The Deubiquitinase USP9X Maintains DNA Replication Fork Stability and DNA Damage Checkpoint Responses by Regulating CLASPIN during S-Phase.

Author Manuscript Published OnlineFirst on February 26, 2016; DOI: 10.1158/0008-5472.CAN-15-2890 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

The deubiquitinase USP9X maintains DNA replication fork stability and DNA damage checkpoint responses by regulating CLASPIN during S-phase

Edel McGarry1, David Gaboriau1,3, Michael Rainey1, Umberto Restuccia2, Angela Bachi2 and Corrado Santocanale1.

1

Centre for Chromosome Biology, School of Natural Sciences, National University of

Ireland Galway, Ireland 2

IFOM-FIRC Institute of Molecular Oncology, Milan 20139, Italy

3

Current address: FILM (Facility for Imaging by Light Microscopy), National Heart

and Lung Institute, Imperial College London, London SW7 2AZ, United Kingdom.

*Correspondence should be addressed to Corrado Santocanale, Biosciences building, Dangan, National University of Ireland Galway, Galway, Ireland. Phone +353-91495174. Email: [email protected]

This work was supported by Science Foundation Ireland (SFI) grant 12/IP/1508 to CS and by Breast Cancer Now grant (2012MayPR089). EMG was supported by Molecular Medicine Ireland CTRSP Scholarship. Conflict of interest: The authors have no conflict of interest to disclose. Keywords: DNA replication, Cell cycle checkpoints, Genome stability, USP9X, Protein stability Running title: USP9X role in genome stability

1 Downloaded from cancerres.aacrjournals.org on February 28, 2016. © 2016 American Association for Cancer Research.


ABSTRACT

Coordination of the multiple processes underlying DNA replication is key for maintaining genome stability and preventing tumorigenesis. CLASPIN, a critical player in replication fork stabilization and checkpoint responses, must be tightly regulated during the cell cycle to prevent the accumulation of DNA damage. In this study, we used a quantitative proteomics approach and identified USP9X as a novel CLASPIN interacting protein. USP9X is a deubiquitinase involved in multiple signaling and survival pathways whose tumor suppressor or oncogenic activity is highly context-dependent. We found that USP9X regulated the expression and stability of CLASPIN in an S-phase-specific manner. USP9X depletion profoundly impairs the progression of DNA replication forks, causing unscheduled termination events with a frequency similar to CLASPIN depletion, resulting in excessive endogenous DNA damage. Importantly, restoration of CLASPIN expression in USP9X-depleted cells partially suppressed the accumulation of DNA damage. Furthermore, USP9X depletion compromised CHK1 activation in response to hydroxyurea and UV, thus promoting hypersensitivity to drug-induced replication stress. Taken together, our results reveal a novel role for USP9X in the maintenance of genomic stability during DNA replication, and provide potential mechanistic insights into its tumor suppressor role in certain malignancies.



INTRODUCTION

The timely and precise duplication of DNA in S-phase of the cell cycle is critical to maintaining genome stability and preventing tumorigenesis (1,2). Indeed genome duplication is a tightly coordinated process where mechanisms that regulate replication origin activation lead to the assembly of new replication forks in a defined spatiotemporal programme (3). During S-phase cells are extremely vulnerable to exogenous and endogenous sources of DNA damage that impede the progression of replication forks thus causing replication stress. Importantly, cellular surveillance mechanisms that overlap with the DNA damage response pathways detect, stabilise and resolve stalled replication forks to help preserve genome stability (2). CLASPIN, critical for both DNA synthesis and for signalling the presence of replication stress, is a ring shaped protein which, together with the TIPIN-TIM1 complex physically links DNA polymerases and DNA helicase (4-6); this is important for stabilisation of replication forks, both during normal replication and upon prolonged arrest (1,2,7). CLASPIN also plays an important role in the replication stress response pathway (3,8,9) since ATR activation of CHK1 is favoured by the binding of CHK1 to CLASPIN (2,10-13). Several kinases have been reported to phosphorylate CLASPIN and promote CHK1 activation, including CHK1 itself (4-6,14), casein kinase 1 gamma 1 (CK1γ1) (15) and CDC7 (16,17). Phosphorylation of CLASPIN at its N-terminus by PLK1 can also contribute to switching off CHK1 once the damage is repaired, thus allowing cells to progress in the cell cycle (18,19). Mechanistically, PLK1 phosphorylation of CLASPIN creates a phospho-degron domain recognised by the SCF-βTrCP ubiquitin ligase leading to proteasome degradation (18,19).



Ubiquitinylation regulates CLASPIN levels not only during checkpoint recovery but also during other phases of the cell cycle. For example in G1, CLASPIN degradation is promoted by the APC/C Cdh1-mediated K48-linked poly-ubiquitinylation (20). Several deubiquitinylating enzymes (DUBs) have been shown to counteract proteosomal degradation of CLASPIN: USP28 was reported to reverse the APC/C Cdh1 dependent degradation (20,21) whereas USP7 and more recently USP29 have been shown to stabilise CLASPIN degradation mediated by SCF-βTrCP (22,23). Two concurrent reports have recently identified USP20 as a fourth DUB, which regulates CLASPIN stability with a particular relevance during replication stress (24,25). USP20 itself is regulated by ATR-dependent phosphorylation, resulting in its disassociation from the E3 ubiquitin ligase HERC2 and in its stabilization (24,25). The

regulation

of

the

DNA

damage

response

by

ubiquitinylation

and

deubiquitinylation is well established, with many DUBs involved in genome stability (26) often regulating multiple proteins involved in the same pathway. For example USP7 not only also regulates CLASPIN levels, but also directly deubiquitinylates CHK1 and RNF168 (27,28), while USP28 controls the levels of 53BP1 and CHK2 (20). We have identified USP9X as a novel DUB that binds CLASPIN and regulates its levels. USP9X is one of the largest ubiquitin-specific proteases (USPs) and it has been implicated in a number of essential cellular processes, and knockout of this gene is embryonic lethal in mice (29) . USP9X is involved in the regulation of cell adhesion molecules like E-cadherin, chromosome segregation, NOTCH and TGF-β signalling as well as apoptosis (comprehensively reviewed in (30)).



In different cancers USP9X can act as an oncogene or as a tumour suppressor gene in a context dependent manner: USP9X is overexpressed in multiple carcinomas including lymphomas, non-small cell lung and breast cancer (30). The best-described oncogenic function of USP9X derives from its role in promoting the deubiquitinylation and stabilization of anti-apoptotic protein MCL1. Furthermore elevated expression of MCL1 is found in numerous cancers and is associated with resistance to chemotherapy (31). On the contrary in pancreatic ductal adenocarcinoma (PDA), USP9X acts as tumor suppressor with low expression associated with poor patient outcome and widespread metastasis (32). However, little is known at the molecular level about USP9X tumor suppression function: the ubiquitin ligase ITCH is a USP9X substrate and has been proposed to be involved since ITCH was partially responsible for the ability of USP9X to promote anoikis and suppress colony formation (32). Also in ERα-positive breast cancers USP9X downregulation can promote resistance to Tamoxifen, as ERα is stabilized on chromatin driving activation of ERα-responsive genes (33).

In this work we uncover a novel role of USP9X in the maintenance of genome stability. We show that USP9X interacts with CLASPIN and that its down regulation destabilizes CLASPIN in an S-phase specific manner. We also demonstrate that USP9X depletion impacts CLASPIN function in both replication fork dynamics and the DNA damage response, resulting in the accumulation of DNA damage.



Materials and Methods

Cell culture: U2OS Osteosarcoma cells were obtained from Noel Lowndes laboratory in 2011 and were first authenticated by STR analysis and subsequently certified in 2015 by transposon profiling. Flp-In T-REx 293 cells (Life technologies and validated by ATCC in 2011) conditionally expressing Claspin tagged with a dual C-terminal Flag/OneSTrEP tag were generated in this study (Supplementary Materials and Methods). Cells were cultured at 37°C, 5% CO2 in DMEM supplemented with 1% penicillin-strep and heat inactivated 10% Fetal bovine serum (Sigma-Aldrich). Plasmids expressing full length USP9X or a catalytically inactive mutant (C1566A) were

previously

described

(34)

and

obtained

from

https://mrcppureagents.dundee.ac.uk . Transfections were performed using jetPRIME (Polyplus) according to manufacture instruction. Drug treatments and UV irradiation: Doxycycline (Sigma-Aldrich) was used at 1 µg/ml to induce the expression of CLASPIN, Hydroxyurea (HU) (Sigma-Aldrich) was used at with 2 mM, MG132 (Sigma-Aldrich) at 10 µM and WP1130 (SelleckChem) at 5 µM. For experiments using UV, cells were irradiated with 20 J/m2 at 250 nM using a UV lamp (UVItec). siRNA: siRNAs were previously described and purchased from Sigma-Aldrich: siUSP9X(a)

AGAAAUCGCUGGUAUAAAUUU

GCAGUGAGUGGCUGGAAGUTT

(35),

(36),

siUSP9X(b) siClaspin

GCACAUACAUGAUAAAGAA (37), siHERC2 GCGGAAGCCUCAUUAGAAA (25),

siUSP20

CCAUAGGAGAGGUGACCAA

(25),

siUSP7

ACCCUUGGACAAUAUUCCU (38). As control the Ambion negative control # 1



(Ambion) was used. Cells were transfected with 100 nM of all siRNAs for 48 hr using jetPRIME (Polyplus).

Protein manipulation. Whole cell extracts were prepared in buffer A (50 mM TrisHCl, pH 7.4, 300 mM NaCl, 1 mM EDTA, 1% Triton-X) containing protease and phosphatase inhibitors (Sigma-Aldrich) For immunoblotting, proteins were resolved by SDS-PAGE, transferred onto nitrocellulose membranes prior to overnight incubation with primary antibodies and infrared-labelled secondary antibodies. Immunoreactive bands were visualized and quantified using Odyssey Infrared Imaging Systems (Li-Cor Biosciences). For immunoprecipitation experiments, pre-cleared protein extracts were incubated with

antibodies that were pre-bound to protein A/G beads (Santa-Cruz

Biotechnology). For Strep affinity purifications, pre-cleared extracts were incubated with Strep-Tactin Sepharose resin (Fisher Scientific). Following extensive washes in buffer A, bound proteins were recovered by eluting in buffer A containing 10 mM Biotin (Sigma-Aldrich) or by boiling the beads in Laemmli buffer.

SILAC and mass spectrometry. Empty vector and Strep-CLASPIN expressing cells were grown for 5 passages in medium (R6K4) or light (R0K0) SILAC medium (Dundee Cell Products, Cat n. LM016 and LM014) respectively. Protein extracts were prepared as above and loaded onto individually pre-equilibrated Strep-Tactin Sepharose columns (IBA). Proteins were recovered by biotin competition, mixed at 1:1 ratio, concentrated on an Amicon centrifugal filter (10 kDa cut off) and resolved on a 4-12% pre-cast gel (Bio-Rad). Gels were stained by Coomassie colloidal blue (Sigma-Aldrich) and lanes were cut into 10 slices each of which was subject to



reduction, alkylation and trypsin digestion as described (39). Peptides were separated and analyzed on an UHPLC (Easy-nLC 1000 Proxeon, Denmark) connected to a QExactive mass spectrometer (ThermoScientific, Bremen, Germany). Detailed protocol is available in Supplementary Materials and Methods.

Flow Cytometry. For the analysis of DNA damage, cells were fixed with 1% formaldehyde/PBS and permeabilized with PBS containing 0.05% saponin and 1% BSA. Cells were then stained with primary rabbit anti-pSer139 Histone H2A.X (Cell Signaling, cat n. 9718s) antibody and mouse anti-Strep antibody (Qiagen, cat n. 34850) followed by incubation secondary Alexa Fluor 647 donkey anti-rabbit antibody (Invitrogen) and Alexa Fluor 488 goat anti-mouse antibody (Invitrogen) respectively. DNA was stained with 1 µg/ml DAPI (Sigma-Aldrich). Data were aquired on a BD FACS Canto II cytometer (BD Biosciences) and analysed with FlowJo software v10. Statistical analysis of three independent experiments was performed using Prism (GraphPad Software).

Immunofluorescence microscopy. Cells were fixed with 4% paraformaldehyde and then permeabilised with PBS-TX (PBS 0.1% Triton X-100). Primary rabbit antipSer139 Histone H2A.X antibody (Cell signalling cat n. 9718s) was used together with mouse anti-Strep antibody (Qiagen cat n. 34850). Secondary antibodies were Alexa Fluor 546 goat anti-rabbit antibody and Alexa Fluor 488 goat anti-mouse antibody (Invitrogen). Cells were examined using an IX71 Olympus microscope with a 40× oil immersion objective.



RESULTS

CLASPIN interacting proteins In order to obtain further insights into CLASPIN function and regulation we aimed to identify CLASPIN interacting proteins. To this end we generated a Flp-In T-Rex HEK-293 cell line in which a tagged-CLASPIN (Strep-CLASPIN) fusion protein is conditionally expressed from a TET-controlled promoter upon the addition of doxycycline to the culture medium. The levels of CLASPIN in these cells increased by approximately 5-fold following induction with doxycycline and the fusion protein was easily detected with either anti-Strep or anti-CLASPIN antibodies (Fig 1A). Strep-CLASPIN did not affect cell proliferation for at least three days, nor did it affect the distribution of cells within the different phases of the cell cycle. Furthermore Strep-CLASPIN protein levels fluctuated during the cell cycle with maximum expression during the S-phase (Fig S1). By exploiting the Strep–tag at the C-terminus of the protein, we devised an affinitypurification protocol to enrich for Strep-CLASPIN and potential interacting proteins. After 24 hours of induction with Doxycycline, empty-vector or Strep-CLASPIN cells were lysed in a 300 mM NaCl containing buffer, as this is sufficient to extract most of the protein from chromatin (Fig S2). Protein extracts were loaded onto Strep-Tactin columns and, after extensive washing, bound proteins were eluted by addition of biotin. By immunoblotting we confirmed that Strep-CLASPIN protein was highly enriched in the partially purified fractions, and that a known CLASPIN interacting protein, CDC45, was also specifically found only in the fractions obtained from the Strep-CLASPIN cells (Fig 1B).



Notably, by staining these fractions with silver we observed that many more proteins were present in the eluate derived from Strep-CLASPIN cells compared to the control, suggesting that several different proteins could potentially bind to CLASPIN (Fig 1C). To determine the identity of these proteins, we used a SILAC proteomic approach, where empty vector and Strep-CLASPIN cells were grown on media containing unlabelled or labelled amino acids. Protein extracts were prepared as above and loaded onto individually pre-equilibrated Strep-Tactin columns prior to washing and biotin-mediated elution. Eluates from empty vector and Strep-CLASPIN affinity purifications were mixed 1:1, concentrated and proteins were resolved using SDS-PAGE prior to in-gel digestion and quantitative MS analysis. We were able to identify and quantify 334 proteins, excluding potential contaminants and reverse hits; these show a distribution markedly skewed towards the bait, indicating that the negative control is relatively clean and that most of the proteins are potential CLASPIN interactors. Indeed, together with the bait Strep-CLASPIN, we found that several known CLASPIN interactors were detected, including MCM2-3-6 subunits of the MCM complex. Notably, among the enriched proteins, we observed a large number of proteasome subunits and enzymes involved in ubiquitin mediated proteolysis, including the deubiquitinase USP9X (Supplementary Table 1).

USP9X interacts with CLASPIN The identification of USP9X was particularly intriguing as several deubiquitinases have recently been shown to be involved in regulating CLASPIN including USP28, USP7, USP20 and USP29 (20,22-25). To assess if USP9X interacts with CLASPIN, we first repeated the affinity purification of Strep-CLASPIN protein on a smaller scale, and analysed the eluted



proteins by immunoblotting. Indeed USP9X was specifically detected in the fractions derived from Strep-CLASPIN expressing cells and not in the control (Fig 2A). By performing reciprocal immunoprecipitation experiments using USP9X antibodies or IgG control and extracts from Strep-CLASPIN expressing cells, we detected an antiStrep immunoreactive band in the USP9X immunoprecipitated material (Fig 2B). More importantly, by immunoprecipitating USP9X from extracts prepared from U2OS cells we recovered endogenous CLASPIN (Fig 2C). Altogether these data indicate that in extracts USP9X, either directly or indirectly, associates with both endogenous and ectopically expressed CLASPIN.

USP9X stabilizes CLASPIN in S-phase To begin exploring the relationship between USP9X and CLASPIN we performed siRNA mediated depletion of USP9X in HEK-293 cells using two different siRNAs targeting USP9X mRNA, that have been extensively validated in several studies (35,36). We observed that both USP9X siRNA’s efficiently reduce USP9X protein levels when measured 48 hours post-transfection (Fig 3A). Interestingly, depletion of USP9X also correlated with an obvious decrease of CLASPIN, although the depletion was not as pronounced as by a specific siRNA that directly target CLASPIN mRNA (Fig 3A). The effect of USP9X depletion on CLASPIN levels was not only found in HEK-293 cells but also observed in U2OS cells (Fig 3B). Growth and distribution of cells within the cell cycle was not grossly affected by USP9X depletion in either cell line (Fig S3). These observations suggested the possibility that USP9X, being an ubiquitin-specific peptidase, may regulate CLASPIN levels by affecting its turnover, possibly through the proteasome. If this is the case, then proteasome inhibition would be expected to



rescue CLASPIN levels and indeed upon treatment with MG132, CLASPIN levels were stable in the presence of USP9X depletion, in a manner similar to p21, a CDK inhibitor and well-known substrate of the proteasome (40) (Fig 3C). The level of USP9X itself was increased by MG132 treatment in cells transfected with control siRNA but not in cells transfected with USP9X targeting siRNA. Thus the decrease of CLASPIN observed upon USP9X depletion is most likely caused by accelerated proteasome-mediated degradation. To test this hypothesis, U2OS cells were transfected with either control or USP9X targeting siRNA. Cycloheximide was added to prevent further protein synthesis, samples were harvested at different time points and protein levels analysed by semi-quantitative western blotting. Although in USP9X depleted cells CLASPIN levels were already reduced at the beginning of the experiments, its level rapidly decreased to become almost undetectable after 6 hours, while in control cells CLASPIN levels decline with a slower kinetics (Fig 3D and Fig S4). As multiple mechanisms have been shown to control CLASPIN degradation in different phases of the cell cycle and in order to obtain better insights into the role of USP9X in CLASPIN stability, we used the Strep-CLASPIN cells. These were grown in doxycycline containing medium, arrested in either S-phase with Hydroxyurea or in mitosis with Nocodazole and the rate of degradation of Strep-CLASPIN protein analysed as above. Firstly, we observed that the Strep-CLASPIN protein, similarly to endogenous CLASPIN is stabilised in S-phase compared to mitosis (Fig 3E) and secondly we found that the treatment with the small molecule WP1130, a deubiquitinase inhibitor that shows some specificity for USP9X (41), destabilises the protein only in S-phase cells. We then looked at ubiquitinylation levels of the StrepCLASPIN protein in S-phase. For these experiments, Strep-CLASPIN expressing



cells were transfected with a construct expressing HA-tagged ubiquitin, arrested in Sphase by HU and treated with WP1130 in the presence of MG132; ubiquitinylation was then assessed by Strep-affinity purification and anti-HA immunoblotting. Fig 3F shows that in untreated cells the levels of CLASPIN ubiquitinylation are hardly detectable over background (Fig 3F lane 1-2). As expected MG132 caused an increase in ubiquitinylated CLASPIN and addition of WP1130 further enhanced accumulation of ubiquitinylated forms (Figure 3F lanes 4 and 5), suggesting that USP9X could contribute to the removal of ubiquitin chains from CLASPIN. The role of USP9X in protecting CLASPIN from proteasome dependent degradation was then further assessed by overexpressing either wild type or a catalytically dead version of USP9X carrying a single amino acid change in its active site (C1566A)(34) in U2OS cells. 24 hours after transfection cyclohexamide was added for 6 hours to the culture and the residual levels of CLASPIN assessed by western blotting. Figure 3G and Fig S5 shows that overexpression of USP9X indeed prevents the CLASPIN degradation while the C1566A mutant proteins fails to stabilise CLASPIN indicating that the catalytic activity of USP9X is required.

USP9X depletion does not affect the levels of other DUBs involved in preventing CLASPIN degradation and USP9X levels are unaffected by their depletion In order to gain insight into the mechanism by which USP9X protects CLASPIN we first explored the relationship between USP9X and other DUBs that contribute to CLASPIN stabilization during S-phase, namely USP29, USP7 and USP20. U2OS cells were transfected with siRNA targeting these DUBs and protein levels assessed by immunoblotting 48 hours later. As USP20 itself is stabilized by the HERC2 ubiquitin ligase, a HERC2 targeting siRNA was also used in these experiments.



Firstly, we found that depletion of USP9X did not affect the levels of any of these DUBs (Fig 4). We then asked the reciprocal question of whether depletion of USP7, USP20 and USP29 regulates USP9X abundance. We observed that neither USP7 nor USP20 depletion affected the levels of USP9X (Fig 4 lanes 3 and 5). Similarly HERC2 depletion did not change USP9X levels although, as previously reported (25), promoted USP20 stabilization (Fig 4). In these experiments we also noticed that USP20 depletion correlated with a decrease in USP29 suggesting a functional crosstalk between the two DUBs (Fig 4). Our repeated attempts to down-regulate USP29 by siRNAs did not result in a convincing depletion of the protein, thus we could not assess if USP29 directly affects USP9X levels. Altogether these data suggest that USP9X may act in an independent manner from the previously reported USPs that control CLASPIN stability in S-phase.

USP9X depletion causes DNA replication fork instability and defective replication checkpoint responses The finding that USP9X controls CLASPIN levels in S-phase prompted us to test the hypothesis that DNA replication dynamics could be affected. In particular we investigated if USP9X depletion would affect on-going replication forks and origin firing using a DNA fiber labelling technique (42-44). U2OS cells were transfected with control, USP9X or CLASPIN siRNAs, and after 48 hours nascent DNA was sequentially labelled for thirty minutes with the nucleotide analogue iododeoxyuridine (IdU) followed by washing and thirty minutes with cloro-deoxyuridine (CldU). Cells were then lysed, DNA fibers prepared and nascent DNA analysed by fluorescence microscopy, with IdU containing DNA visualised with TRITC conjugated antibodies (red) and CldU containing DNA with FITC conjugated



antibodies (green). Strikingly we observed that in the USP9X depleted cells the percentage of termination events and stalled forks, scored as red only tracks, was greatly increased compared to siRNA control transfected cells and was at a similar level to that seen by CLASPIN depletion (Fig 5A). Interestingly, and similar to what has already been reported for CLASPIN depletion (7), the amount of DNA synthesized during the second labelling period was severely reduced as observed by short green tracks in the USP9X depleted cells. In our experiments neither USP9X nor CLASPIN depletion appeared to have a significant impact on the origin firing (green only tracks). Using a different labelling strategy, we asked whether USP9X depletion could affect replication fork restart after forks have been blocked by treating cells with ribonucleotide inhibitor HU. In these experiments, cells were first labelled for 30 minutes with IdU, then IdU was removed and hydroxyurea was added, and after two further hours the drug was washed away and CldU was added to label replication products. Again compared to controls, in both USP9X and CLASPIN depleted cells we observed an increase in the number of red only tracks indicative of replication forks that collapsed or are unable to restart after HU removal (Fig 5B). The role of CLASPIN in mediating ATR-dependent phosphorylation of CHK1 in the response to DNA replication blockade or DNA damage has been widely documented, thus we predicted that lower CLASPIN levels may also impact on ATR signalling. To verify this hypothesis, U2OS cells transfected with either control or USP9X specific siRNAs were treated with HU, samples were collected throughout a two hour time course experiment and protein analysed. Fig 6A and Fig S6A show that CHK1 phosphorylation at Ser317 is severely reduced in USP9X depleted cells compared to the control. Low CLASPIN levels and defective phosphorylation of CHK1 upon HU



treatment were also observed in USP9X depleted hTERT-immortalized retinal pigment epithelial RPE1 cells (Fig S6B). In order to assess if defective checkpoint signalling in USP9X depleted cells was not limited to HU, but a more general response to replication stress, U2OS cells were irradiated with 20 J/m2 of UV light and samples collected 30 minutes and 2 hours after irradiation. Fig 6B shows that again the levels of CHK1 phosphorylation at serine 317 were reduced. We then assessed the effects of prolonged replication stress in USP9X depleted cells using a colony forming assay. In these experiments after transfection with control and USP9X siRNAs, U2OS cells were incubated for 18 hours with increasing amounts of HU, plated and the number of colonies scored after 10 days. We noticed that in this cell line USP9X depletion caused a substantial decrease in plating efficiency without any added replication stress; however, upon HU treatment, the decrease in colony formation is further enhanced in USP9X depleted cells when compared to control cells at all doses tested (Fig 6B). The loss of clonogenic potential upon depletion of USP9X could indicate the inherent problems with ongoing replication upon depletion of USP9X in a normal cell cycle, but clearly the decrease in survival observed upon HU treatment reveals that USP9X plays an important role in dealing with replication stress.

CLASPIN dependent DNA damage in USP9X depleted cells The observations that USP9X depletion affects replication fork stability and that USP9X contributes to efficient induction of the DNA replication checkpoint, suggested that depletion of USP9X would lead to accumulation of DNA damage. As expected a large number of nuclei of USP9X-depleted cells stained positive for phosphorylated H2AX at serine 139 (γ-HA2X). The γ-H2AX staining pattern was



very heterogeneous, with some cells showing only punctuate staining and others with very bright pan nuclear staining, these features are reminiscent of the phenotype we observe upon CLASPIN depletion (Fig. 7A, Fig S6C and (45)). DNA damage upon USP9X depletion was observed in a different cell line and with two independent USP9X targeting siRNAs (Fig S6C). Importantly, the addition of doxycycline and ectopic expression of Strep-CLASPIN protein significantly reduced the percentage of cells with damaged DNA (Fig. 7A-B). Altogether these data show that reduced levels of CLASPIN, as a result of USP9X depletion, are among the primary contributing factors causing DNA damage.



DISCUSSION

In this work we provide evidence that USP9X is critical for efficient DNA replication. USP9X depletion causes spontaneous replication fork stalling and increased sensitivity to HU. We also show that USP9X controls CLASPIN levels, most likely through counteracting its ubiquitinylation in S-phase. Strikingly the effect of USP9X depletion on DNA replication is almost indistinguishable from the direct down regulation of CLASPIN itself, suggesting that CLASPIN is the main target of USP9X in the process of DNA replication. This idea is further reinforced by the fact that the amount of DNA damage in USP9X-depleted cells, likely accumulating because of fork instability, is partially rescued by ectopic expression of CLASPIN. Our experiments demonstrate that USP9X depletion decreases levels of endogenous CLASPIN in a proteasome dependent manner and increases the rate of CLASPIN degradation. Furthermore, we find that the two proteins can be coimmunoprecipitated, and that CLASPIN stabilization requires the catalytic activity of USP9X, suggesting that CLASPIN is very likely a bonafide in vivo substrate of USP9X. USP9X is mostly a cytoplasmic and membrane associated protein (30), however a small fraction has been

reported

to

be

nuclear

(46).

We

reconfirmed

these

findings

by

immunofluorescence experiments and we found that some USP9X can accumulate in the nucleus of U2OS cells when nuclear export is inhibited (Fig S7 and S8). It is tempting to speculate that some USP9X activity may play a direct role at replication forks and in agreement with this idea a proteomic study reported that USP9X, like CLASPIN, is preferentially found associated with nascent chromatin compared to mature post-replicative chromatin (47).



It is intriguing that four different deubiquitinases, USP7, USP29, USP20 and USP9X target the same protein in a non-redundant manner. As depletion of USP9X does not alter the protein levels of any of these DUBs and vice versa, it is possible that each DUB may be involved in limiting CLASPIN ubiqitinylation at different specific sites on the protein thus allowing multiple layers of regulation to be independently imposed on CLASPIN. Consistent with a dual role for CLASPIN at replication forks and as a mediator of checkpoint signalling, USP9X depletion decreases, but does not abolish CHK1 activation in response to HU and UV and leads to hypersensitivity to drug-induced replication stress. Increased DNA damage and a diminished ability to promote efficient checkpoint signalling may also be the reason for the hypersensitivity to other genotoxic agents such 5 flouro-uracil in USP9X deficient colorectal cancer cells (48). Inhibition of USP9X either as single agent or in combination with other drugs has been suggested as therapeutic strategy for several leukaemias and solid tumours, however most of the studies focused on the role of USP9X in the stabilization of the anti-apopotic protein MCL1 (35) and on the increased rate of apoptosis. In our study we did not observe an obvious increase in apoptotic cell death by siRNA mediated USP9X depletion and the additive effects of USP9X depletion with HU were only revealed with clonogenic assays that have long-term end-points. This highlights the possibility that excessive genome instability may be the main reason of the loss of the proliferative capability in our cellular models. Interestingly, in pancreatic cancer USP9X acts as a tumour suppressor by limiting KRAS induced cellular transformation and by suppressing tumour aggressiveness by a mechanism that still requires further understanding (32). It is tempting to speculate



that the protection of replication forks and protection from DNA damage could be an important factor in the tumour suppressor role of USP9X.

In conclusion, we propose that USP9X, by regulating CLASPIN, is a novel player in the replication of the genome, in the DNA damage/replication checkpoint and its function is important for the maintenance of genomic stability. Further studies in systems that more closely recapitulate human cancers, both in vitro and in vivo, will be required in order to understand how this novel function or USP9X contributes to either cancer development or to the outcome of treatments targeting the DNA replication process and/or the integrity of DNA.

Acknowledgements We thank Sandra Healy, Bob Lahue and Brian McStay for critical reading of manuscript, Kevin Wu, Karolina Kujawa, Aisling O’Connor and Grainne Donnellan for technical assistance and all the members of the Santocanale lab for discussion and support. We thank Simona Polo for discussion and reagents, Ciaran Morrison for help with microscopy and the NCBES flow cytometry facility, that is funded by NUIG, the Irish Government’s PRTLI4-5 and NDP 2007-2013. Confocal microscopy was performed in the Facility for Imaging by Light Microscopy (FILM) at Imperial College London.



References: 1.

Hills SA, Diffley JFX. DNA Replication and Oncogene-Induced Replicative Stress. Curr Biol. 2014;24:R435–44.

2.

Gaillard H, García-Muse T, Aguilera A. Replication stress and cancer. Nat Rev Cancer. 2015;15:276–89.

3.

Sclafani RA, Holzen TM. Cell cycle regulation of DNA replication. Annu Rev Genet. 2007;41:237–80.

4.

Chou DM, Elledge SJ. Tipin and Timeless form a mutually protective complex required for genotoxic stress resistance and checkpoint function. Proc Natl Acad Sci USA. 2006;103:18143–7.

5.

Cho W-H, Kang Y-H, An Y-Y, Tappin I, Hurwitz J, Lee J-K. Human TimTipin complex affects the biochemical properties of the replicative DNA helicase and DNA polymerases. Proc Natl Acad Sci USA. 2013;110:2523–7.

6.

Aria V, De Felice M, Di Perna R, Uno S, Masai H, Syvaoja JE, et al. The Human Tim-Tipin Complex Interacts Directly with DNA Polymerase epsilon and Stimulates Its Synthetic Activity. J Biol Chem. 2013;288:12742–52.

7.

Petermann E, Helleday T, Caldecott KW. Claspin promotes normal replication fork rates in human cells. Mol Biol Cell. 2008;19:2373–8.

8.

Chini CCS, Chen J. Human claspin is required for replication checkpoint control. J Biol Chem. 2003;278:30057–62.

9.

Lin S-Y, Li K, Stewart GS, Elledge SJ. Human Claspin works with BRCA1 to both positively and negatively regulate cell proliferation. Proc Natl Acad Sci



USA. 2004;101:6484–9. 10.

Kumagai A, Dunphy WG. Claspin, a novel protein required for the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts. Mol Cell. 2000;6:839–49.

11.

Kumagai A, Dunphy WG. Repeated phosphopeptide motifs in Claspin mediate the regulated binding of Chk1. Nat Cell Biol. 2003;5:161–5.

12.

Lindsey-Boltz LA, Serçin O, Choi J-H, Sancar A. Reconstitution of human claspin-mediated phosphorylation of Chk1 by the ATR (ataxia telangiectasiamutated and rad3-related) checkpoint kinase. Journal of Biological Chemistry. 2009;284:33107–14.

13.

Lindsey-Boltz LA, Sancar A. Tethering DNA damage checkpoint mediator proteins topoisomerase IIbeta-binding protein 1 (TopBP1) and Claspin to DNA activates

ataxia-telangiectasia

mutated

and

RAD3-related

(ATR)

phosphorylation of checkpoint kinase 1 (Chk1). J Biol Chem. 2011;286:19229– 36. 14.

Chini CCS, Chen J. Repeated phosphopeptide motifs in human Claspin are phosphorylated by Chk1 and mediate Claspin function. J Biol Chem. 2006;281:33276–82.

15.

Meng Z, Capalbo L, Glover DM, Dunphy WG. Role for casein kinase 1 in the phosphorylation of Claspin on critical residues necessary for the activation of Chk1. Mol Biol Cell. 2011;22:2834–47.

16.

Kim JM, Kakusho N, Yamada M, Kanoh Y, Takemoto N, Masai H. Cdc7



kinase mediates Claspin phosphorylation in DNA replication checkpoint. Oncogene. 2008;27:3475–82. 17.

Rainey MD, Harhen B, Wang G-N, Murphy PV, Santocanale C. Cdc7dependent and -independent phosphorylation of Claspin in the induction of the DNA replication checkpoint. Cell Cycle. 2013;12.

18.

Peschiaroli A, Dorrello NV, Guardavaccaro D, Venere M, Halazonetis T, Sherman NE, et al. SCFbetaTrCP-mediated degradation of Claspin regulates recovery from the DNA replication checkpoint response. Mol Cell. 2006;23:319–29.

19.

Mailand N, Bekker-Jensen S, Bartek J, Lukas J. Destruction of Claspin by SCFbetaTrCP restrains Chk1 activation and facilitates recovery from genotoxic stress. Mol Cell. 2006;23:307–18.

20.

Zhang D, Zaugg K, Mak TW, Elledge SJ. A role for the deubiquitinating enzyme USP28 in control of the DNA-damage response. Cell. 2006;126:529– 42.

21.

Bassermann F, Frescas D, Guardavaccaro D, Busino L, Peschiaroli A, Pagano M. The Cdc14B-Cdh1-Plk1 axis controls the G2 DNA-damage-response checkpoint. Cell. 2008;134:256–67.

22.

Faustrup H, Bekker-Jensen S, Bartek J, Lukas J, Mailand N. USP7 counteracts SCFbetaTrCP- but not APCCdh1-mediated proteolysis of Claspin. J Cell Biol. 2009;184:13–9.

23.

Martín Y, Cabrera E, Amoedo H, Hernández-Pérez S, Domínguez-Kelly R,



Freire R. USP29 controls the stability of checkpoint adaptor Claspin by deubiquitination. Oncogene. 2014. 24.

Yuan J, Luo K, Deng M, Li Y, Yin P, Gao B, et al. HERC2-USP20 axis regulates DNA damage checkpoint through Claspin. Nucleic Acids Res. 2014.

25.

Zhu M, Zhao H, Liao J, Xu X. HERC2/USP20 coordinates CHK1 activation by modulating CLASPIN stability. Nucleic Acids Res. 2014.

26.

Nishi R, Wijnhoven P, le Sage C, Tjeertes J, Galanty Y, Forment JV, et al. Systematic characterization of deubiquitylating enzymes for roles in maintaining genome integrity. Nat Cell Biol. 2014.

27.

Alonso-de Vega I, Martín Y, Smits VAJ. USP7 controls Chk1 protein stability by direct deubiquitination. Cell Cycle. 2014;:0.

28.

Zhu Q, Sharma N, He J, Wani G, Wani AA. USP7 deubiquitinase promotes ubiquitin-dependent DNA damage signaling by stabilizing RNF168. Cell Cycle. 2015;:0.

29.

Nagai H, Noguchi T, Homma K, Katagiri K, Takeda K, Matsuzawa A, et al. Ubiquitin-like Sequence in ASK1 Plays Critical Roles in the Recognition and Stabilization by USP9X and Oxidative Stress-Induced Cell Death. MOLCEL. Elsevier Ltd; 2009;36:805–18.

30.

Murtaza M, Jolly LA, Gecz J, Wood SA. La FAM fatale: USP9X in development and disease. Cell Mol Life Sci. 2015.

31.

Ertel F, Nguyen M, Roulston A, Shore GC. Programming cancer cells for high expression levels of Mcl1. EMBO Rep. 2013;14:328–36.



32.

Pérez-Mancera PA, Rust AG, van der Weyden L, Kristiansen G, Li A, Sarver AL, et al. The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma. Nature. 2012;486:266–70.

33.

Oosterkamp HM, Hijmans EM, Brummelkamp TR, Canisius S, Wessels LFA, Zwart W, et al. USP9X Downregulation Renders Breast Cancer Cells Resistant to Tamoxifen. Cancer Res. 2014;74:3810–20.

34.

Al-Hakim AK, Zagorska A, Chapman L, Deak M, Peggie M, Alessi DR. Control of AMPK-related kinases by USP9X and atypical Lys(29)/Lys(33)inked polyubiquitin chains. Biochem J. 2008;411:249–60.

35.

Schwickart M, Huang X, Lill JR, Liu J, Ferrando R, French DM, et al. Deubiquitinase USP9X stabilizes MCL1 and promotes tumour cell survival. Nature. 2010;463:103–7.

36.

Dupont S, Mamidi A, Cordenonsi M, Montagner M, Zacchigna L, Adorno M, et al. FAM/USP9x, a Deubiquitinating Enzyme Essential for TGF beta Signaling, Controls Smad4 Monoubiquitination. Cell. 2009;136:123–35.

37.

Semple JI, Smits VAJ, Fernaud JR, Mamely I, Freire R. Cleavage and degradation of Claspin during apoptosis by caspases and the proteasome. Cell Death Differ. 2007;14:1433–42.

38.

Khoronenkova SV, Dianova II, Parsons JL, Dianov GL. USP7/HAUSP stimulates repair of oxidative DNA lesions. Nucleic Acids Res. 2011;39:2604– 9.

39.

Restuccia U, Boschetti E, Fasoli E, Fortis F, Guerrier L, Bachi A, et al. pI-



based fractionation of serum proteomes versus anion exchange after enhancement of low-abundance proteins by means of peptide libraries. J Proteomics. 2009;72:1061–70. 40.

Bloom J, Amador V, Bartolini F, DeMartino G, Pagano M. Proteasomemediated

degradation

of

p21

via

N-terminal

ubiquitinylation.

Cell.

2003;115:71–82. 41.

Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M, Donato NJ. Deubiquitinase Inhibition by Small-Molecule WP1130 Triggers Aggresome Formation and Tumor Cell Apoptosis. Cancer Res. 2010;70:9265–76.

42.

Jackson DA, Pombo A. Replicon clusters are stable units of chromosome structure: Evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells. J Cell Biol. 1998;140:1285–95.

43.

Merrick CJ, Jackson D, Diffley J. Visualization of altered replication dynamics after DNA damage in human cells. J Biol Chem. 2004;279:20067–75.

44.

Schwab RAV, Niedzwiedz W. Visualization of DNA replication in the vertebrate model system DT40 using the DNA fiber technique. J Vis Exp. 2011;:e3255.

45.

Liu S, Bekker-Jensen S, Mailand N, Lukas C, Bartek J, Lukas J. Claspin operates downstream of TopBP1 to direct ATR signaling towards Chk1 activation. Mol Cell Biol. 2006;26:6056–64.

46.

Trinkle-Mulcahy L, Boulon S, Lam YW, Urcia R, Boisvert F-M, Vandermoere



F, et al. Identifying specific protein interaction partners using quantitative mass spectrometry and bead proteomes. J Cell Biol. 2008;183:223–39. 47.

Alabert C, Bukowski-Wills J-C, Lee S-B, Kustatscher G, Nakamura K, de Lima Alves F, et al. Nascent chromatin capture proteomics determines chromatin dynamics during DNA replication and identifies unknown fork components. Nat Cell Biol. 2014;16:281–93.

48.

Harris DR, Mims A, Bunz F. Genetic disruption of USP9X sensitizes colorectal cancer cells to 5-fluorouracil. Cancer Biol Ther. 2012;13:1319–24.



Figure legends Figure 1. Enrichment of CLASPIN associated proteins. A) Flp-In TREx HEK-293 empty vector (EV) cells or cells expressing StrepCLASPIN were treated with doxycycline for 24 hours and proteins analyzed by immunoblotting. B) Whole cell extracts (WCE) and partially purified proteins (PP) on Strep-Tactin columns from empty vector or Strep-CLASPIN cells were analyzed by immunoblotting with anti-Strep and anti-CDC45 antibodies, GADPH was used as loading control and as a control for the purification procedure. C) Partially purified fractions shown in B were separated on a 10% SDS-PAGE gel and the gel was stained with silver.

Figure 2. USP9X interacts with CLASPIN. A) Proteins were pulled down using Strep-Tactin resin from extracts prepared from empty vector cells or cells expressing Strep-CLASPIN. Whole cell extracts (WCE) and pulled down material (PD) were probed with either anti-Strep or with antiUSP9X antibodies. B) Immunoprecitpitated proteins with anti-USP9X antibodies or control IgG from extracts prepared from cells expressing Strep-CLASPIN were analyzed by western blotting. Tagged CLASPIN interacting with USP9X was detected with an anti-Strep antibody. C) As in panel B, but extracts were prepared from U2OS cells and endogenous CLASPIN interacting with USP9X was detected using an anti-CLASPIN antibody.

Figure 3. USP9X controls CLASPIN levels. A) HEK-293 were transfected with either a siRNA targeting CLASPIN, two different siRNA’s targeting USP9X or a control siRNA. After 48 hours cells were harvested



and proteins analyzed by immunoblotting. B) HEK-293 and U2OS were transfected with either USP9X or control siRNAs. Proteins were then analyzed after 48 hours as above. C) U2OS cells were transfected with either USP9X or control siRNA; 45 hours post transfection MG132 was added as indicated, cells were then collected 3 hours later and protein analyzed. D) U2OS cells were transfected with either control or USP9X siRNA. After 48 hours cycloheximide was added and cells harvested at the indicated time points. Protein samples were analyzed by immunoblotting. E) HEK-293 cells expressing Strep-CLASPIN were first arrested in S-phase with HU or in mitosis with nocodazole. Cycloheximide was then added to prevent further protein synthesis in the presence or absence of the USP9X inhibitor WP1130 and samples harvested at the indicated times. A sample from the same cell line uninduced (U) was loaded as control. F) Empty vector or Strep-CLASPIN expressing cells were transfected with a plasmid expressing HA-tagged ubiquitin and arrested in S-phase with Hydroxyurea. Pull downs were performed with Strep-Tactin resin and samples were analysed with anti-Strep antibody and anti-HA antibody to detect ubiquitinylated protein. G) U2OS were transfected with constructs expressing either functional (WT) or catalytically dead C1566A (CD) USP9X. After 24 hours cells were either collected (lanes 1-3) or treated with cycloheximide for a further 6 hours (lanes 4-6). Protein extracts were then prepared and analyzed by immunoblotting.

Figure 4. Relationship between USP9X, USP7, USP20 and USP29. U2OS were transfected with siRNA targeting the indicted transcripts. After 48 hours cells were collected and protein extracts analyzed by immunoblotting.



Figure 5. USP9X depletion impairs DNA replication fork stability. A) U2OS cells were transfected with either control (black bars), USP9X (grey bars) or CLASPIN (white bars) targeting siRNA, after 48 hours cells were labeled with consecutive pulses of IdU and CldU. Replication intermediates were detected by fiber labeling technique and fluorescence microscopy. B) As in A, but cells were treated for 2 hours with HU before the second labeling with CldU. In both cases the figure shows the labeling strategy, representative examples of tracks observed in each sample and quantification of red only tracks representing termination events occurring during first labeling period and fork collapse events, red/green tracks representing ongoing forks or forks able to restart after HU treatment, and green only tracks representing initiation events occurring during the second labeling period. Error bars are standard deviation, p is

Replication fork progression during re-replication requires the DNA damage checkpoint and double-strand break repair.

HERC2-USP20 axis regulates DNA damage checkpoint through Claspin.

DNA polymerase η modulates replication fork progression and DNA damage responses in platinum-treated human cells.

DNA damage checkpoint kinase ATM regulates germination and maintains genome stability in seeds.

The Replication Checkpoint Prevents Two Types of Fork Collapse without Regulating Replisome Stability.

SMARCAL1 maintains telomere integrity during DNA replication.

The Fork in the Road: Histone Partitioning During DNA Replication.

SCF(FBXW7α) modulates the intra-S-phase DNA-damage checkpoint by regulating Polo like kinase-1 stability.

DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

DNA-PKcs is required to maintain stability of Chk1 and Claspin for optimal replication stress response.

2-Deficient Tumors and Promotes Alternative End-Joining DNA Repair.

Replication fork slowing and stalling are distinct, checkpoint-independent consequences of replicating damaged DNA.

Recovery from the DNA Replication Checkpoint.

Okazaki pieces grow opposite to the replication fork direction during simian virus 40 DNA replication.

DNA damage checkpoint recovery and cancer development.

Molecular mechanisms of DNA replication checkpoint activation.

M checkpoint.

DNA Replication Origins and Fork Progression at Mammalian Telomeres.

Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage.

Monoubiquitylation of histone H2B contributes to the bypass of DNA damage during and after DNA replication.

Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration.

Regulation of Replication Fork Advance and Stability by Nucleosome Assembly.

Changes in the rate of DNA replication fork movement during S phase in mammalian cells.

DNA copy-number control through inhibition of replication fork progression.