http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2015 Informa UK Ltd. DOI: 10.3109/19401736.2015.1038807
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Stylodipus telum (Rodentia: Dipodidae) and its phylogenetic analysis Guangjie Luo, Li Ding, and Jicheng Liao
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/07/15 For personal use only.
Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou, China Abstract
Keywords
Stylodipus telum belongs to the genus Stylodipus in the subfamily of Dipodinae. We got its complete genome first and it is 16,696 bp in length, the heavy strand contains 31.0% A, 13.8% G, 27.3% C, 27.9% T. Among them, protein-coding genes take up approximately 67.90% of the complete sequence. Trees constructed through phylogenetic analysis showed S. telum and Jaculus jaculus were clustered in one branch belonging to the family Dipodinae. This conclusion was identical to the former result by the methods of morphological taxonomy, and it would be convenient for further research on S. telum and other jerboa.
Complete genome, phylogentic analysis, Stylodipus telum
Stylodipus telum belongs to the genus Stylodipus in Dipodinae (Luo et al., 2000). In mammals, mitochondrial (mt) genome is about 15–17 kb in length. It is typical that mt gene arrangement composed of 22 transfer RNAs (tRNAs), 2 ribosomal RNAs (LrRNA and SrRNA), 13 protein-coding genes (PCGs) consisting of ND1-6 and ND4L, ATP6 and 8, COXI-III and Cytb (Avise et al., 1990; Boore, 1999; Clayton, 1992; Feng et al., 2010; Liu et al., 2012). We extracted total genomic DNA of S. telum from the muscle sample using TIANamp Genomic DNA Kit (Tiangen Biotech Beijing, Co., Ltd, China). The specimen was preserved in the School of Life Sciences, Lanzhou University. Three pairs of primers of S. telum (Table 1) were designed based on conserved regions of mt genes by aligning mt sequences and that of their sibling species from Genbank with MEGA 6.06 (Tamura et al., 2013). We amplified DNA with 50 ml reaction system which contained 10 ml 5 PCR buffer (Mg2+ plus), 4 ml dNTP (2.5 mM each), 2 ml of each primer (10 mM each), 1 ml PrimeSTAR GXL DNA Polymerase (1.25 U/ml), 2 ml total genomic DNA (100– 200 ng) and 29 ml water. PCR was run with pre-denaturation for 5 min at 98 C, followed by 30 cycles of denaturation for 10 s at 98 C, annealing for 15 s at 60 C, extension for 1 min/kb at 68 C, and a final extension at 68 C for 5 min. From the Genbank, We downloaded mt genome of 11 species with high similarity compared with S. telum (Figure 1). Phylogenetic tree was run in MrBayes version 3.2 (Ronquist et al., 2012) and Paup 4.0b10 (Swofford, 2002) using maximum parsimony (MP) and maximum likelihood (ML) methods. In the analysis of MP and ML trees, we valued 1000 of bootstrap and saved the minimum length tree finally. The complete mt sequence of S. telum is 16,696 bp in length, it is accessible at GenBank (Accession No. KR054627). Correspondence: Jicheng Liao, Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000, China. Tel: +86 13919484992. E-mail: [email protected]
History Received 4 April 2015 Accepted 5 April 2015 Published online 29 May 2015
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Stylodipus telum. Sequence of primer (50 –30 )
Name of primer ST (16S–F) ST (ND4-R) Inside* (16S-ND4)
ST (ND4-F) ST (CYTB-R) Inside (ND4-CYTB) ST (CYTB-F) ST (16S-R) Inside (CYTB-16S)
CAGAATGAACCCGTCTATGTGGC TTAGGTCGGTTTGTCGTAAGCAGAT GCAAAGGTAGCATAATCAT AGTCATGAGGTAAGGATAAGTAGT TCCCACCTCCTGCTTATG CCTAGGGCGATTGTGATGAAG CATTTTACCAACCTGACCT TAGGGATAAAATAAGGATGAGT CTCCATTAACAGGCTTTCTACC AAGGAATTAGGCACAGGT TATGCAAATCAAACAGCCCAAGAG TACCATTTCATCCCTCTCCCACAC GATTAGGGCTACGGCAAACTCT ATCAACTGGCTTCAATCTACTTCT AAGAAGAGATTTTTGTTTG TTATTATAGGCCACCTGTATTGTAG GTTACGGACGAGAAGGCGGTTAT GGACGATCAGAAGCTAATACCGC CTCTTCCTGTGCTCTGGGTCAAT AATGTCGGCATCCTACTATTGTTTG CTGGAAGGTCAATTTCACTGATAGG TAACACTAACTTGAATTGGAGGTC TGATACCCACTCCTTACAAT ATCCTATCTCCCTCACAC AACCCTAAAACAAGCACTAAAAT TACCGCAAGGGAAAGATGAAAG CTGGAAGGTCAATTTCACTGATAGG
*Extra internal sequencing primer.
Among them, PCGs are 11,337 bp long, taking up 67.90% approximately. We used MEGA 6.06 to analyze the overall base composition of the heavy strand, it contains 31.0% A, 13.8% G, 27.3% C, 27.9% T. Regarding the start and stop codons of PCGs, ATG is the initiation codon for all PCGs except for ND2, ND3 and ND5 that have ATA. Similartly, TAA is the termination codon for
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/07/15 For personal use only.
2
G. Luo et al.
Mitochondrial DNA, Early Online: 1–2
Figure 1. Phylogenetic tree based on the mitochondrial genome of Dipus sagitta, Stylodipus telum and other 11 species. The Genbank accession number of 11 species are as follows: Rattus norvegicus (FJ919759), Rattus fuscipes (GU570664), Rattus lutreolus (GU570661), Nannospalax carmeli (JN571137), Nannospalax golani (JN571138), Spalax ehrenbergi (AJ416891), Acomys cahirinus (JN571140), Myodes glareolus (KM892840), Apodemus agrarius (JN629047), Mus spretus (KM978950), Jaculus jaculus (AJ416890). Among, A. agrarius and M. spretus are designated as outgroup. The numbers on the right of internode branches are Bayesian posterior probability and bootstrap percentages for MP and ML analysis.
most PCGs and incomplete termination codon T is for ND1, ND2, COXIII and ND4; ATP8 ends with TAG and Cytb with AGA. The heavy strand is conducted as template for all the PCGs, but ND6 is on the light strand. Trees constructed by the Bayesian statistics, MP and ML methods showed a similar topological structure with very high support values (Figure 1). Stylodipus telum and Jaculus jaculus were clustered in one branch. This conclusion was identical to the former conclusion made for morphological taxonomy, and it would be a significant molecular evidence for the classification of Dipodinae as well.
Acknowledgements We are grateful to LM Zhao and QS Zhao, of School of Life Sciences, Lanzhou University, for helping in the process of sampling.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. The work was supported by the National Natural Science Foundation of China (Nos. 30870294, 31372179).
References Avise JC, Ankney CD, Nelson WS. (1990). Mitochondrial gene trees and the evolutionary relationship of mallard and black ducks. Evolution 44: 1109–19. Boore JL. (1999). Animal mitochondrial genomes. Nucleic Acids Res 27: 1767–80. Clayton DA. (1992). Transcription and replication of animal mitochondrial DNAs. Int Rev Cytol 141:217–32. Feng X, Liu DF, Wang NX, Zhu CD, Jiang GF. (2010). The mitochondrial genome of the butterfly Papilio xuthus (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mol Biol Rep 37:3877–88. Liu G, Zhou LZ, Gu CM. (2012). Complete sequence and gene organization of the mitochondrial genome of scaly-sided merganser (Mergus squamatus) and phylogeny of some Anatidae species. Mol Biol Rep 39:2139–45. Luo Z, Chen W, Gao W. (2000). Fauna sinica. Beijing: Science Press. Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Ohna SH, Larget BL, et al. (2012). Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42. Swofford DL. (2002). PAUP*: Phylogenetic analysis using parsimony, Version 4.0 b10. Sunderland (MA): Sinauer Associates. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–9.
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Stylodipus telum (Rodentia: Dipodidae) and its phylogenetic analysis Guangjie Luo, Li Ding, and Jicheng Liao
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/07/15 For personal use only.
Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou, China Abstract
Keywords
Stylodipus telum belongs to the genus Stylodipus in the subfamily of Dipodinae. We got its complete genome first and it is 16,696 bp in length, the heavy strand contains 31.0% A, 13.8% G, 27.3% C, 27.9% T. Among them, protein-coding genes take up approximately 67.90% of the complete sequence. Trees constructed through phylogenetic analysis showed S. telum and Jaculus jaculus were clustered in one branch belonging to the family Dipodinae. This conclusion was identical to the former result by the methods of morphological taxonomy, and it would be convenient for further research on S. telum and other jerboa.
Complete genome, phylogentic analysis, Stylodipus telum
Stylodipus telum belongs to the genus Stylodipus in Dipodinae (Luo et al., 2000). In mammals, mitochondrial (mt) genome is about 15–17 kb in length. It is typical that mt gene arrangement composed of 22 transfer RNAs (tRNAs), 2 ribosomal RNAs (LrRNA and SrRNA), 13 protein-coding genes (PCGs) consisting of ND1-6 and ND4L, ATP6 and 8, COXI-III and Cytb (Avise et al., 1990; Boore, 1999; Clayton, 1992; Feng et al., 2010; Liu et al., 2012). We extracted total genomic DNA of S. telum from the muscle sample using TIANamp Genomic DNA Kit (Tiangen Biotech Beijing, Co., Ltd, China). The specimen was preserved in the School of Life Sciences, Lanzhou University. Three pairs of primers of S. telum (Table 1) were designed based on conserved regions of mt genes by aligning mt sequences and that of their sibling species from Genbank with MEGA 6.06 (Tamura et al., 2013). We amplified DNA with 50 ml reaction system which contained 10 ml 5 PCR buffer (Mg2+ plus), 4 ml dNTP (2.5 mM each), 2 ml of each primer (10 mM each), 1 ml PrimeSTAR GXL DNA Polymerase (1.25 U/ml), 2 ml total genomic DNA (100– 200 ng) and 29 ml water. PCR was run with pre-denaturation for 5 min at 98 C, followed by 30 cycles of denaturation for 10 s at 98 C, annealing for 15 s at 60 C, extension for 1 min/kb at 68 C, and a final extension at 68 C for 5 min. From the Genbank, We downloaded mt genome of 11 species with high similarity compared with S. telum (Figure 1). Phylogenetic tree was run in MrBayes version 3.2 (Ronquist et al., 2012) and Paup 4.0b10 (Swofford, 2002) using maximum parsimony (MP) and maximum likelihood (ML) methods. In the analysis of MP and ML trees, we valued 1000 of bootstrap and saved the minimum length tree finally. The complete mt sequence of S. telum is 16,696 bp in length, it is accessible at GenBank (Accession No. KR054627). Correspondence: Jicheng Liao, Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000, China. Tel: +86 13919484992. E-mail: [email protected]
History Received 4 April 2015 Accepted 5 April 2015 Published online 29 May 2015
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Stylodipus telum. Sequence of primer (50 –30 )
Name of primer ST (16S–F) ST (ND4-R) Inside* (16S-ND4)
ST (ND4-F) ST (CYTB-R) Inside (ND4-CYTB) ST (CYTB-F) ST (16S-R) Inside (CYTB-16S)
CAGAATGAACCCGTCTATGTGGC TTAGGTCGGTTTGTCGTAAGCAGAT GCAAAGGTAGCATAATCAT AGTCATGAGGTAAGGATAAGTAGT TCCCACCTCCTGCTTATG CCTAGGGCGATTGTGATGAAG CATTTTACCAACCTGACCT TAGGGATAAAATAAGGATGAGT CTCCATTAACAGGCTTTCTACC AAGGAATTAGGCACAGGT TATGCAAATCAAACAGCCCAAGAG TACCATTTCATCCCTCTCCCACAC GATTAGGGCTACGGCAAACTCT ATCAACTGGCTTCAATCTACTTCT AAGAAGAGATTTTTGTTTG TTATTATAGGCCACCTGTATTGTAG GTTACGGACGAGAAGGCGGTTAT GGACGATCAGAAGCTAATACCGC CTCTTCCTGTGCTCTGGGTCAAT AATGTCGGCATCCTACTATTGTTTG CTGGAAGGTCAATTTCACTGATAGG TAACACTAACTTGAATTGGAGGTC TGATACCCACTCCTTACAAT ATCCTATCTCCCTCACAC AACCCTAAAACAAGCACTAAAAT TACCGCAAGGGAAAGATGAAAG CTGGAAGGTCAATTTCACTGATAGG
*Extra internal sequencing primer.
Among them, PCGs are 11,337 bp long, taking up 67.90% approximately. We used MEGA 6.06 to analyze the overall base composition of the heavy strand, it contains 31.0% A, 13.8% G, 27.3% C, 27.9% T. Regarding the start and stop codons of PCGs, ATG is the initiation codon for all PCGs except for ND2, ND3 and ND5 that have ATA. Similartly, TAA is the termination codon for
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/07/15 For personal use only.
2
G. Luo et al.
Mitochondrial DNA, Early Online: 1–2
Figure 1. Phylogenetic tree based on the mitochondrial genome of Dipus sagitta, Stylodipus telum and other 11 species. The Genbank accession number of 11 species are as follows: Rattus norvegicus (FJ919759), Rattus fuscipes (GU570664), Rattus lutreolus (GU570661), Nannospalax carmeli (JN571137), Nannospalax golani (JN571138), Spalax ehrenbergi (AJ416891), Acomys cahirinus (JN571140), Myodes glareolus (KM892840), Apodemus agrarius (JN629047), Mus spretus (KM978950), Jaculus jaculus (AJ416890). Among, A. agrarius and M. spretus are designated as outgroup. The numbers on the right of internode branches are Bayesian posterior probability and bootstrap percentages for MP and ML analysis.
most PCGs and incomplete termination codon T is for ND1, ND2, COXIII and ND4; ATP8 ends with TAG and Cytb with AGA. The heavy strand is conducted as template for all the PCGs, but ND6 is on the light strand. Trees constructed by the Bayesian statistics, MP and ML methods showed a similar topological structure with very high support values (Figure 1). Stylodipus telum and Jaculus jaculus were clustered in one branch. This conclusion was identical to the former conclusion made for morphological taxonomy, and it would be a significant molecular evidence for the classification of Dipodinae as well.
Acknowledgements We are grateful to LM Zhao and QS Zhao, of School of Life Sciences, Lanzhou University, for helping in the process of sampling.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. The work was supported by the National Natural Science Foundation of China (Nos. 30870294, 31372179).
References Avise JC, Ankney CD, Nelson WS. (1990). Mitochondrial gene trees and the evolutionary relationship of mallard and black ducks. Evolution 44: 1109–19. Boore JL. (1999). Animal mitochondrial genomes. Nucleic Acids Res 27: 1767–80. Clayton DA. (1992). Transcription and replication of animal mitochondrial DNAs. Int Rev Cytol 141:217–32. Feng X, Liu DF, Wang NX, Zhu CD, Jiang GF. (2010). The mitochondrial genome of the butterfly Papilio xuthus (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mol Biol Rep 37:3877–88. Liu G, Zhou LZ, Gu CM. (2012). Complete sequence and gene organization of the mitochondrial genome of scaly-sided merganser (Mergus squamatus) and phylogeny of some Anatidae species. Mol Biol Rep 39:2139–45. Luo Z, Chen W, Gao W. (2000). Fauna sinica. Beijing: Science Press. Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Ohna SH, Larget BL, et al. (2012). Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42. Swofford DL. (2002). PAUP*: Phylogenetic analysis using parsimony, Version 4.0 b10. Sunderland (MA): Sinauer Associates. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–9.
