EPIDEMIOLOGY

MICROBIAL DRUG RESISTANCE Volume 00, Number 00, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0072

The Contribution of Class 1 Integron to Antimicrobial Resistance in Stenotrophomonas maltophilia Yi-Wei Huang,1 Rouh-Mei Hu,2,3 Yi-Tsung Lin,4,5 Hsin-Hui Huang,1 and Tsuey-Ching Yang1

Two hundred clinical isolates of Stenotrophomonas maltophilia were examined for the presence of class 1 integron and for the susceptibility to 12 different antimicrobials and detergents. The prevalence of class 1 integron in S. maltophilia isolates was 11%. The class 1 integron-positive isolates exhibited a higher resistance to kanamycin, tobramycin, and trimethoprim–sulfamethoxazole (SXT) than the class 1 integron-negative ones. Polymerase chain reaction (PCR), amplifying the variable region of the class 1 integron, showed the existence of six different amplicon sizes, indicating that there are at least six different class 1 integrons distributed in the 23 class 1 integron-positive isolates. Sequence analysis of six representative PCR amplicons revealed that qacK, aac(6¢)-Ib¢, qacK-aac(6¢)-Ib, qacK-aac(6¢)-Ib-aac(6¢)-Ib, and qacL-aadB-cmlA-aadA2 were identified in the 550-, 800-, 1,200-, 1,800, and 3,600-bp amplicons, respectively. The sequence analysis of the 150-bp PCR amplicon demonstrated no additional resistance-associated genes except the basic genetic elements of class 1 integron. The impact of class 1 integron acquisition on the antimicrobials susceptibility was assayed by isogenic integron deletion mutant construction and the susceptibility test. The most significant contribution of the class 1 integron acquisition to S. maltophilia is the increased resistance to SXT.

Burkholderia, Enterobacteriaceae, Morganella, Proteus, Pseudomonas, Stenotrophomonas, and Vibrio.13 Stenotrophomonas maltophilia, a ubiquitous Gram-negative bacillus, is widely isolated from natural environments, animals, plants, and human.30 In addition, S. maltophilia is an important opportunistic pathogen considered as one of the major agents of nosocomial infections.5 S. maltophilia exhibits a variety of mechanisms that contribute to the resistance to an array of antimicrobial agents.31 First, S. maltophilia harbors intrinsically expressed antimicrobial resistance determinants, including b-lactamases, aminoglycoside-modifying enzymes (AMEs), and multidrug efflux pumps. Furthermore, some intrinsically quiescent antimicrobial resistance determinants can be further expressed by environmental stimuli or gene mutation. In addition, S. maltophilia can enforce its resistance potential by horizontally acquiring resistance through integrons, transposons, and plasmids.32 Therefore, the treatment of S. maltophilia infections is a great challenge to clinicians. Trimethoprim–sulfamethoxazole (SXT) is one of the most active agents for treating S. maltophilia infection.5 However, the emergence of the SXT-resistant S. maltophilia has been reported, with a prevalence of 3.8% in Latin America, North America, and Europe, 28.3% in Turkey, 33% in China, and 18–25% in Taiwan.8,14,17,21,35

Introduction

I

ntegrons are gene capture elements that recruit antimicrobial resistance determinant using site-specific recombination. The site-specific recombination is catalyzed by the integron-encoded integrase.18 Integron generally consists of three components: the integrase gene (intI) that encodes integrase mediating site-specific recombination, the recombination site (attI) that is recognized by integrase, and the promoter (Pc) that is necessary for the expression of gene cassettes embedded in the integron. According to the sequence of integrase genes, the integrons have been classified into a few classes, of which class 1 integron has received the most attention because of its contribution to antimicrobial resistance in clinical settings.13 Class 1 integrons are composed of three distinct genetic regions: the 5¢-conserved segment (5¢-CS), the 3¢-conserved segment (3¢-CS), and the central variable region, where the gene cassettes are embedded. The 5¢-CS contains an integrase gene (intI1), an attI recombination site, and the promoter Pc. The 3¢CS consists of the qacED1 and sul1, which mediate resistance to quaternary ammonium compounds (QACs) and sulfonamides, respectively. Class 1 integrons are mainly reported in Gram-negative bacteria such as Acinetobacter, Aeromonas, 1

Department of Biotechnology and Laboratory Science in Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China. Departments of 2Biotechnology and 3Biomedical Informatics, Asia University, Taichung, Taiwan, Republic of China. Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, Republic of China. 5 School of Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China. 4

1

2

HUANG ET AL.

Several mechanisms have been described as conferring the SXT resistance in clinical bacteria, including (1) mutations in genes encoding dihydropteroate synthetase (DHPS) or dihydropteroate reductase (DHFR), (2) acquisition of new low-affinity DHPS or DHFR genes, and (3) promoter mutation leading to overproduction of DHFR.15 However, such mechanisms have been less reported in S. maltophilia isolates. The reported mechanisms concerning the SXT resistance in S. maltophilia include the sul1, sul2, and the insertion element common region elements.32 Among them, the sul1 gene, as part of a class 1 integron, makes a more significant contribution to the SXT resistance. Class 1 integron has been identified in S. maltophilia strains isolated in Argentina, Europe, the United States, Australia, Taiwan, China, and Malaysia.1,8,21,24,27,32 Most studies concerning the class 1 integron and S. maltophilia focus on the SXT resistance and the prevalence. In this study, class 1 integron-mediated antimicrobial resistance was investigated to determine its role among the clinical isolates of S. maltophilia. Materials and Methods S. maltophilia isolates

Two hundred epidemiologically unrelated S. maltophilia isolates (isolates FE1-FE200) were collected from the routine clinical microbiology laboratory in the Far Eastern Memorial Hospital in northern Taiwan. Our study involved 108 men aged 32–88 and 92 women aged 27–93. The isolates were originated from sputum (148), blood (16), bile (8), ascites (8), tissue (4), cerebrospinal fluid (4), bronchial washing (4), urine (4), and pleural (4). All isolates were initially identified by the Phoenix100 system (Becton Dickinson) and further confirmed by the polymerase chain reaction (PCR) using the species-specific primers SM-F/SM-R (Table 1), which targets a specific 531-bp sequence from the 16S rRNA gene of S. maltophilia.34 Repetitive extragenic palindromic-PCR (REPPCR) was used for the determination of clone related-

ness.25 Isolates with undistinguishable REP-PCR banding patterns were excluded. Susceptibility test

Antimicrobials susceptibility tests were performed by a standard twofold serial agar dilution method according to the guidelines of the CLSI.10 All antimicrobial agents used were purchased from Sigma Aldrich. Final concentrations of 1–2,048 mg/L were tested for all antimicrobial agents except SXT. The concentrations of SXT tested were from 0.125 to 32 mg/L. The minimal inhibitory concentration (MIC) was defined as the antimicrobial concentration at which no visible bacterial growth was observed. Polymerase chain reaction

The integrase 1 (intI1) and sulfonamide resistance (sul1) genes were screened in the S. maltophilia isolates with primers Int1-F/Int1-R and Sul1-F/Sul1-R (Table 1), respectively. Gene cassettes embedded within the class 1 integrons were also determined using primers Int1V-F/Int1V-R (Table 1). The DNA used for PCR was prepared, as described previously.25 The PCR was performed using a conditioned program: 94C for 10 min, followed by 30 cycles of 94C for 1 min, 58C for 1 min, and 72C for 1–5 min depending on the sequence to be amplified. The amplified products were separated by electrophoresis in 2% agarose gels. Construction of class 1 integron deletion mutants

Two PCR amplicons containing partial integrase 1 (intI1) and dihydropteroate synthase (sul1) genes were amplified using primer sets of DInt1N-F/DInt1N-R and DInt1C-F/ DInt1C-R (Table 1 and Fig. 1), respectively, and then subsequently cloned into pEX18Tc to yield the recombinant plasmid pDInt1. Plasmid pDInt1 was mobilized from Escherichia coli S17-1 into recipient S. maltophilia by conjugation. The transconjugants were initially selected on LB agar plates supplemented with tetracycline (40 mg/L)/ norfloxacin (2.5 mg/L). The double crossover integron

Table 1. Primers Used in This Study Primer name SM-F SM-R Int1-F Int1-R Sul1-F Sul1-R Int1V-F Int1V-R DInt1N-F DInt1N-R DInt1C-F DInt1C-R Int1M-F Int1M-R QacL-F QacL-R

Sequence (5¢/3¢)

Purpose

CAGCCTGCAAAAGTA TTAAGCTTGCCACGAACAG GCATCCTCGGTTTTCTGG GGTGTGGCGGGCTTCGTG GACGGTGTTCGGCATTCT TTTGAAGGTTCGACAGC GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA GGTCTGCAGTGTGGCGGGCTTCGTG GTTCGGATCCTCGGTTTTCTGGAA CCATGTCGACGGTGTTCGGCATTCT CTTAAGCTTTTGAAGGTTCGACAGC GCGAACAAACGATGCTCGCC CGGTCCGACATCCACGACG CGATGTTACGCAGCAGGGCAG CCCACCAAGCAGGTTCGCAGT

Stenotrophomonas maltophilia Identification The presence of intI1 The presence of sul1 Gene cassette identification Mutant construct Mutant construct Mutant check Construction of pQacL

INTEGRON-MEDIATED RESISTANCE IN S. MALTOPHILIA

deletion mutant was further selected on an LB agar containing 10% sucrose.36 The correctness of deletion mutants was checked by colony PCR amplification using primers Int1M-F/Int1M-R (Table 1).25 Construction of qacL expression plasmid, pQacL

To determine the resistance profile of QacL, a qacL expression plasmid, pQacL, was constructed using the T vector (Yeastern Biotech Co.). The 3,660-bp DNA fragment embedded in the IntF7 was initially amplified from isolate FE7 by PCR using primer sets Int1V-F/R (Table 1). The qacL gene in the 3,660-bp PCR amplicon was further amplified by PCR using QacL-F and QacL-R as primers (Table 1). The 834-bp PCR amplicon containing the intact qacL gene was cloned into the T vector and its correctness was checked by fluorescencebased sequencing methods. Phylogenetic analysis

Multiple sequence alignments among the assayed proteins were carried out using the ClustalX program. Phylip package3.69 was used for the phylogenetic analysis and the DNA distances were calculated by DNADist using the Kimura model. Phylogenetic trees were constructed based on the neighbor-joining methods. The bootstrap number was obtained in 1,000 replications. Nucleotide sequence accession numbers

The sequences of the gene cassettes embedded in class 1 integron have been deposited in GenBank and assigned the following accession numbers: KF556704 for InB10; KF556705 for InC9; KF556706 for InD12; KF556707 for InE47; and KF556708 for InF7. Results Prevalence of class 1 integron in S. maltophilia isolates

To assess the presence of class 1 integrons, the associated integrase (intI1) and sulfonamide resistance (sul1) genes were screened. Of 200 epidemiologically unrelated S. mal-

3

tophilia isolates, 23 (11%) isolates were positive for both genes. These isolates were isolated from sputum (n = 14, 61.2%), blood (n = 4, 17.3%), bile (n = 2, 8.6%), bronchial washing (n = 1, 4.3%), urine (n = 1, 4.3%), and pleural (n = 1, 4.3%). The age and gender of patients were less relevant to the presence of class 1 integron. Comparison of antimicrobial susceptibility between class 1 integron-positive and class 1 integron-negative isolates

To assess the impact of class 1 integron on the antimicrobial resistance, the antimicrobial susceptibility of the 200 isolates was performed. The antimicrobials tested included chloramphenicol, quinolone, tetracycline, aminoglycoside, macrolide, QACs, and SXT. Table 2 demonstrates a link between the presence of class 1 integron and the high MIC50 to kanamycin, tobramycin, and SXT. It was creditably mentioned that the prevalence of SXT resistance in clinical isolates was 13% (26/200). Of the 26 SXT resistance isolates, 23 isolates were positive for class 1 integron. Analysis of the gene cassettes embedded in the class 1 integrons

The variable region of the class 1 integron was examined by PCR using Int1V-F and Int1V-R as primers (Table 1). According to the size of PCR amplicons, six distinct DNA fragments embedded in the class 1 integrons were revealed from the 23 isolates assayed. The PCR amplicons of approximate size 150-, 550-, 800-, 1,200-, 1,800-, and 3,600-bp were designed as type A, B, C, D, E, and F, respectively. The prevalence of different type amplicons was 22% (5/23), 13% (3/23), 52.1% (12/23), 4.3% (1/ 23), 4.3% (1/23), and 4.3% (1/23) for types A to F, respectively. The PCR amplicons obtained from isolates FE43, FE10, FE9, FE12, FE47, and FE7 were selected as the representatives of types A to F for further determination of the harboring gene cassettes. The class 1 integrons harbored by isolates FE43, FE10, FE9, FE12, FE47, and FE7 were designated as InA43, InB10, InC9, InD12, InE47, and InF7, respectively. Figure 1 demonstrates the six class 1 integrons. InA43 contained no additional

Table 2. Antimicrobial Susceptibility of Class 1 Integron-Positive and Class 1 Integron-Negative Stenotrophomonas maltophilia Isolates Class 1 integron-positive (n = 23) Antimicrobial Chloramphenicol Nalidixic acid Tetracycline Kanamycin Tobramycin Amikacin Erythromycin CTAB BC Proflavine Ethidium bromide SXT

Class 1 integron-negative (n = 177)

MIC range (mg/L)

MIC50 (mg/L)

MIC range (mg/L)

MIC50 (mg/L)

8 to > 128 4 to 64 16 to 256 2 to 2,048 < 2 to 1,024 16 to 512 128 to 1,024 64 to > 512 32 to 256 < 256 to 1,024 512 to > 2,048 0.5 to 32

16 16 32 512 256 128 512 128 128 512 2,048 8

8 to 16 8 to 64 8 to 64 32 to 2,048 < 2 to 512 16 to 2,048 256 to 1,024 64 to 128 32 to 128 < 256 to 1,024 512 to 2,048 0.125 to 16

16 32 32 64 64 128 512 64 64 1,024 2,048 0.5

CTAB, cetyl trimethyl ammonium bromide; BC, benzalkonium chloride; SXT, trimethoprim–sulfamethoxazole. MIC50, minimum inhibitory concentration required to inhibit the growth of 50% of organisms.

4

HUANG ET AL.

FIG. 1. The gene cassette structures of six different class 1 integrons recovered from Stenotrophomonas maltophilia isolates FE43, FE10, FE9, FE12, FE47, and FE7. The solid bar indicates the polymerase chain reaction amplicons for the construction of plasmid pDInt1, which is used for the construction of integron 1 deletion mutant. intI1, site-specific integrase 1 gene; qacK, quaternary ammonium compound K gene; aac(6¢)-Ib¢, aminoglycoside (6¢) acetyltransferase gene; qacL, quaternary ammonium compound L gene; aadB, aminoglycoside (2¢¢) adenylyltransferase gene; cmlA, nonenzymatic chloramphenicol resistance gene; aadA2, streptomycin 3¢¢-adenylyltransferase gene; qacED1, deleted derivative qacE (quaternary ammonium compounds E) gene; and sul1, sulfonamide resistance gene. captured gene cassette except the basic genetic elements of class 1 integron. The smr gene, annotated as qacK hereafter, encoding a putative small multidrug resistance (SMR)-family efflux protein, was identified in InB10. InC9 contained an embedded aac(6¢)-Ib¢ gene. The gene cassettes carried by InD12 were a qacK gene and an aac(6¢)-Ib¢ gene. InE47 carried a qacK gene and two tandem aac(6¢)-Ib¢ genes. InF7 harbored four resistance gene cassettes, a 333-bp putative SMR family exporter gene (designated as qacL hereafter), aadB (aminoglycoside adenylyltransferases), cmlA (chloramphenicol efflux protein), and aadA2 (Fig. 1). Analysis of the class 1 integron-mediated antimicrobial resistance

To determine the contribution of class 1 integron to antimicrobial resistance, the strategy of genetic knockout was per-

formed. The knockout mutants of class 1 integron were constructed on isolates FE43, FE10, FE9, FE12, FE47, and FE7, respectively, by the strategy of homologous recombination, as described in Materials and Methods. Unfortunately, after several tries, the class 1 integron knockout mutant of FE7 was not available. The selection of pEX18Tc-mediated transconjugants was based on the tetracycline resistance.20 Tetracycline displayed a high MIC toward isolate FE7 (256 mg/L) (Table 3), which may be the reason as to why the class 1 integron deletion mutant of isolate FE7 cannot be successfully obtained. The antimicrobial susceptibilities of the knockout mutants (FE43DInt1, FE10DInt1, FE9DInt1, FE12DInt1, and FE47DInt1) and their parental counterparts were assessed (Table 3). Removal of the class 1 integron from isolate FE43 increased the susceptibility to SXT, but not to any QAC tested, indicating that the qacED1 makes little contribution to QAC resistance in S. maltophilia. Compared with their individual parental strains FE10,

Table 3. Antimicrobial Susceptibility of Stenotrophomonas maltophilia Isolates and Their Derived Class 1 Integron Deletion Mutants MIC (mg/L) FE43 Antimicrobial CHL NAL TET KAN TOB AMK ERY CTAB BC PF EthBr SXT

WT

DInt1

FE10 WT

DInt1

FE9 WT

DInt1

8 8 16 16 8 8 16 16 16 16 8 8 32 32 32 32 16 16 1,024 1,024 64 64 512 32 256 256 64 64 128 8 128 128 256 256 64 64 512 512 256 256 256 256 64 64 128 128 128 128 64 64 128 64 128 128 512 512 1,024 1,024 512 512 2,048 2,048 2,048 2,048 2,048 2,048 0.5 < 0.125 16 0.5 16 0.5

FE12 WT

DInt1

FE47 WT

DInt1

FE7

Escherichia coli DH5a

WT

pT

16 16 16 16 128 ND 32 32 32 32 32 ND 32 32 32 32 256 ND 1,024 512 > 2,048 1,024 512 ND 1,024 64 2,048 128 512 ND 512 512 1,024 1,024 64 ND 512 512 512 512 256 ND 128 128 128 128 128 8 128 64 128 64 256 2 1,024 1,024 1,024 1,024 1,024 4 1,024 1,024 2,048 2,048 2,048 2 8 0.5 16 0.5 8 ND

pQacL

pQacK

ND ND ND ND ND ND ND 256 128 64 256 ND

ND ND ND ND ND ND ND 128 128 32 16 ND

CHL, chloramphenicol; NAL, nalidixic acid; TET, tetracycline; KAN, kanamycin; TOB, tobramycin; AMK, amikacin; ERY, erythromycin; PF, proflavine; EthBr, ethidium bromide; ND, not determined.

INTEGRON-MEDIATED RESISTANCE IN S. MALTOPHILIA

FE12, and FE47, the MICs of FE10DInt1, FE12DInt1, and FE47DInt1 to benzalkonium chloride (BC) had a twofold decrease, supporting that the qacK determinant confers a slight resistance to BC. Class 1 integron deletion from the aac(6¢)-Ib¢containing isolates (FE9, FE12, and FE47) decreased the resistance to kanamycin and tobramycin, which is consistent with the reported substrate profile of AAC(6¢)-Ib¢.23 Since mutant FE7DInt1 was not available, the IntF7-medicated resistance was considered by the captured gene cassettes. Of the four gene cassettes harbored in IntF7 (Fig. 1), the aadB, cmlA, and aadA2 have been reported and their contributions to antimicrobial resistance are well known.2,3,7 To evaluate the contribution of QacL to QAC resistance, plasmid pQacL was prepared, as described in Materials and Methods. The susceptibility of E. coli DH5a (pQacL) to QACs was assessed by the susceptibility test, as shown in Table 3. Compared with the vector control DH5a (pT), DH5a (pQacL) displayed apparent resistance to cetyl trimethyl ammonium bromide (CTAB), BC, proflavine, and ethidium bromide. The contribution of QacK to QAC resistance was also included for comparison (Table 3). Phylogenetic analysis of SMR family QAC exporters

Two QAC resistance genes, qacK and qacL, were characterized in this study. Both belonged to the SMR family exporter. The 105-aa QacK protein is the member of the SugE-type efflux protein subfamily. SugE-type efflux protein is known to confer resistance to toxic QACs.9 To elucidate the phylogenetic relationship between the two novel QAC exporters and the known SMR family QAC exporters, the phylogenetic analysis was assessed. The QAC exporters analyzed included QacC/D, QacE, QacF, QacG, QacH, QacJ, and EmrE.4,19,26,29 Three distinct phylogenetic clades were observed and labeled as clades I to III in Fig. 2. The qac genes, reported in Gram-positive bacteria, were located in clade I. The qac genes included in clade II were identified in Gram-negative bacteria. The QacL, a member of

FIG. 2. Phylogenetic analyses of small multidrug resistance family QAC exporters. The alignment of the protein sequences was performed by ClustalX program. The phylogenetic tree was created using the neighbor-joining matrix method. Bootstrap values from 1,000 replicates are shown. The accession numbers of QAC exporter protein sequences: QacC, AAA60379; QacD, AAA26666; QacE, AEH26330; QacF, AAG68348; QacG, AFQ93496; QacH, O87868; QacJ, CAD55144; EmrE, YP_669772, QacK, KF556704, and QacL, KF556708.

5

clade II, displayed the closest phylogenetic relationship with QacF. However, interestingly, the QacK formed a separate phylogenetic clade from all the QAC exporters examined, despite being identified in Gram-negative bacteria (Fig. 2). Discussion

The class 1 integron-mediated antimicrobial resistance has been widely reported in different geographic regions and bacterial isolates. Most studies focus on the prevalence of class 1 integron, the physical linkages of integron gene cassettes, and the phenotype of antimicrobial resistance. Buffet-Bataillon et al. found that three clinical E. coli isolates, which contained the class 1 integron with the same captured gene cassette, exhibited different antimicrobial resistance patterns.6 Therefore, the actual impact of class 1 integron acquisition on the bacterial antimicrobial resistance cannot be simply judged by the harbored gene cassette types owing to the following two considerations. First, there is quite a diversity in the gene cassette promoter variants of class 1 integron,33 which is linked to the expression level of captured gene cassette(s) and antimicrobial resistance. Second, the resistance determinants from the bacterial chromosomal background may shield the contribution of class 1 integron to the resistance. S. maltophilia is a species intrinsically harboring an array of resistance determinants, so the contribution of class 1 integron to the antimicrobial resistance should be more complicated than we can imagine. In this study, the strategy of class 1 integron deletion mutant construction can provide a clear evidence to describe the impacts of class 1 integron acquisition on antimicrobial resistance. Some interesting findings have been observed in this study: (1) Table 2 demonstrates that the qacL and qacK in E. coli transformants indeed increase the resistance toward QACs. However, deletion of class 1 integron does not alter the MICs to QAC tested in the S. maltophilia isolates harboring the qacL- and qacK-containing integron (FE10, FE12, and FE47) (Table 2). These observations indicate that S. maltophilia exhibits a high intrinsic resistance to QAC, such as the outer membrane permeability, which may shield the class 1 integron-mediated QAC resistance. (2) It has been well known that S. maltophilia intrinsically harbors many chromosomal aminoglycoside resistance determinants such as AMEs and multidrug efflux pumps (SmeIJK and SmeYZ).16,22,28 However, the most common gene cassettes found in the class 1 integrons of S. maltophilia isolates are the AME genes (Fig. 1). Although acquisition of AME gene cassettes indeed confers isolates more resistance to aminoglycosides (e.g., FE9, FE12, and FE47), the FE12DInt1 and FE47DInt1 still display a high resistance to aminoglycosides (Table 3), indicating that FE12 and FE47 may have the properties of high aminoglycoside resistance before the acquisition of class 1 integron. Therefore, for some S. maltophilia isolates, the significance of the acquisition of class 1 integron cannot be simply judged by the types of captured gene cassettes. The chromosome of S. maltophilia harbors many antimicrobial resistance determinants,12 however, few chromosomally resistance determinants involved in the SXT resistance have been reported so far. Three evidences presented in this study link the class 1 integron to the SXT

6

resistance in S. maltophilia: (1) There is a high prevalence of class 1 integron in the SXT-resistant isolates (88%, 23/ 26), which is consistent with the previous studies,1,8 (2) Of the 23 class 1 integron-positive isolates, six isolates harbor the InA43-like class 1 integron (no gene cassette in the variable region), meaning that the acquisition of class 1 integron gives S. maltophilia a favor to stress fitness even though no additional gene cassettes are captured. (3) All class 1 integron knockout mutants tested in this study display significant compromise in SXT resistance, but not in QAC resistance (Table 3). Therefore, the most important significance of the horizontal acquisition of class 1 integron should be the occurrence of SXT resistance in S. maltophilia. The gene cassettes identified in this study include three AME genes (aac(6¢)-Ib¢, aadA2, and aadB), two QAC resistance genes (qacK and qacL), and a chloramphenicol resistance gene (cmlA). Of them, aac(6¢)-Ib¢, aadA2, aadB, and cmlA have been well characterized previously. The aac(6¢)Ib¢, aadA2, and aadB encode the enzymes of AAC(6¢)-Ib¢, aminoglycoside-3¢¢-adenylyltransferase, and aminoglycoside (2¢¢) adenylyltransferase, which can modify the kanamycin/ tobramycin/ gentamicin, streptomycin/spectinomycin, and kanamycin/gentamicin/tobramycin, respectively.3,7,22 The putative chloramphenicol resistance determinant encoded by the cmlA gene of InG7 is 97% and 85% identical to the CMLA and CMLA2 chloramphenicol exporters,2,29 respectively, which have been known to confer chloramphenicol resistance. The results of susceptibility test agreed well with the expected resistance profile of these gene cassettes (Table 3). The result that QacK-containing class 1 integron confers a slight resistance to BC and QacL contributes the resistance to CTAB, BC, proflavine, and ethidium bromide is initially found. Some of the class 1 integrons found in this study have also been reported in other S. maltophilia isolates, isolated in different countries. S. maltophilia isolates, isolated in Germany and Brazil, harbor the integron the same as the InA43.32 The A S. maltophilia isolate, isolated in Australia, carries an integron the same as the InB10. The InC9 has been reported in the S. maltophilia isolates from the United States and Chile.32 This phenomenon points out that certain types of class 1 integrons are distributed worldwide and may be inclined to be captured by S. maltophilia. The gene cassette sequence of the InG7 is identical to the InPSN18 harbored by a Pseudomonas aeruginosa isolate, isolated from a healthy captive snake in France.11 The integrase gene (int1) of InPSN18 has been reported to be disrupted by the inserted transposon IS26 carrying a tetracycline resistance module tetA(C)-tetA(R).11 In view of the high tetracycline resistance in isolate FE7 (Table 3), we speculate that a similar genetic organization of transposon insertion may exist in InG7. To test the presence of transposon-mediated tetracycline resistance module in InG7, the downstream region of the integrase 1 gene of InG7 was obtained by PCR using an array of primer sets, which are designed based on the known sequence of InPSN18 (accession No. AJ867811 and AJ639924). Indeed, the tetA(C)-tetA(R) module carried by the IS26 was found in InG7 (data not shown). This may be the reason why isolate EF7 displays a high resistance to tetracycline.

HUANG ET AL. Acknowledgment

This work was supported by the National Science Council of Taiwan (NSC 101-2320-B-010-053-MY3). Disclosure Statement

No competing financial interests exist. References

1. Barbolla, R., M. Catalano, B.E. Orman, A. Famiglietti, C. Vay, J. Smayevsky, D. Centro´n, and S.A. Pin˜eiro. 2004. Class 1 integrons increase trimethoprim-sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob. Agents Chemother. 48:666– 669. 2. Bissonnette, L., S. Champetier, J.P. Buisson, and P.H. Roy. 1991. Characterization of the nonenzymatic chloramphenicol resistance (cmlA) gene of the In4 integron of Tn1696: similarity of the product to transmembrane transport proteins. J. Bacteriol. 173:4493–4502. 3. Bito, A., and M. Susani. 1994. Revised analysis of aadA2 gene of plasmid pSa. Antimicrob. Agents Chemother. 38:1172–1175. 4. Bjorland, J., T. Steinum, M. Sunde, S. Waages, and E. Heir. 2003. Novel plasmid-borne gene qacJ mediates resistance to quaternary ammonium compounds in equine Staphylococcus aureus, Staphylococcus simulans, and Staphylococcus intermedius. Antimicrob. Agents Chemother. 47:3046–3052. 5. Brooke, J.S. 2012. Stenotrophomonas maltophilia: an emerging global opportunistic pathogen. Clin. Microbiol. Rev. 25:2–41. 6. Buffet-Bataillon, S., A.L. Jeune, S. Le Gall-David, M. Bonnaure-Mallet, and A. Jolivet-Gougeon. 2012. Molecular mechanisms of higher MICs of antibiotics and quaternary ammonium compounds for Escherichia coli isolated from bacteraemia. J. Antimicrob. Chemother. 67:2837–2842. 7. Cameron, F.H., D.J.G. Obbink, V.P. Ackerman, and R.M. Hall. 1986. Nucleotide sequence of the AAD(2¢¢) aminoglycoside adenylyltransferase determinant aadB. Evolutionary relationship of this region with those surrounding aadA in R538-1 and dhfrII in R388. Nucleic Acid Res. 14:8625–8635. 8. Chang, L.L., H.H. Lin, C.Y. Chang, and P.L. Lu. 2007. Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 59:1038–1045. 9. Chung, Y.J., and M.H. Saier. 2002. Overexpression of the Escherichia coli sugE gene confers resistance to a narrow range of quaternary ammonium compounds. J. Bacteriol. 184:2543–2545. 10. [CLSI] Clinical Laboratory Standards Institute. 2010. Performance standards for antimicrobial susceptibility testing, 20th Informational Supplement. M100-S20. CLSI, Wayne, PA. 11. Colinon, C., D. Jocktane, E. Brothier, G.M. Rossolini, B. Cournoyer, and S. Nazaret. 2010. Genetic analyses of Pseudomonas aeruginosa isolated from healthy captive snakes: evidence of high inter- and intrasite dissemination and occurrence of antibiotic resistance genes. Environ. Microbiol. 12:716–729. 12. Crossman, L.C., V.C. Gould, J.M. Dow, G.S. Vernikos, A. Okazaki, M. Sebaihia, D. Saunders, C. Arrowsmith, T. Carver, N. Peters, E. Adlem, A. Kerhornou, A. Lord, L. Murphy, K. Seeger, R. Squares, S. Rutter, M.A.

INTEGRON-MEDIATED RESISTANCE IN S. MALTOPHILIA

13. 14.

15. 16.

17.

18. 19.

20.

21.

22.

23.

24.

25.

Quail, M.A. Rajandream, D. Harris, C. Churcher, S.D. Bentley, J. Parkhill. N.R. Thomson, and M.B. Avison. 2008. The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants. Genome Biol. 9:R74. Domingues, S., G.J. da Silva, and K.M. Nielsen. 2012. Integrons: vehicles and pathways for horizontal dissemination in bacteria. Mob. Genet. Elements 2:211–223. Fedler, K.A., D.J. Biedenbach, and R.N. Jones. 2006. Assessment of pathogen frequency and resistance patterns among paediatric patient isolates: report from the 2004 SENTRY Antimicrobial Surveillance Program on three continents. Diagn. Microbiol. Infect. Dis. 56:427–436. Giedraitiene, A., A. Vitkauskiene, R. Naginiene, and A. Pavilonis. 2011. Antibiotic resistance mechanisms of clinically important bacteria. Medicina 47:137–146. Gould, V.C., A. Okazaki, and M.B. Avison. 2013. Coordinate hyperproduction of SmeZ and SmeJK efflux pumps extends drug resistance in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 57:655–657. Gulmez, D., and G. Hascelik. 2005. Stenotrophomonas maltophilia: antimicrobial resistance and molecular typing of an emerging pathogen in a Turkish university hospital. Clin. Microbiol. Infect. 11:880–886. Hall, R.M. 2012. Integrons and gene cassettes: hotspots of diversity in bacterial genomes. Ann. N. Y. Acad. Sci. 1267: 71–78. Heir, E., G. Sundheim, and A.L. Holck. 1998. The Staphylococcus qacH gene product: a new member of the SMR family encoding multidrug resistance. FEMS Microbiol. Lett. 163:49–56. Hoang, T.T., R.R. Karkhoff-Schweizer, A.J. Kutchma, and H.P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86. Hu, L.F., X. Chang, Y. Ye, Z.X. Wang, Y.B. Shao, W. Shi, X. Li, and J.B. Li. 2011. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents 37:230–234. Lambert, T., M.C. Pley, and P. Courvalin. 1994. A spontaneous point mutation in the aac(6¢)-Ib¢ gene results in altered substrate specificity of aminoglycoside 6¢-Nacetyltransferase of a Pseudomonas fluorescens strain. FEMS Microbiol. Lett. 115:297–304. Lambert, T., M.C. Ploy, F. Denis, and P. Courvalin. 1999. Characterization of the chromosomal aac(6¢)-Iz gene of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 43:2366–2371. Liaw, S.J., Y.L. Lee, and P.R. Hsueh. 2010. Multidrug resistance in clinical isolates of Stenotrophomonas maltophilia: roles of integrons, efflux pumps, phosphoglucomutase (SpgM), and melanin and biofilm formation. Int. J. Antimicrob. Agents 35:126–130. Lin, C.W., C.S. Chiou, Y.C. Chang, and T.C. Yang. 2008. Comparison of pulse-field gel electrophoresis and three rep-PCR methods for evaluating the genetic related-

7

26.

27.

28. 29.

30.

31. 32.

33.

34.

35.

36.

ness of Stenotrophomonas maltophilia isolates. Lett. Appl. Microbiol. 47:393–398. Littlejohn, T.G., I.T. Paulsen, M.T. Gillespie, J.M. Tennent, M. Midgley, I.G. Jones, A.S. Purewal, and R.A. Skurray. 1992. Substrate specificity and energetics of antiseptic and disinfectant resistance in Staphylococcus aureus. FEMS Microbiol. Lett. 74:259–265. Neela, V., S.Z. Rankouhi, A. van Belkum, R.V. Goering, and R. Awang. 2012. Stenotrophomonas maltophilia in Malaysia: molecular epidemiology and trimethoprim-sulfamethoxazole resistance. Int. J. Infect. Dis. 16:e603–e607. Okazaki, A., and M.B. Avison. 2007. Aph(3’)-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 51:356–360. Ploy, M.C., P. Courvalin, and T. Lambert. 1998. Characterization of In40 of Enterobacter aerogenes BM2688, a class 1 integron with two new gene cassettes, cmlA2 and qacF. Antimicrob. Agents Chemother. 42:2557–2563. Ryan, R.P., S. Monchy, M. Cardinale, S. Taghavi, L. Crossman, M.B. Avison, G. Berg, D. van der Lelie, and J.M. Dow. 2009. The versatility and adaptation of bacteria from the genus Stenotrophomonas. Nat. Rev. Microbiol. 7:514–525. Sanchez, M.B., A. Hemandez, and J.L. Martinez. 2009. Stenotrophomonas maltophilia drug resistance. Future Microbiol. 4:655–660. Toleman, M.A., P.M. Bennett, D.M. Bennett, R.N. Jones, and T.R. Walsh. 2007. Global emergence of trimethoprim/ Sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg. Infect. Dis. 13:559–565. Wei, Q., X. Jiang, M. Li, G. Li, Q. Hu, H. Lu, G. Chen, Y. Zhou, and Y. Lu. 2013. Diversity of gene cassette promoter variants of class 1 integrons in uropathogenic Escherichia coli. Curr. Microbiol. 67:543–549. Whitby, P.W., K.B. Carter, J.L. Burns, J.A. Royall, J.J. LiPuma, and T.L. Stull. 2000. Identification and detection of Stenotrophomonas maltophilia by rRNA-directed PCR. J. Clin. Microbiol. 38:4305–4309. Wu, H., J.T. Wang, Y.R. Shiau, H.Y. Wang, T.L. Lauderdale, and S.C. Chang. 2012. A multicenter surveillance of antimicrobial resistance on Stenotrophomonas maltophilia in Taiwan. J. Microbiol. Immunol. Infect. 45:120e126. Yang, T.C., Y.W. Huang, R.M. Hu, S.C. Huang, and Y.T. Lin. 2009. AmpDI is involved in expression of the chromosomal L1 and L2 b-lactamases of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 53:2902–2907.

Address correspondence to: Tsuey-Ching Yang, PhD Department of Biotechnology and Laboratory Science in Medicine National Yang-Ming University 155 Section 2, Lie-Nong Street Taipei 112 Taiwan Republic of China E-mail: [email protected]