmp1 knockdown phenotype is modified by regulators of the DER In the Drosophila wing, the DER signaling pathway promotes the development of wing veins and vein cell fate. So the thickened wing veins observed with Chmp1 knockdown might be caused by over-active DER signaling. This could result from a failure of ESCRT machinery to down-regulate the DER through MVB generation. If Chmp1 knockdown enhances the DER signal, then introducing gene mutations that reduce DER signaling into a Chmp1 knockdown wing should attenuate the wing vein phenotype. To test this, Chmp1 was knocked down in wings heterozygous for loss of function alleles of two positive regulators of the DER signaling pathway, rhomboid (rhove-1) and vein (vn1). In Chmp1 knockdown wings that were heterozygous for both the vn1 and rhove-1 alleles, the wing vein phenotype was significantly suppressed (Figures 3E and 3K). Wings that are heterozygous for vn1, rhove-1 alone show normal vein 9 John Wiley & Sons, Inc.


development, suggesting that the suppression of the Chmp1 knockdown phenotype is not just an additive effect. Significant rescue of the Chmp1 knockdown phenotype was also observed in vn1 heterozygous wings, however, no rescue was observed in rhove-1 heterozygous wings (Figures 3C, 3D, and 3K). An interaction with Vn and not Rho is surprising, especially considering the synergistic role that these two proteins appear to have in the wing (DiazBenjumea and Garcia-Bellido, 1990; Garcia-Bellido et al., 1994; Martin-Blanco et al., 1999). This could be due to the fact that the Rho protein is a strong DER activator, while the Vn protein is considered a weaker activator (Sturtevant et al., 1993; Schnepp et al., 1998). Thus, reduced


levels of Rho might still activate DER sufficiently, whereas reduced Vn may not provide sufficient activation. Chmp1 knockdown in a wing with reduced activity of Vn, a positive regulator of the DER, weakened the Chmp1 knockdown phenotype, supporting the idea that Chmp1 negatively regulates DER signaling. If this is the case, then reducing activity of negative regulators of DER signaling should enhance the Chmp1 knockdown phenotype. To test this, Chmp1 was knocked down in wings heterozygous for loss of function alleles of the negative regulators of DER signaling, kekkon-1 (kek1), sprouty (sty) or argos (aos). Chmp1 knockdown wings that were heterozygous for the kek1DG23812, sty∆5, aosrlt, aosW11, or aos∆7 alleles had wing veins that were significantly thicker than those observed with Chmp1 knockdown alone (Figures 3F-3K). Wings heterozygous for kek1DG23812, sty∆5, aosrlt, aosW11, or aos∆7 alone showed normal vein development, suggesting this was not simply an additive effect. The opposite effects of loss of positive and negative DER regulators on the Chmp1 knockdown phenotype are consistent with a role for Chmp1 in negative regulation of the DER signaling pathway. Blistered expression, which is negatively regulated by DER signaling, is reduced by Chmp1 knockdown If Chmp1 regulates DER signaling, then the expression of genes regulated by the DER signaling pathway should be altered under Chmp1 knockdown conditions. Clones of Chmp1 10 John Wiley & Sons, Inc.

Page 10 of 34

Page 11 of 34


knockdown (with 21788GD) marked by GFP expression were generated using the FLP/FRT system in the imaginal wing disc. We analyzed the effect of Chmp1 knockdown on expression of the Blistered (Bs) protein by staining the discs with an anti-Bs antibody. Bs is negatively regulated by DER signaling and its down-regulation is likely a required event during vein cell differentiation (Roch et al., 1998). Consequently, Bs is normally expressed in the intervein regions of the wing disc and repressed in provein regions (Figure 4A). If Chmp1 knockdown causes an over-active DER signaling pathway, then Bs expression should be decreased in Chmp1 knockdown clones. We found that large clones (>120 cells) of Chmp1 knockdown that


spanned vein/intervein regions reduced Bs expression within the clone (Figures 4B, B’ and 4C, C’). However, smaller clones of Chmp1 knockdown did not have an observable effect on Bs expression even though they could sometimes induce vein formation (see below, Figure 4F). This could be due to our observing Bs levels in imaginal disc clones, when the final fate decision between vein and intervein cell does not occur until the pupal stage (de Celis et al., 1995; Blair, 2007). We also generated clones with both Chmp1 (HM05117) and forked (33200GD) knockdown in the developing wing. The forked hair phenotype provided a cell autonomous marker to identify Chmp1 knockdown clones in adult wings. We observed that Chmp1 knockdown clones had smooth edges, a characteristic that was also observed of bs- clones (Roch et al., 1998), which supports our finding that Bs expression was reduced in the Chmp1 knockdown clones. Clones of Chmp1 knockdown that overlapped wing veins caused a fate change from intervein to vein cell, resulting in widening of the wing vein (Figure 4D). This cell fate change was restricted to clone cells, implying that the effect of Chmp1 knockdown is cell autonomous. In some cases, Chmp1 knockdown clones located within the intervein had no effect on cell fate (Figure 4E). However, cells within the clones often displayed characteristics of vein cells, including darkened pigmentation and increased hair density (Figure 4F), which are also characteristics of bs- clone cells (Fristrom et al., 1994). 11 John Wiley & Sons, Inc.


Therefore, it appears that Chmp1 knockdown alone is not sufficient to induce a vein fate. Rather, the decision of a Chmp1 knockdown cell to become a vein cell appears to be influenced by its position within the wing. For example, Chmp1 knockdown cells within provein territories appear more likely to differentiate as vein than cells within intervein regions. In Chmp1 knockdown clones located within intervein regions, only a proportion of cells within the clone adopt a vein fate, and these were normally clustered (Figure 4F). Indeed, it appears that the regions of the wing that are most sensitive to Chmp1 loss are those where DER signaling is most active (i.e. at or near wing veins).


Drosophila Chmp1 localizes to the late endosome Most studies on the subcellular localization of Chmp1 have been completed in single cells rather than in developing tissues, and different studies have shown different localizations for Chmp1. As we have shown that the UAS-Chmp1 and UAS-HM-Chmp1 over-expression lines provide rescue of Chmp1 knockdown and cause only occasional minor localized phenotypes when strongly over-expressed (see below, Figures 5G-5J), the UAS-HM-Chmp1 line provided a suitable way to study the subcellular localization of the Chmp1 protein in a developing tissue. HM-Chmp1 and GFP (to mark HM-Chmp1-expressing cells) were expressed in the Drosophila embryo under the en-Gal4 driver, which drives in the anterior compartment of each parasegment. An anti-c-myc antibody was used to detect HM-Chmp1, which was only detected in GFP-expressing cells, and was mostly localized apically and to the membrane of the embryonic epithelial cells (Figures 5E and 5F). A similar subcellular localization was observed in epithelial cells of the third instar larval wing disc (Figures 5A-5D’). Association to the membrane is consistent with the charged nature of the Chmp1 protein. These results suggest that the apical localization observed was the consistent localization of HM-Chmp1, as multiple transgenic lines and two separate tissues had similar HM-Chmp1 localizations. In the case of the wing disc staining, larvae were cultured at low temperature (18oC) to reduce HM-Chmp1 expression, and so lessen the possibility that Chmp1 over-abundance resulted in protein mis12 John Wiley & Sons, Inc.

Page 12 of 34

Page 13 of 34


localization. However, we acknowledge that it remains possible that a proportion of the observed HM-Chmp1 protein might display an aberrant localization compared to endogenous Chmp1. In cultured monkey cells (Howard et al., 2001) and Aspergillus nidulans (Hervas-Aguilar et al., 2010) Chmp1 localized to the early and late endosomes, and in Arabidopsis thaliana (Tian et al., 2007) Chmp1 localized to the late endosome/MVB. Localization to the endosome is consistent with the role of Chmp1 as a component of ESCRT-III in MVB generation. Therefore, if Chmp1 regulates DER signaling through its involvement in ESCRT, Chmp1 should localize to


the endosome. Localization of HM-Chmp1 at the endosome was investigated by looking for colocalization of HM-Chmp1 with Rab5 and Rab9, markers for the early and late endosome, respectively. To check for localization to the early endosome, HM-Chmp1 was expressed with the en-Gal4 driver in embryos, which were immunostained with anti-c-myc to detect HM-Chmp1 and a commercial antibody to detect Rab5. However, there was no obvious co-localization between HM-Chmp1 and Rab5, suggesting that Chmp1 does not localize to the early endosome (Figure 5E). To check for localization at the late endosome, a YFP-Rab9 fusion protein was used (Zhang et al., 2007). HM-Chmp1 and YFP-Rab9 were expressed with the en-Gal4 driver in embryos, which were immunostained to detect HM-Chmp1. Co-localization between HM-Chmp1 and YFP-Rab9 was frequently apparent, suggesting that a proportion of Chmp1 protein is present at the late endosome (Figure 5F). There are several reports of Chmp1 localization to the nucleus (Stauffer et al., 2001; Li et al., 2009; Manohar et al., 2011; Mochida et al., 2012), however, a nuclear localization was not observed in either wing or embryonic epithelial cells in this study. Localization of Chmp1 at the late endosome is compatible with Chmp1 functioning there as a component of the ESCRT-III complex. Thus, Chmp1 most likely regulates DER signaling as an ESCRT-III component involved in MVB generation, mediating down-regulation of the DER.



Chmp1 was detectable by immunostaining in the UAS-HM-Chmp1 lines that expressed an epitope-tagged Chmp1 (Figures 5A-5F), and our UAS-Chmp1 and UAS-HM-Chmp1 transgenic fly lines can rescue the Chmp1 knockdown phenotype (Figures 2H, 2I and 2K). This implies that these lines express functional Chmp1 protein. Over-expression of either Chmp1 or HM-Chmp1 in the dorsal wing using the MS1096-Gal4 driver or in the posterior wing with the en-Gal4 driver occasionally caused formation of weak deltas in the distal L4 wing vein and loss of the anterior cross vein (acv) (Figures 5G-5I). The delta phenotype observed could be caused by changes in DER signaling, but could also be due to altered Notch signaling. Both the Notch


(Jekely and Rorth, 2003; Vaccari and Bilder, 2005) and DER pathways (Chin et al., 2001; Jekely and Rorth, 2003) require ESCRT function for proper signaling in Drosophila, so it is likely that Chmp1 is involved in their regulation. In fact, one study identified Chmp1 as a possible negative regulator of Notch in Drosophila (Mummery-Widmer et al., 2009). If Chmp1 negatively regulated signaling of Notch, then over-expression might cause reduced Notch signaling, which could result in the deltas observed under Chmp1 over-expression. We took several approaches to test for Chmp1 regulation of Notch signaling, including testing whether Chmp1 knockdown modified the phenotype of the hypomorphic Notch allele, N55e11, looking for a role for Chmp1 in ligandindependent Notch signaling through Deltex, and assaying the ability for Chmp1 knockdown or over-expression to alter expression of the Notch target gene, enhancer of split. However, in each case our results were inconclusive, so despite the suggestive Chmp1 over-expression phenotypes, we cannot conclusively assign a role in Notch regulation to Drosophila Chmp1. In addition, in the UAS-Chmp1 lines, another wing phenotype was occasionally observed that included extra vein, cells carrying multiple wing hairs, and altered hair polarity (Figure 5J). These phenotypes may indicate Chmp1 involvement in other signaling pathways. For example, the multiple wing hairs and altered hair polarity, which were also observed when Chmp1 was knocked down, support a role for Chmp1 in PCP, possibly through the regulation of the Fz PCP pathway. In fact, the requirement of graded Chmp1 knockdown to alter PCP is reminiscent of 14 John Wiley & Sons, Inc.

Page 14 of 34

Page 15 of 34


the ability of Fz gradients to reorient PCP (Adler et al., 1997). Additionally, regulation through endocytosis has been shown for the Fz PCP Core proteins, Frizzled and Flamingo (Strutt and Strutt, 2008; Ho et al., 2010). The Chmp1 over-expression phenotype is most likely not due to a dominant negative effect that blocks ESCRT activity, as it differs from the knockdown phenotype. The rarity and mildness of the Chmp1 over-expression phenotypes suggests that fly development is generally insensitive to Chmp1 dosage, perhaps because Chmp1 is not a limiting component for ESCRT function, so increased Chmp1 does not increase ESCRT activity. Discussion


Many cellular signaling pathways share a common cascade structure, in which an extracellular signal is transmitted into the cell via a transmembrane receptor. Appropriately modulated signaling requires not just activation of the pathway, but also down-regulation. One method for down-regulation is the degradation of activated transmembrane receptors through the MVB pathway, which is mediated by the ESCRT protein complexes. In Drosophila, mutation of components of the ESCRT complexes can lead to prolonged signaling, which has been observed for several signaling pathways, including DER (Jekely and Rorth, 2003; Vaccari et al., 2009) and Notch (Jekely and Rorth, 2003; Vaccari and Bilder, 2005; Vaccari et al., 2009). In this study, we used Drosophila as a model to investigate the Chmp1 protein, a component of ESCRT-III, in what we believe to be the first genetic study Chmp1 function in invertebrates. Previous studies in a variety of organisms have implicated Chmp1 in MVB biogenesis (Spitzer et al., 2009), protein sorting (Nickerson et al., 2006; Obita et al., 2007; Hervas-Aguilar et al., 2010), mitosis (Bajorek et al., 2009; Morita et al., 2010), and both positive (Hervas-Aguilar et al., 2010; Mochida et al., 2012) and negative (Shen et al., 2003; Li et al., 2008; You et al., 2012) regulation of growth. We found that Chmp1 was required for proper development of Drosophila as ubiquitous Chmp1 knockdown was lethal. This is consistent with the finding that Chmp1 is essential in Arabidopsis thaliana (Spitzer et al., 2009), but contrasts with studies in Nicotiana benthamiana 15 John Wiley & Sons, Inc.


(Yang et al., 2004) and Aspergillus nidulans (Hervas-Aguilar et al., 2010), in which Chmp1 was not essential for survival. It appears that the deregulation of cell signaling resultant from loss of Chmp1 might cause inviability in particular organisms. This suggests that, although molecular interactions with Chmp1 appear to be conserved, the downstream consequences of Chmp1 loss may differ across species. We showed that Chmp1 knockdown in the wing causes a fate change, in which intervein cells that border the veins adopt a vein fate, likely due to increased DER signaling. A cell fate change associated with loss of Chmp1 has not been reported previously in animal studies,


although in Zea mays, loss of Chmp1 caused extra layers of aleurone cells to form (Shen et al., 2003). This phenotype may have been caused by a cell fate change driven by failure to downregulate transmembrane receptors through the MVB pathway (Shen et al., 2003; Tian et al., 2007). A role for Chmp1 in cell fate specification through receptor down-regulation is consistent with the function of Chmp1 in the ESCRT-III complex. Chmp1 binds Vps4, which completes ILV formation at the MVB. If loss of Chmp1 function caused incomplete ILV formation, this might result in retention of transmembrane receptors in the limiting membrane of the endosome, rather than incorporation into the ILV. Indeed, in Drosophila loss of activity of ESCRT-III components caused reduced ILV formation (Vaccari et al., 2009). Additionally, in Arabidopsis thaliana, Chmp1 mutation resulted in the presence of membrane proteins in the limiting membrane of the MVB (Spitzer et al., 2009) and the vacuole in yeast (Obita et al., 2007). Therefore, the increased DER signaling observed in Chmp1 knockdown wings may be a consequence of reduced or incomplete ILV formation, resulting in a failure to isolate the DER from the cytoplasm. Our observations suggest that Chmp1 knockdown causes wing vein thickening through a change in cell fate, from intervein to vein, rather than an increase in vein growth. This contrasts with the studies in mammalian cell culture that show Chmp1 regulates growth (Li et al., 2008; Mochida et al., 2012; You et al., 2012). As loss of Chmp1A activity was observed in 16 John Wiley & Sons, Inc.

Page 16 of 34

Page 17 of 34


pancreatic (Li et al., 2008) and renal (You et al., 2012) tumor cells, it is possible that an increase in EGFR signaling caused by loss of Chmp1A activity could contribute to tumorigenesis. Indeed, a gain of EGFR signaling is often observed in cancerous cells (Bardeesy and DePinho, 2002; Normanno et al., 2006; Ardito et al., 2012). Therefore, the Drosophila wing may provide a good model for investigating the role of ESCRT components in the deregulated EGFR signaling associated with tumorigenesis. In this study, we created transgenic fly lines that expressed either wild-type or HMtagged Chmp1 proteins under Gal4 UAS control, and we showed that these fly lines expressed


functional Chmp1 protein. Using these fly lines, we showed that Chmp1 localized to the late rather than the early endosome in cells of the Drosophila embryo. This finding contrasts with reports that Chmp1 was detected at both early and late endosomes in Aspergillus nidulans (Hervas-Aguilar et al., 2010) and mammalian cell culture (Howard et al., 2001), but is supported by studies in yeast showing that ESCRT-III components are only transiently present on the endosomal membrane late in MVB biogenesis (Babst et al., 1998; Babst et al., 2002). When over-expressed in mammalian cultured cells, ESCRT-III components localize to the endosome and the plasma membrane (Hanson et al., 2008). However, a proportion of HM-Chmp1 was detected at the late but not the early endosome, suggesting that Drosophila Chmp1 specifically localizes to the late endosome, rather than randomly associating with endosomal membranes. Localization to the late endosome is compatible with Chmp1 involvement in MVB biogenesis, down-regulating the DER. However, it remains possible that Chmp1 regulates DER signaling, and other pathways as well, through its nuclear function (Stauffer et al., 2001; Morita et al., 2010; Manohar et al., 2011; Mochida et al., 2012). We expect that the wing cell fate change from intervein to vein associated with Chmp1 knockdown can provide a sensitive assay for ESCRT function in Drosophila. The wing is a nonessential tissue, and since it is flat, vein phenotypes are easy to observe. The degree of vein thickening should be an indication of activity of ESCRT complexes in the wing. Increased vein 17 John Wiley & Sons, Inc.


thickening would indicate loss of ESCRT activity, whereas reduced vein thickening would indicate rescue of ESCRT activity. This offers a sensitive assay to test the activity of ESCRT components that have only been identified through physical interactions. Experimental Procedures Generation of transgenic fly lines Transgenic fly lines that express Chmp1 under the control of a Gal4 responsive UAS enhancer were generated. The clone GH26351 which contains Chmp1 cDNA in the pOT2 vector was obtained from the Drosophila Genomics Resource Center (DGRC). The Chmp1


coding sequence was amplified by PCR with the following primer pairs (Invitrogen): UAS-HMChmp1 forward GGGCCCGGATCCACGTCGCATATGTCTACGAGTTCCATGG and UAS-HMChmp1 reverse TACCACCTCGAGTTATTCAGCCTGGCGGAGACG for insertion into pUASHM, and UAS-Chmp1 forward ACGTCGGAATCCATGTCTACGGAGTTCCATGG and UAS-Chmp1 reverse TACCACCTCGAGTTATTCAGCCTGGCGGAGACG for insertion into pUAST. These primers added Nde1, Xho1, and EcoR1 restriction enzyme recognition sites (underlined) that allowed for insertion of the Chmp1 cDNA into the pUAST and pUASHM plasmids. Chmp1 cDNA was inserted downstream of a UAS enhancer into the EcoR1/Xho1 sites of pUAST and the Nde1/Xho1 sites of pUASHM. The pUASHM plasmid allows the expression of Chmp1 protein carrying an N-terminal his-myc (HM) tag. The amplified Chmp1 sequence was verified by nucleotide sequencing. The UAS-HM-Chmp1 and UAS-Chmp1 plasmids were sent to BestGene Inc., where transgenic flies were generated. Balanced stocks carrying the UAS-HM-Chmp1 and UAS-Chmp1 transgenes were produced in the Collier fly lab.

Fly stocks and genetics All flies were cultured on standard cornmeal/yeast media at 25oC, unless otherwise stated. P[GD11219]v21788 (UAS-Chmp1-RNAi VDRC) and P[GD1443]v33200 (UAS-forkedRNAi ) were obtained from the VDRC. TRiP.HM05117 (UAS-Chmp1-RNAi TRiP) was obtained 18 John Wiley & Sons, Inc.

Page 18 of 34

Page 19 of 34


from the TRiP stocks at Harvard. All other fly lines were from Bloomington Stock Center at Indiana University. Additionally, six transgenic fly lines were generated. Lines UAS-HM-Chmp11 through UAS-HM-Chmp1-4 can express his-myc (HM)-tagged Chmp1. Lines UAS-Chmp1-1 and UAS-Chmp1-2 can express wild-type Chmp1. To generate clones of Chmp1 knockdown in wing discs for Blistered immunostaining, larvae of the genotype hs-flp/act5c>CD2>Gal4; UAS-GFP/+; UAS-Chmp1-RNAi TRiP/+ were raised at 25oC, heat shocked at 38oC for one hour at 2-3 days (48-72 hours), and grown at 30oC for the remaining development. To generate clones of Chmp1 knockdown in developing wings


for adult analysis, larvae of the genotype hs-flp/act5c>CD2>Gal4; UAS-forked-RNAi/ UASChmp1-RNAi VDRC were grown at 25oC for 4-5 days (120-144 hours), heat shocked for one hour at 37oC, and incubated at 28oC for the remaining development. Wing vein measurements Wing veins were measured to quantify wing vein thickening between genotypes for the DER interaction studies, and to determine rescue of Chmp1 knockdown by Chmp1 overexpression. To quantify wing vein thickening, the area of the L3 vein was measured from its junction with the anterior cross vein for 200µm in the distal direction using ImageJ software (Schneider et al., 2012). At least 10 wings were measured for each genotype. For each wing, the area of the L3 wing vein was measured three times and the mean of the measurements was used for the quantification. A student’s t-test (p120 cells) of Chmp1 knockdown marked by GFP expression. B’-C’. Same clones as B and C respectively, but with the GFP fluorescence removed and clones outlined in green. D-F. Light micrographs of wings of females (hs-flp/act5c>CD2>Gal4; UAS-forked-RNAi/ UAS-Chmp1RNAi VDRC) showing clones of Chmp1 knockdown marked by forked knockdown, outlined in yellow. D. Chmp1 knockdown clone that overlaps the L3 wing vein. E. Chmp1 knockdown clone 26 John Wiley & Sons, Inc.

Page 26 of 34

Page 27 of 34


posterior to the L5 wing vein that does not induce vein fate. F. Chmp1 knockdown clone posterior to the L5 wing vein that caused intervein cells to adopt a vein fate. Figure 5. Chmp1 localizes to the late endosome. A-D. Images are from confocal Z-series of imaginal wing discs expressing both HM-Chmp1 and GFP under the control of the en-Gal4 driver (en-Gal4,UAS-GFP/+; UAS-Chmp1-HM/+ or en-Gal4,UAS-GFP/UAS-Chmp1-HM). Cells expressing HM-Chmp1 were marked with GFP (green). HM-Chmp1 localization (red) in four independent HM-Chmp1 transgenic lines. Scale bar is 10µm. A’-D’. Merged images show HMChmp1, GFP, and nuclei (blue). Orthogonal X and Y sections of a confocal Z-series show apical


localization of HM-Chmp1. The position of the X and Y orthogonal sections are indicated by the crosshairs. X orthogonal section is shown at the bottom of each panel, apical is uppermost. Y orthogonal section is shown at the left of each panel, apical is right. Z-series depth for A’ was 11.78µm, B’ was 6.38µm, C’ was 9.64µm, and D’ was 14.25µm. E-F. Confocal images of embryos expressing Chmp1-HM1 under en-Gal4. Scale bar is 5µm. E. Localization of HMChmp1 (red) and Rab5 (yellow). F. Localization of HM-Chmp1 and YFP-Rab9 (yellow). G-J. Light micrographs of wings from female flies over-expressing Chmp1 under en-Gal4 raised at 30oC. G and H. en-Gal4/+; UAS-Chmp1-HM1/+. I and J. en-Gal4 /UAS-Chmp1-2. Doubled hairs shown in upper left corner of panel J.




Figure 1 175x176mm (300 x 300 DPI)

John Wiley & Sons, Inc.

Page 28 of 34


Page 29 of 34


Figure 2 106x65mm (300 x 300 DPI)




Figure 3 112x71mm (300 x 300 DPI)


Page 30 of 34



Page 31 of 34

Figure 4 147x256mm (300 x 300 DPI)




Figure 5 122x85mm (300 x 300 DPI)


Page 32 of 34


Page 33 of 34


141x141mm (72 x 72 DPI)




Drosophila Chmp1 is an essential gene that negatively regulates DER signaling in the wing. Loss of Chmp1 causes increased DER signaling, and promotes vein cell fate over intervein cell fate. This is likely a result of its role as an ESCRT component in MVB generation.


Page 34 of 34

Redox-dependent regulation of epidermal growth factor receptor signaling.

Telomere length regulation through epidermal growth factor receptor signaling in cancer.

Epidermal Growth Factor Receptor Cell Proliferation Signaling Pathways.

AKT signaling pathway.

The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans.

Early signaling dynamics of the epidermal growth factor receptor.

Temporal regulation of Dpp signaling output in the Drosophila wing.

Autophagy regulation in pancreatic acinar cells is independent of epidermal growth factor receptor signaling.

Gastric carcinoma, epidermal growth factor, and epidermal growth factor receptor.

Cytokine regulation by epidermal growth factor receptor inhibitors and epidermal growth factor receptor inhibitor associated skin toxicity in cancer patients.

BMP receptor 1A determines the cell fate of the postnatal growth plate.

Expression of epidermal growth factor receptor and human epidermal growth factor receptor 2 in periocular squamous cell carcinomas of horses.

Extracellular matrix protein 1 regulates cell proliferation and trastuzumab resistance through activation of epidermal growth factor signaling.

receptor in ovarian cancer cells.

human epidermal growth factor receptor 2-targeted therapies for breast cancer.

Cell and molecular biology of epidermal growth factor receptor.

Isolation of cell membrane for epidermal growth factor receptor studies.

Microenvironmental stiffness enhances glioma cell proliferation by stimulating epidermal growth factor receptor signaling.

CUB domain-containing protein 1 and the epidermal growth factor receptor cooperate to induce cell detachment.

Direct interaction of avermectin with epidermal growth factor receptor mediates the penetration resistance in Drosophila larvae.

The NADPH Oxidases DUOX1 and NOX2 Play Distinct Roles in Redox Regulation of Epidermal Growth Factor Receptor Signaling.

Epidermal growth factor receptor in non-small cell lung cancer.

Epidermal growth factor receptor expression in canine transitional cell carcinoma.

Analogs of human epidermal growth factor which partially inhibit the growth factor-dependent protein-tyrosine kinase activity of the epidermal growth factor receptor.