http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.926513
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae) Chunlan Kang1 Hao Yue1, Mengyao Liu1, Ting Huang2, Yang Liu3, Xiuyue Zhang2, Bisong Yue2, Tao Zeng2, and Shaoying Liu3
Mitochondrial DNA Downloaded from informahealthcare.com by University of Maastricht on 07/03/14 For personal use only.
1
Key Laboratory of Bio-resources and Eco-environment (Ministry of Education), College of Life Sciences, Sichuan University, Chengdu, P.R. China, Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu, P.R. China, and 3 Sichuan Academy of Forestry, Chengdu, P.R. China 2
Abstract
Keywords
The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (40%) and A is the most numerous nucleotide followed by T4C4G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases ‘‘CAT’’ were inserted in cytb at the 30 end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.
Complete mitochondrial genome, cricetulus kamensis, gene arrangement
The Cricetulus kamensis belongs to the subfamily Cricetinae, which is endemic to China. The subfamily Cricetinae includes 7 genera and 18 species, but only three species have complete mitochondrial genome sequences. In this study, we sequenced the complete mitochondrial genome of C. kamensis (GenBank accession no. KJ680375). Total genomic DNA was extracted from tissue samples using standard phenol/chloroform methods (Sambrook & Russell, 2001). Thirteen primer sets (Table 1) were used to amplify overlapping segments of the complete mitochondrial genome. The amplification was carried out in 25 ml reaction volumes with 2.5 ml 10 EXTaq buffer (Mg2 + Free), 1.5–3 ml dNTP (2.5 mM each), 1.5 ml Mgcl2 (2.5 mM each), 1 ml of each primer (10 mM), 0.2 ml 10 EXTaq polymerase (5U/ml), and approximately 200 ng total genomic DNA as the template. PCR were an initial pre-denaturation for 5 min at 95 C, followed by 35 cycles of 45 s denaturations at 95 C, 50 s annealing at 50–60 C, 1–2 min extension at 72 C, and a final extension at 72 C for 10 min. The mtDNA of C. kamensis is a 16,270 bp circular molecule containing 13 protein-coding genes, 22 tRNA genes, 2 rRNA
Correspondence: Tao Zeng, Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu 610064, P.R. China. Tel: + 86 28 85412057. Fax: + 86 28 85414886. E-mail: [email protected] Shaoying Liu, Sichuan Academy of Forestry, Chengdu 610081, P.R. China. Tel: +8613808190594. E-mail: [email protected]
History Received 7 May 2014 Accepted 18 May 2014 Published online 25 June 2014
genes and a control region. Most genes are encoded on H-strand, except for ND6 and eight tRNA genes (tRNA-Gln, Ala, Asn, Cys, Tyr, Ser, Glu and Pro). The gene number and arrangement are analogous to other mammals’ mitochondrial genomes (Bibb et al., 1981; Gadaleta et al., 1989; Ursing & Arnason, 1998). MEGA5 (Tamura et al., 2011) was used to analyzing the overall base composition of the heavy strand: 33.2% A, 26.8% T, 12.7% G and 27.2% C. Obviously, the sequence is highly G-C poor (40%) and A is the most numerous nucleotide followed by T4C4G, which is similar to other mammalian mitochondrial genomes (Partridge et al., 2007). ATG is the common start codon for most proteincoding genes, while GTG is for ND1 gene and ATT for ND2, ND3 and ND5. Eight protein-coding genes share the typical termination codon TAA (COX1, COX2, ATP8, ATP6, ND3, ND4L, ND5 and ND6) and the incomplete stop codon T is for four other genes (ND1, ND2, COX3 and ND4). It is notable that there are three extra bases (CAT) were inserted into 30 end of gene cytb relative to that of Cricetulus griseus and no stop codon was found for cytb. Despite the phylogenetic positions of most species in Cricetinae were confirmed by mitochondrial cytb and 12s rRNA genes (Neumann et al., 2006), short sequence might mislead conclusion for resolution of evolutionary branches due to limited phylogenetic information provided (Cummings et al., 1995; Saitoh et al., 2000; Zardoya & Meyer, 1996). Offering more phylogenetic information, the complete mitogenome sequence contributes to achieving a relatively accurate result. Additionally, only a few complete mitochondrial genome sequences of Cricetinae are accessible. Therefore, in order to better understand the phylogenetic relationship within Cricetinae more complete mitochondrial genome sequences are required.
2
C. Kang et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Cricetulus kamensis.
Mitochondrial DNA Downloaded from informahealthcare.com by University of Maastricht on 07/03/14 For personal use only.
Primer name PL1-F PL1-R PL2-F PL2-R PL3-F PL3-R PL4-F PL4-R CK(ND2)-F CK(COX1)-R PL6-F PL6-R PL7-F PL7-R PL8-F PL8-R CK(ND4)-F CK(ND6)-R PL10-F PL10-R CK(12SrRNA)-F CK(12SrRNA)-R CK(16SrRNA)-F CK(ND1)-R CK(ND3)-F CK(tRNALeu)-R
Sequence (50 to 30 )
Source
TTCCCCTTAAATAAGACATCTCG CGCCAAGTCCTTTGAGTTTTA GGATTAGATACCCCACTATGCTT ATAGATAGAAACCGACCTGGA CCTCGATGTTGGATCAGG GTATGGGCCCGATAGCTT CGACCTAACAGAAGGAGAATC GAACATAGGTAAAATGGCTGAG ACACTAATAGCCATCACAGCCC ATCTGGGTAGTCGGAGTAACG CTGGCTTTGTCCACTGATTCC GATTACGGCTCCAGCTCATAG TATTCGCCTCTTTCATTACCC GCAGGTGTCATTTTTGGTAA GAACACAAAAAGGCTTAGAATGAACAG GGTTCCTAAGACCAACGGATTACTC TAACACTCCACATTACACCCCT TGGTAGTTTCTGGTTGGACAC TGCTACACCAACGCCTGAG AGTCACAGCATCCCGAAAA AGCCCAAGGAGACGGTATCA CTGGATTAGCAAGGGGTGGT AATGAACGGCTAAACGAGGG GAGATTGTTTGTGCGACTGC AACATAATCACAACTGCCCT CCTAAGACCAATGGATTACTAC
Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 In this study In this study Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 In this study In this study Hao et al., 2011 Hao et al., 2011 In this study In this study In this study In this study In this study In this study
Acknowledgements The authors would like to thank Dan Zhu for her assistance in this study.
Declaration of interest This research was funded by National Science and Technology Support Project of China, 2012BAC01B06. This study had no conflicts of interest. The authors alone are responsible for the content and writing of the article.
References Bibb MJ, Van Etten RA, Wright CT, Walberg MW, Clayton DA. (1981). Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167–80. Cummings MP, Otto SP, Wakeley J. (1995). Sampling properties of DNA sequence data in phylogenetic analysis. Mol Biol Evol 12:814–22. Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisa E, Saccone C. (1989). The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: Cryptic signals revealed by comparative analysis between vertebrates. J Mol Evol 28:497–516. Hao HB, Liu SY, Zhang XY, Chen WC, Song ZB, Peng HY, Liu Y, et al. (2011). Complete mitochondrial genome of a new vole Proedromys liangshanensis (Rodentia: Cricetidae) and phylogenetic analysis with
related species: Are there implications for the validity of the genus Proedromys? Mitochondrial DNA 22:28–34. Neumann K, Michaux J, Lebedev V, Yigit N, Colak E, Ivanova N, Poltoraus A, et al. (2006). Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene. Mol Biol Evol 39:135–48. Partridge MA, Davidson MM, Hei TK. (2007). The complete nucleotide sequence of Chinese hamster (Cricetulus griseus) mitochondrial DNA* Full Length Research Article. Mitochondrial DNA 18:341–6. Saitoh K, Hayashizaki K, Yokoyama Y, Asahida T, Toyohara H, Yamashita Y. (2000). Complete nucleotide sequence of Japanese flounder (Paralichthys olivaceus) mitochondrial genome: Structural properties relationships. J Hered 91:271–8. Sambrook J, Russell DW. (2001). Molecular cloning: A laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–9. Ursing BM, Arnason U. (1998). The complete mitochondrial DNA sequence of the pig (Sus scrofa). J Mol Evol 47:302–6. Zardoya R, Meyer A. (1996). Phylogenetic performance of mitochondrial protein-coding genes in resolving relationships among vertebrates. Mol Biol Evol 13:933–42.
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae) Chunlan Kang1 Hao Yue1, Mengyao Liu1, Ting Huang2, Yang Liu3, Xiuyue Zhang2, Bisong Yue2, Tao Zeng2, and Shaoying Liu3
Mitochondrial DNA Downloaded from informahealthcare.com by University of Maastricht on 07/03/14 For personal use only.
1
Key Laboratory of Bio-resources and Eco-environment (Ministry of Education), College of Life Sciences, Sichuan University, Chengdu, P.R. China, Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu, P.R. China, and 3 Sichuan Academy of Forestry, Chengdu, P.R. China 2
Abstract
Keywords
The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (40%) and A is the most numerous nucleotide followed by T4C4G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases ‘‘CAT’’ were inserted in cytb at the 30 end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.
Complete mitochondrial genome, cricetulus kamensis, gene arrangement
The Cricetulus kamensis belongs to the subfamily Cricetinae, which is endemic to China. The subfamily Cricetinae includes 7 genera and 18 species, but only three species have complete mitochondrial genome sequences. In this study, we sequenced the complete mitochondrial genome of C. kamensis (GenBank accession no. KJ680375). Total genomic DNA was extracted from tissue samples using standard phenol/chloroform methods (Sambrook & Russell, 2001). Thirteen primer sets (Table 1) were used to amplify overlapping segments of the complete mitochondrial genome. The amplification was carried out in 25 ml reaction volumes with 2.5 ml 10 EXTaq buffer (Mg2 + Free), 1.5–3 ml dNTP (2.5 mM each), 1.5 ml Mgcl2 (2.5 mM each), 1 ml of each primer (10 mM), 0.2 ml 10 EXTaq polymerase (5U/ml), and approximately 200 ng total genomic DNA as the template. PCR were an initial pre-denaturation for 5 min at 95 C, followed by 35 cycles of 45 s denaturations at 95 C, 50 s annealing at 50–60 C, 1–2 min extension at 72 C, and a final extension at 72 C for 10 min. The mtDNA of C. kamensis is a 16,270 bp circular molecule containing 13 protein-coding genes, 22 tRNA genes, 2 rRNA
Correspondence: Tao Zeng, Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu 610064, P.R. China. Tel: + 86 28 85412057. Fax: + 86 28 85414886. E-mail: [email protected] Shaoying Liu, Sichuan Academy of Forestry, Chengdu 610081, P.R. China. Tel: +8613808190594. E-mail: [email protected]
History Received 7 May 2014 Accepted 18 May 2014 Published online 25 June 2014
genes and a control region. Most genes are encoded on H-strand, except for ND6 and eight tRNA genes (tRNA-Gln, Ala, Asn, Cys, Tyr, Ser, Glu and Pro). The gene number and arrangement are analogous to other mammals’ mitochondrial genomes (Bibb et al., 1981; Gadaleta et al., 1989; Ursing & Arnason, 1998). MEGA5 (Tamura et al., 2011) was used to analyzing the overall base composition of the heavy strand: 33.2% A, 26.8% T, 12.7% G and 27.2% C. Obviously, the sequence is highly G-C poor (40%) and A is the most numerous nucleotide followed by T4C4G, which is similar to other mammalian mitochondrial genomes (Partridge et al., 2007). ATG is the common start codon for most proteincoding genes, while GTG is for ND1 gene and ATT for ND2, ND3 and ND5. Eight protein-coding genes share the typical termination codon TAA (COX1, COX2, ATP8, ATP6, ND3, ND4L, ND5 and ND6) and the incomplete stop codon T is for four other genes (ND1, ND2, COX3 and ND4). It is notable that there are three extra bases (CAT) were inserted into 30 end of gene cytb relative to that of Cricetulus griseus and no stop codon was found for cytb. Despite the phylogenetic positions of most species in Cricetinae were confirmed by mitochondrial cytb and 12s rRNA genes (Neumann et al., 2006), short sequence might mislead conclusion for resolution of evolutionary branches due to limited phylogenetic information provided (Cummings et al., 1995; Saitoh et al., 2000; Zardoya & Meyer, 1996). Offering more phylogenetic information, the complete mitogenome sequence contributes to achieving a relatively accurate result. Additionally, only a few complete mitochondrial genome sequences of Cricetinae are accessible. Therefore, in order to better understand the phylogenetic relationship within Cricetinae more complete mitochondrial genome sequences are required.
2
C. Kang et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Cricetulus kamensis.
Mitochondrial DNA Downloaded from informahealthcare.com by University of Maastricht on 07/03/14 For personal use only.
Primer name PL1-F PL1-R PL2-F PL2-R PL3-F PL3-R PL4-F PL4-R CK(ND2)-F CK(COX1)-R PL6-F PL6-R PL7-F PL7-R PL8-F PL8-R CK(ND4)-F CK(ND6)-R PL10-F PL10-R CK(12SrRNA)-F CK(12SrRNA)-R CK(16SrRNA)-F CK(ND1)-R CK(ND3)-F CK(tRNALeu)-R
Sequence (50 to 30 )
Source
TTCCCCTTAAATAAGACATCTCG CGCCAAGTCCTTTGAGTTTTA GGATTAGATACCCCACTATGCTT ATAGATAGAAACCGACCTGGA CCTCGATGTTGGATCAGG GTATGGGCCCGATAGCTT CGACCTAACAGAAGGAGAATC GAACATAGGTAAAATGGCTGAG ACACTAATAGCCATCACAGCCC ATCTGGGTAGTCGGAGTAACG CTGGCTTTGTCCACTGATTCC GATTACGGCTCCAGCTCATAG TATTCGCCTCTTTCATTACCC GCAGGTGTCATTTTTGGTAA GAACACAAAAAGGCTTAGAATGAACAG GGTTCCTAAGACCAACGGATTACTC TAACACTCCACATTACACCCCT TGGTAGTTTCTGGTTGGACAC TGCTACACCAACGCCTGAG AGTCACAGCATCCCGAAAA AGCCCAAGGAGACGGTATCA CTGGATTAGCAAGGGGTGGT AATGAACGGCTAAACGAGGG GAGATTGTTTGTGCGACTGC AACATAATCACAACTGCCCT CCTAAGACCAATGGATTACTAC
Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 In this study In this study Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 Hao et al., 2011 In this study In this study Hao et al., 2011 Hao et al., 2011 In this study In this study In this study In this study In this study In this study
Acknowledgements The authors would like to thank Dan Zhu for her assistance in this study.
Declaration of interest This research was funded by National Science and Technology Support Project of China, 2012BAC01B06. This study had no conflicts of interest. The authors alone are responsible for the content and writing of the article.
References Bibb MJ, Van Etten RA, Wright CT, Walberg MW, Clayton DA. (1981). Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167–80. Cummings MP, Otto SP, Wakeley J. (1995). Sampling properties of DNA sequence data in phylogenetic analysis. Mol Biol Evol 12:814–22. Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisa E, Saccone C. (1989). The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: Cryptic signals revealed by comparative analysis between vertebrates. J Mol Evol 28:497–516. Hao HB, Liu SY, Zhang XY, Chen WC, Song ZB, Peng HY, Liu Y, et al. (2011). Complete mitochondrial genome of a new vole Proedromys liangshanensis (Rodentia: Cricetidae) and phylogenetic analysis with
related species: Are there implications for the validity of the genus Proedromys? Mitochondrial DNA 22:28–34. Neumann K, Michaux J, Lebedev V, Yigit N, Colak E, Ivanova N, Poltoraus A, et al. (2006). Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene. Mol Biol Evol 39:135–48. Partridge MA, Davidson MM, Hei TK. (2007). The complete nucleotide sequence of Chinese hamster (Cricetulus griseus) mitochondrial DNA* Full Length Research Article. Mitochondrial DNA 18:341–6. Saitoh K, Hayashizaki K, Yokoyama Y, Asahida T, Toyohara H, Yamashita Y. (2000). Complete nucleotide sequence of Japanese flounder (Paralichthys olivaceus) mitochondrial genome: Structural properties relationships. J Hered 91:271–8. Sambrook J, Russell DW. (2001). Molecular cloning: A laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–9. Ursing BM, Arnason U. (1998). The complete mitochondrial DNA sequence of the pig (Sus scrofa). J Mol Evol 47:302–6. Zardoya R, Meyer A. (1996). Phylogenetic performance of mitochondrial protein-coding genes in resolving relationships among vertebrates. Mol Biol Evol 13:933–42.
