Immunology Letters, 24 (1990) 267-272

Elsevier IMLET 01396

The cytoplasmic domain of the CD8 o -chain is required for its interaction with p56 tck L i b o Yao 1, H i r o m i t s u N a k a u c h i 2, T a s u k u H o n j o a n d Toshiaki K a w a k a m i 1Department of Medical Chemistry, Kyoto University School of Medicine, Kyoto, Japan, and 2Laboratory of Molecular Regulation of Aging, Frontier Research Program, The Institute of Physical and Chemical Research (RIKEN), Ibaraki, Japan

(Received 15 March 1990; accepted 25 March 1990) 1. Summary The CD8 glycoprotein expressed on the surface of CTLs is a heterodimer composed o f ~ (Lyt-2) and j3 (Lyt-3) chains. Recent studies have shown that CD4 and CD8 are physically associated with a T cellspecific protein-tyrosine kinase p56 tck. Our previous experiments have suggested strongly that p56 lck interacts directly with CD4 and CD8 molecules. The present report using cytoplasmic deletion mutants of the CD8 o~-chain gene has extended our observations to demonstrate unequivocally that the cytoplasmic domain of the CD8 a chain is responsible for interaction with p56 tck. The data has also confirmed the importance o f the conserved twelve amino acid sequence motif of the CD8a cytoplasmic domain in complex formation with p56 lck. 2. Introduction The CD8 glycoprotein is a heterodimer composed of two distinct chains, ~ (Lyt-2) and ~ (Lyt-3), which are highly conserved in their respective transmembrane and cytoplasmic domains [1-3]. It is expressed on the surface of cytotoxic T lymphocytes (CTLs) that are specific for antigen presented by major histocompatibility complex (MHC) class I molecules [4], and is thought to play an important Key words." p56/ck; CD8; Lyt-2; Cytoplasmicdomain; Deletion

mutant Correspondence to: Toshiaki Kawakami, Department of Medical Chemistry, Kyoto University School of Medicine, Yoshida, Sakyo-ku, Kyoto 606, Japan. Tel. 075-753-4376; FAX 075-753-4388.

role in T cell development and in interactions between CTLs and their targets. It has also been suggested that CD8 may become physically associated with the TCR/CD3 complex and may thus directly participate in signal transduction [5-8]. Recent studies have shown that CD4 and CD8 are physically associated with a protein-tyrosine kinase (PTK) p56 tc~ [9, 10]. lck is a member of the src P T K family of genes which includes c-src, c-yes, c-fgr, f y n , hck, lyn, and t k l ( r e v i e w e d in refs. 11 and 12). Unlike growth factor receptor PTKs, the proteins encoded by the src family of genes are devoid of extracellular and transmembrane domains. However, they are localized to the inner surface of the plasma membrane by virtue of myristoylation o f their amino termini. Because of a number of reasons they are believed to play important roles in cell growth, differentiation and cell-cell interactions, p56 tck is expressed exclusively in lymphoid cells, especially in T lymphocytes [13], and is known to undergo rapid, complex phosphorylations during T cell activation [14, 15]. These observations have led to the hypothesis that p56 Ice might be the signal-transducing molecule for CD4 and CD8. Indeed, p56 lck fulfilled signal transducing functions in certain CD4 ÷ T cells [16] and a hematopoietic precursor cell transfected with CD4 and lck genes [17]. In the present study, we examined whether the cytoplasmic deletion mutants of the CD8 ~ chain could bind to p56/ck, since we have already shown that the CD8 ~ chain, not the/3 chain, is responsible for association with p561ok [17]. The results indicate that the twelve-amino-acid motif which is conserved among the rodent and human CD4 and CD8 c~ sequences, is important for association, consistent

0165-2478 / 90 / $ 3.50 © 1990 ElsevierSciencePublishers B.V.(BiomedicalDivision)

267

with our previous data on interactions between p56 tck and synthetic peptides corresponding to the cytoplasmic portion of the L3T4 (mouse CD4) molecule [17]. 3. Materials and Methods

3.1. Materials Geneticin (Sigma, St. Louis, MO), RPMI1640 (GIBCO, Grand Island, NY), and fetal bovine serum (Filtron, Victoria, Australia) were purchased. Fluorescein isothiocyanate (FITC)-labeled antiLyt-2 mAb and the hybridoma MAR18.5 secreting anti-rat K chain mAb were bought from BectonDickinson (Franklin Lakes, N J) and ATCC (Rockville, MD), respectively. Preparation of anti-lck was as described [17]. Pansorbin and Staphylococcus aureus V8 protease were obtained from Calbiochem (La Jolla, CA) and ICN Biochemicals (Cleveland, OH), respectively.

3.2. Construction of Lyt-2 deletion mutants The deletion of the Lyt-2 cDNA sequence coding for the cytoplasmic domain was performed on pLyt2SK.BamHI containing the sequence encoding Lyt-2 molecule [18]. To construct pLyt2SK. BamHI, 289-bp NcoI-EcoRI and 475-bp EcoRI-AluI fragments containing 5' and 3' halves of Lyt-2 cDNA were isolated from pLyt2-a [19], and each fragment was subcloned into the SmaI-EcoRI site of pBluescript SK ÷ (Stratagene, La Jolla, CA). Two fragments (293 bp and 479 bp) generated after digestion of these vectors with BamHI and EcoRI were recloned into the BamHI site of the pBluescript vector to reconstitute the full-length Lyt-2 ~ cDNA. Following linearization with XbaI which opened the plasmid at the site downstream of Lyt-2 a cDNA, pLyt2SK.BamHI DNA was treated with BAL 31 for various intervals of time. BAL 31-digested ends were blunted with the Klenow fragment of Escherichia coli DNA polymerase I and the DNA fragments delineated by the upstream SalI site and blunt-ended deletion sites were isolated after SalI digestion. Subsequently, these fragments were subcloned into the SalI-EcoRV site of pBluescript SK- in which a synthetic oligonucleotide encoding translation stop codons in all three reading frames was previously in268

serted into the Sinai site, allowing termination of translation of the truncated Lyt-2 cDNA. These subcloned fragments were sequenced from the BAL 31 digested ends by dideoxy chain termination method [20]. The vector DNA of appropriate clones was digested with BamHI and, after filling-in, the fragment containing the truncated Lyt-2 cDNA was cloned into the blunt-ended XhoI site of pBMGneo vector [21]. 3.3. Transfection 0.06/~g/A -1 of StuI-linearized pLyt-2.BMG or its deletion mutants and 0.3 #g/z1-1 of MLV/lck-A2 [17] were sterilized, mixed, and transfected onto 2×106 of LyD9 cells suspended in 40/zl of phosphate-buffered saline by electroporation as described [17]. Selection with Geneticin was started 48 h after transfection. Geneticin-resistant clones were obtained using 96-well plates.

3.4. Flow cytometric analysis of Lyt-2 molecules on the surface of LyD9 transfected cells Cells were incubated with an anti-Lyt-2 mAb conjugated with FITC. After washes in phosphatebuffered saline, 10 4 of the cells were analyzed with FACScan (Becton-Dickinson, Franklin Lakes, NY). 3.5. Immune complex kinase assays Assays were performed according to the method described previously [17]. Briefly, about 106 cells were lysed in 1% Nonidet P-40 containing buffer. Lysates were incubated with anti-Lyt-2 or anti-lck antibodies. Immune complexes were precipitated by anti-rat Kchain mAb-coated or non-coated Pansorbin, respectively. Immune complexes were incubated with [3,-32p]ATP and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and autoradiography. 4. Results

We engineered four cytoplasmic deletion mutants of the Lyt-2 (mouse CD8 a chain) cDNA (Fig. 1), the details of whose construction were described in Materials and Methods. Co-transfection of a pro B cell line LyD9 [18] with the lck and mutant Lyt-2 ex-

*

*

*

*

*

*

WT

Y H R S R K R V C K C P R P L V R Q E G TACCACAGGAGCCGAAAGCGTGTTTGCAAATGTCCCAGGCCGCTAGTCAGACAGGAAGGCAAGCC

A4

Q S N S C S P L N ---CAATCGAATTCCTGCAGCCCGCTTAATTAA

A2

...........................

A6

....................................

AI8

...............................................................

I E F L Q P ATCGAATTCCTGCAGCCCGC

K

P

R P S E K I V CAGACC TTCAGAGAAAATTGTGTAA

A TTAA

I E F L Q P A ATCGAATTCC TGCAGCCCGCTTAA P S N S C CATCGAATTCCT

C S P L N GCAGCC CGCTTAATTAA

Fig. I. The sequences of the cytoplasmic domain of the wild-type and deletion mutants of Lyt-2. The nucleotide and deduced amino a c i d s e q u e n c e s o f t h e e n t i r e c y t o p l a s m i c d o m a i n a r e s h o w n . T h e d a s h e s in m u t a n t s e q u e n c e s r e p r e s e n t i d e n t i t i e s w i t h t h e w i l d - t y p e ( W T ) s e q u e n c e . T h e a m i n o a c i d s e q u e n c e s are s h o w n in t h e s t a n d a r d s i n g l e letter c o d e . T h e c o n s e r v e d r e s i d u e s a m o n g t h e h u m a n a n d m o u s e CD4

and

are marked with asterisks.

CD8a

pression vectors was d o n e as described previously. Trans fected cell clones were selected with the n e o m y cin analogue Geneticin and surface expression o f Lyt-2 m o l e c u l e s c o n f i r m e d by flow c y t o m e t r y (Fig. 2). Clones with similar expression levels o f Lyt-2 were lysed in the buffer containing 1o7o N o n i d e t P-40 and i m m u n o p r e c i p i t a t e d with anti-lck or antiLyt-2 antibodies. I m m u n e c o m p l e x e s recovered with the aid o f Pansorbin were incubated with [.y_32p] ATP and analyzed by S D S - P A G E and autoradiograplay. A s shown in Fig. 3, a u t o p h o s p h o r y l a t e d p56/ok m o l e c u l e s were observed in both i m m u n e c o m p l e x kinase reactions w h e n the LyD9 cells transfected

WT

] 4 -I

r ........ r ........ i ........ i ........ , 10 0

101

10 2

10 3

10 4

A4

A2

t . . . . .

I

4

] 4

i

4:1

I I

!/! A :

i

ii

I

: :J'k

A4

A2

A6

A18

I

i ........ i ........ F ........ i . . . . . . . ,I 10 0

101

10 2

10 3

10 4

10 0

101

A6

10 3

10 4

10 3

10 4

A18

4 "1 ] 4 -4 1

4 1

I/A.

10 0

10 2

101

10 2

10 3

10 4

10 0

101

10 2

Fig. 2. Flow cytometric analysis of the surface expression of Lyt-2 molecules on LyD9 transfectants. LyD9 and its derivatives doubly transfected with the Ick and Lyt-2 genes were stained with FITC-labeled anti-Lyt-2 monoclonal antibody and analyzed by FACScan. Dotted lines represent the negative control (LyD9) and solid lines the expression profile with the transfectants.

Fig. 3. Immune complex kinase assays. The LyD9 derivatives doubly transfected with the lck and Lyt-2 genes were processed as described in Materials and Methods. The left lanes of each column represent the reactions with the anti-Lyt-2 precipitated complexes and the right lanes with the anti-lck precipitated complexes. The arrow marks the position of p56/ck. 269

with the lck and wild-type Lyt-2 genes were used. The identity of the two 56-kDa bands was confirmed by partial V8 protease digestion (data not shown). This result reproduced our previous data [17], showing that Lyt-2 can associate with p56/ok. It is also shown that the Lyt-2 molecules encoded by the mutants A18 and A6 could associate with p56 Ice, but that those encoded by A4 and ,52 could not. The same results were obtained with at least three independent clones with each mutant. 5. Discussion The present study confirms the report by Zamoyska et al. [22] and demonstrates that the cytoplasmic domain of Lyt-2 is responsible for its association with p56 tcx as exemplified by the mutants A4 and A2. In accord with our previous studies [17], in which the synthetic peptide Lys-Lys-Thr-Cys-Gln-Cys-ProHis-Arg-Met-Gln-Lys corresponding to the conserved sequence motif of the cytoplasmic domain of CD4 was shown to bind to p56 Ick, the results described here support the idea that the twelveresidue motif is the binding site for p56/ok on both CD4 and CD8 a chain. In this sense the results with the mutants A2 and A6 are interesting. A2 encodes the Lyt-2 protein whose cytoplasmic domain has the four amino-terminal residues (Lys-Arg-Val-Cys) of the 12 residue motif. Lack of association between p56/ok and the A2-encoded Lyt-2 molecules indicates that the four-residue part is not sufficient for association between the two molecules. This is consistent with the peptide binding assays in our previous report [17], where the ll-residue CD4 peptide lacking the carboxy-terminal Lys residue in the twelve-residue motif was shown not to bind to p56/ok. /x6 codes for the Lyt-2 molecule with a cytoplasmic sequence in which the carboxy-terminal basic amino acid of the 12-residue motif is substituted with glutamine. Since the eleven-residue peptide devoid of the carboxy-terminal Lys of the 12-residue motif is known not to bind to p56 lcx, the positive charge of this basic amino acid may be important for interaction with p56/ck. We interpret that the polar amide N of glutamine instead could be involved in the interaction with p56 lck in the A6/lck transfectants, although the associated to non-associated p56 lck ratio appeared to be less than that of the W T / l c k or A18/lck transfectants. The results with 270

the A 6 / l c k transfectants have also shown that the unconserved four residues encompassed by the conserved Pro and Arg residues are not important for interaction between Lyt-2 and p56/ck. As discussed previously [17], there remains to be explored the role(s) played by p56 lck which is bound to by Lyt-2 molecules. Acknowledgements We are grateful to Dr. K. White for critical reading of the manuscript. Ms. S. Okazaki, R. Hirochika, and M. Wakino are gratefully acknowledged for their excellent technical assistance. This investigation was supported by grants from the Ministry of Education, Science and Culture of Japan. References [1] Littman, D. R. (1987) Annu. Rev. Immunol. 5, 561. [2] Norment, A. M. and Littman, D. R. (1988) EMBO J. 7, 3433. [3] DiSanto, J. P., Knowles, R. W. and Flomenberg, N. (1988) EMBO J. 7, 3465. [4] Swain, S. L. (1983) Immunol. Rev. 74, 129. [5] Emmrich, E, Strittmatter, U. and Eichmann, K. (1986) Proc. Natl. Acad. Sci. USA 83, 8298. [6] Emmrich, E, Kanz, L. and Eichmann, K. (1987) Eur. J. lmmunol. 17, 529. [7] Walker, C., Bettens, E and Pichler, W. J. (1987) Eur. J. Immunol. 17, 873. [8] Takada, S. and Engleman, E. G. (1987) J. lmmunol. 139, 3231. [9] Rudd, C. E., Trevillyan, J. M., Dasgupta, J. D., Wong, L. L. and Schlossman, S. F. (1988) Proc. Natl. Acad. Sci. USA 85, 5190. [10] Veillette, A., Bookman, M. A., Horak, E. M. and Bolen, J. B. (1988) Cell 55, 310. [11] Hanks, S. K., Quinn, A. M. and Hunter, T. (1988) Science 241, 42. [12] Cooper, J. A. (1989) in: Peptides and Protein Phosphorylation (B. Kemp and P. E Alewood, Eds.) CRC Press, Boca Raton, FL, in press. [13] Marth, J. D., Peer, R., Krebs, E. G. and Perlmutter, R. M. (1985) Cell 43, 393. [14] Veillette, A., Horak, 1. D., Horak, E. M., Bookman, M. A. and Bolen, J. B. (1988) Mol. Cell. Biol. 8, 4353. [15] Marth, J. D., Lewis, D. B., Cooke, M. P., Mellins, E. D., Gearn, M. E., Samelson, L. E., Wilson, C. B., Miller, A. D. and Perlmutter, R. M. (1989) J. Immunol. 142, 2430. [16] Veillette, A., Bookman, M. A., Horak, E. M. Samelson, L. E. and Bolen, L. B. (1989) Nature 338, 257. [17] Kawakami, T., Yao, L., Nakauchi, H., Kawakami, Y., Nisitani, S., Otaka, A., Koide, T., Koumoto, Y., Fujii, N. and Honjo, T. (1990) submitted.

[18] Nakauchi, H., Nolan, G. P., Hsu, C., Huang, S., Kavathas, P. and Herzenberg,L. A. (1985) Proc. Natl. Acad. Sci. USA 82, 5126. [19] Tagawa, M., Nakauchi, H., Herzenberg, L. A. and Nolan, G. P. (1986) Proc. Natl. Acad. Sci. USA 83, 3422. [20] Sanger, E, Nicklen, S. and Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. USA 74, 5463. [21] Karasuyama, H. and Melchers, E (1988) Eur. J. Immunol. 18, 97. [22] Zamoyska, R., Derham, P., Gorman, S. D., von Hoegen, P., Bolen, J. B., Veillette, A. and Parnes, J. R. (1989) Nature 342, 278.

271