Proc. Natl. Acad. Sci. USA Vol. 88, pp. 7464-7468, September 1991
Biochemistry
The carbohydrate domain of calicheamicin 71 determines its sequence specificity for DNA cleavage JACQUELINE DRAK, NOBUHARU IWASAWA, SAMUEL DANISHEFSKY, AND DONALD M. CROTHERS Department of Chemistry, Yale University, New Haven, CT 06511
Contributed by Samuel Danishefsky, February 22, 1991
ABSTRACT We have investigated the DNA cleaving properties of calicheamicinone, the synthetic core aglycone of calicheamicin y', a natural product with extremely potent antitumor activity. Our experiments have shown that the synthetic analog binds and cleaves DNA, albeit without any sequence selectivity and with less efficiency than the natural compound. We propose that a key element in the sequence recognition process is the thiobenzoate ring present in the natural compound. We have demonstrated by one-dimensional NMR that there is direct hydrogen abstraction from DNA by calicheamicinone, with enhanced binding affinity contributed by the carbohydrate domain. The reduced efficiency of hydrogen abstraction from DNA by bound calicheamicinone, compared with the natural compound, implicates the carbohydrate moiety in positioning the drug for hydrogen abstraction.
Bergman reaction (7). The resulting biradical species is responsible for the DNA cleavage properties of the drug (Fig. 1). The sites of hydrogen abstraction from the DNA have been investigated: it is agreed that the 5'-hydrogen atom from the 5'-cytidine is transferred to the diradical, but there is some controversy as to whether it is the 4'-hydrogen or the 1'-hydrogen that is abstracted from the corresponding residue on the complementary strand (5, 8). Evidence of the role played by the carbohydrate residues attached to the diyneene cleaving functionality comes from comparison of the structure and cleaving properties of calicheamicin 71 and esperamicin Al (9). Even though the aglycone portions of both compounds are identical and they also share some of the hexose units in their carbohydrate domains, esperamicin Al is far less sequence specific than calicheamicin yi. The question remains, then, as to which molecular features are recognized and how this is done. To gain some insight into this problem we have investigated the role of the carbohydrate moiety on the sequence selectivity and the ability of calicheamicin yA to induce double-stranded cuts. Our logic relies on a comparison with the corresponding aglycone, the synthetic analog calicheamicinone (10). We have shown that the sugars are responsible for the sequence selectivity of the natural compound and that the carbohydrate moiety increases the apparent binding affinity with respect to the core aglycone by -3 orders of magnitude. Together with previous studies in which some of the sugars were removed from either calicheamicin yI or esperamicin Al (6, 9), our experiments suggest that the thiobenzoate moiety plays a key role in the recognition event.
One of the mechanisms whereby drug molecules can interact noncovalently with DNA is groove binding. Furthermore, most groove binders that interact with canonical B-DNA appear to be minor groove specific, probably because of overall complementarity between the width and curvature of the groove and the drug's surface (1). The majority of these minor-groove binders exhibit some kind of sequence selectivity, usually toward sequences that contain only ANT base pairs (2), although the hydrogen bonding potential of the DNA minor groove presents only a limited recognition capacity for the two base pairs in their two possible orientations (3). Comparative structural studies of two related minor-groove binding drugs, netropin and Hoechst 33258 (2), showed that the latter includes a G-C pair in the preferred interaction site, probably because of the requirement for a wider minor groove to accommodate the terminal piperazine ring in the drug. In addition to minor-groove conformation as reflected in its width, conformationalflexibility may affect recognition. For example, structural studies of the chromomycin-DNA complex (4) have shown that this drug, which favors G-C pairs in its binding site, induces a conformational change that makes the minor groove wider and shallower to accommodate the drug. The most recent example of a minor-groove binder with very high sequence selectivity for regions including G&C base pairs is calicheamicin 71 (Fig. 1), an extremely potent antitumor agent of the diyne-ene family (ref. 5 and references therein). It has been shown to interact with double-stranded DNA in the minor groove and to produce highly sequencespecific double-stranded cuts (5, 6), primarily at homopyrimidine-homopurine sites such as 5'-TCCT/AGGA and 5'TCTC/GAGA. Cleavage takes place at the 5'C and three nucleotides toward the 3' side of its complementary G residue. It has been proposed (5) that bioreductive activation of the trisulfide leads to formation of a thiolate species, which after a Michael addition to the adjacent trigonal carbon results in aromatization of the diyne-ene moiety by way of a
MATERIALS AND METHODS Comparison of the Overall DNA Damage Produced bjv the Natural Product and Calicheamicinone. Calicheamicin Yi was kindly provided by G. Ellestad (American Cyanamid); calicheamicinone was synthesized as described (10). To assay for DNA cleavage we preincubated 0.5 ,ug (2 .ul) of supercoiled DNA [+X174 replicative form I (RF I), purchased from New England Biolabs] for 5-10 min at room temperature with 10 A.l of 50 mM Tris HCl (pH 8) and 1.5 p.l of different concentrations of either compound. We then added 1.5 p.l of 20 mM dithiothreitol (DTT) and the reaction was allowed to proceed for different lengths of time at 370C. A 3-,4l sample was removed from each reaction mixture, to which we added 3 tul of 80%o glycerol and 1.5 p.1 of loading dye solution (0.02% in bromophenol blue, 0.02% in xylene cyanol, 40%o in sucrose). DNA was resolved on a 1% agarose gel in 1 x TAE buffer (40 mM Tris acetate/2 mM EDTA) run at 6-8 V/cm. The gel was stained in a 1.3 pug/pul ethidium bromide solution and photo-
graphed. Determination of the Extent of Single-Stranded and DoubleStranded DNA Cleavage. For the cleavage experiments to be quantitated, the gels were photographed using Polaroid 665 film and the corresponding negatives were scanned using a
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Abbreviations: DTT, dithiothreitol; RF, replicative form. 7464
Biochemistry: Drak et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
OH
H
OMe
NMt
eOMe
0
for Calicheamicin R FIG. 1. biradical
=
y1l H&DMeH
H for Calicheamicinone
Structures of calicheamicin yv, for DNA cleavage.
calicheamicinone, and the
responsible
model 1650 scanning densitometer (Hoefer). We showed by densitometry that there was a linear variation of signal with DNA concentration over the DNA range studied. In addition, since supercoiled DNA is restricted with respect to its ability to bind ethidium bromide, it was necessary to apply a correction factor to the form I signal, following the method by Lloyd et al. (11). Preparation of the DNA Constructs Used for the Sequence Selectivity Assays. Both strands of a 53-base-pair (bp) oligonucleotide containing three cleavage sites for the natural product (5) were made on a DNA synthesizer (Applied Biosystems) and purified on 15% polyacrylamide (acrylamide:bisacrylamide, 19:1)/50%o urea gels (oligonucleotide A, Fig. 2). Ten micrograms of each purified strand was annealed in 50 mM Tris-HC (pH 8.0) by heating to 90'C and slowly cooling to room temperature. The 3' end of the top strand of the duplex was labeled by incubating half of the annealing reaction mixture (20 ,l) with [a-32P]dGTP (3 ,uCi/ pl; 1 Ci = 37 GBq) in 45 mM Tris-HCI, pH 7.5/25 mM NaCl/5 mM MgCI2/Klenow fragment (0.5 unit/pl) for 10 min at room temperature. [a-32P]dGTP was substituted by [a-32P]dATP to label the 3' end of the bottom strand. The labeled fragments were purified on an 8% polyacrylamide gel in 1 x TBE (89 mM Tris HCI, pH 8.0/2 mM EDTA). Bands were visualized by autoradiography, cut from the gel, and soaked at 37°C in a solution containing 50 mM NaCI, 2 mM Tris HCI, and 0.2 mM EDTA. Samples were concentrated to one-fifth of their original volume, ethanol precipitated, and resuspended in 10 mM Tris HCl, pH 8.0/1 mM EDTA. Gel Electrophoresis. Reaction mixtures with either compound were loaded on 12% polyacrylamide (acrylamide:bisacrylamide 19:1)/50% urea gels after adding an equal volume of 80% formamide dye and heating the samples to 95°C for 3 min. Gels were fixed (in 20% methanol and 10% glacial acetic acid), dried, and autoradiographed. Influence of the Carbohydrate Tail on the Binding Affinity of Calicheamicin yv. We synthesized both strands of two A
5'TTTAACCGATCAGAATTCCGGTGCATGCTCCTAAGTGTACGCCTAAGCTTCTT B 5 'GGGTCCTAAATT
C 5 'GGGTACTAAATT
FIG. 2. Sequences of the oligonucleotides (top strand only) used in the sequence specificity (A) and binding affinity studies (B and C). The sequences in bold letters correspond to the binding sites previ-
ously identified for calicheamicin yv.
7465
oligonucleotides, one of them containing a TCCT cleavage site for the natural product (5, 6), whereas in the other one we modified that sequence to TACT, the assumption being that the latter would not be a cleavage site for calicheamicin yi and could be used as a control in our experiments (oligonucleotides B and C, Fig. 2). Ten micrograms of each purified strand was labeled at the 5' end with [y-32P]ATP (5 gOCi/1.d) in 70 mM Tris-HCI, pH 7.6/5 mM DTT/10 mM MgCI2/T4 polynucleotide kinase (1 unit/izl) at 370C for 30 min. The labeled strands were separated from the unincorporated label on a 20% polyacrylamide/50% urea gel. The bands were visualized and the DNA was extracted and purified as was done for the 53-mer. Each labeled strand was annealed to its complementary unlabeled strand by heating to 80'C and slowly cooling to 10'C. We verified that all of the labeled DNA was in duplex form by running the annealed samples and the labeled single strands on a 20% native polyacrylamide gel at 10'C: the mobilities of single strands are distinctly different from the mobilities of the corresponding annealed duplex. The DNA samples were incubated with either calicheamicin y1 or calicheamicinone for 2 hr at 4TC; care was taken to ensure that the drug was always present in excess with respect to the DNA concentration. The reaction mixtures were then lyophilized to dryness, resuspended in 4 td of 80% formamide dye, and loaded on 20%o polyacrylamide (acrylamide:bisacrylamide, 19:1)/50% urea gels that were run until the bromophenol blue had moved 20 cm. The intensities of all bands of interest were measured using a Betascope blot analyzer (Betagen, Waltham, MA). The intensity of the band resulting from DNA cleavage at a specific site (for example TCCT) divided by the intensity of the uncut starting material was plotted against drug concentration: this allowed determination of the drug's concentration at half saturation, a value that provides a crude estimate of the drug's apparent binding affinity for a given binding site. Direct Hydrogen Atom Transfer Between DNA and Calicheamicinone. It had been previously shown that calicheamicin y1 abstracts nonexchangeable hydrogens from the DNA to initiate strand scission. Zein and coworkers (12) demonstrated that in the presence of DNA, deuterated buffer, and deuterated methylthioglycolate, the 1H NMR spectrum of the inactivated calicheamicin species indicated no deuterium incorporation at C1 or C4, whereas when the experiment was repeated in the absence of DNA, these positions were >98% deuterated. The presence of deuterium at the positions where the biradical forms could be easily verified by the absence of the corresponding 1H NMR signal. Furthermore, the 2H-1H coupling is so weak that there is usually no splitting of the proton's signal. When the C1 and C4 positions were fully deuterated, the aromatic portion of the 1H NMR spectrum showed the two doublets corresponding to the hydrogens present at C2 and C3, whereas when the C1 and C4 positions were fully hydrogenated, the spectrum showed two doublets and two triplets, corresponding to the hydrogens present at C1-C4 and C2-C3, respectively. We took a similar approach to test if calicheamicinone was capable of direct hydrogen abstraction from DNA. Highly polymerized calf thymus DNA (Sigma) was phenol and chloroform extracted and then sonicated to give fragments ranging in size from -100 to 400 bp. It was then ethanol precipitated from a solution 150 mM in NaCl. After spinning for 15 min and washing the pellet twice with 70o ethanol, the DNA was repeatedly lyophilized and resuspended in 2H20. The DNA concentration was determined spectrophotometrically at 260 nm. The dried sample was finally redissolved in the deuterated reaction buffer (27 mM Tris.2HCl, p2H 8.0/39 mM sodium phosphate, p2H 7.6/11o C22H502H, 2H20). Calicheamicinone (2 mM) was incubated in the deuterated buffer in the presence or absence of DNA (%42 mM in bp).
7466
Proc. Natl. Acad. Sci. USA 88 (1991)
Biochemistry: Drak et al.
1
The aromatization reaction was started by addition of deuterated DTT (final concentration, 2 mM). After 15 min at 37TC the sample was extracted three times with ethyl acetate, and the combined extracts were dried over MgSO4 and purified by silica-gel column chromatography (ethyl acetate:methanol, 97:3). The extent of hydrogen incorporation was measured by integration of the characteristic signals of the four aromatic protons.
1 2 3 4 5 6 7 8
II
_
III_ FIG. 3. Agarose gel showing the extent of DNA cleavage produced by calicheamicin vy and calicheamicinone. Forms I, II, and III refer to supercoiled, nicked, and linear DNA, respectively. Lane 1, untreated DNA; lanes 2-5, reactions in 1.5 1&M, 73 nM, 7.3 nM, and 0.73 nM calicheamicin vy; lanes 6-8, reactions in 0.65 mM, 0.13 mM, and 13 1LM calicheamicinone.
7 X (
;
II III I
RESULTS AND DISCUSSION Extent of DNA Cleavage Induced by Calicheamicinone. In the presence of DTT calicheamicinone induced DNA cleavage at concentrations as low as 13 ,M (Fig. 3). There was no detectable DNA damage in the absence of a reducing agent, but it was possible to substitute DTT by other reducing thiols such as glutathione, methylthioglycolate, or 2-mercaptoethanol; the extent of cleavage varied somewhat with the nature of the reducing agent. We have shown for comparison the result of the analogous reaction where we used the natural compound: in the latter case there is extensive DNA damage even at concentrations as low as 0.7 nM, and at 1.5 AM the extent of cleavage is such that all of the supercoiled DNA has been converted to very short oligonucleotides (there is a smear ahead of the bromophenol blue marker). The DNA cleaving potential of calicheamicinone (at 10 AM concentration) can be assessed against values taken from the literature for other cleaving agents. MPE-Fe(II) [methidiumpropylEDTA-iron(II)] at 1 AM concentration in the absence of DTT produces comparable DNA damage (13); a conjugated cyclodecaenediyne synthesized by Nicolaou and coworkers (14) causes comparable DNA damage at 100 ,M concentration and much longer reaction times. Quantitation of Double-Stranded and Single-Stranded Breaks. We monitored the kinetics of DNA cleavage in a series of experiments in which calicheamicinone was incubated with supercoiled plasmid and DTT. Typical results are illustrated in Fig. 4. The fast kinetics during the first 5 min of the reaction might possibly indicate that supercoiled DNA is a better substrate for calicheamicinone binding than nicked DNA. More likely, it could reflect conversion of the drug to a less active form, whose action accounts for the slower terminal kinetics (15). Similar results were obtained at lower drug concentrations: rapid initial kinetics and a rather low percentage of linear molecules, even when all of the DNA was cut at the end of the experiment. We assumed a Poisson distribution for the formation of single-stranded breaks and double-stranded breaks so that we could calculate the average number of single and doublestranded cuts per DNA molecule (16). We also estimated the fraction of linear molecules that would have been obtained by accumulation of single-stranded breaks using the FreifelderTrumbo equation (17). The data from the first 5 min of the reaction can be fitted to a linear equation, with a ratio of
A A1
'.
A
100 S~o - - r
80 z 0
//
F: 60
/
U.: 40 U)
2o1 20
1
Xi
k~~~A
0
2
4
6
8
10 12
14 16
TIME (minutes)
B FIG. 4. (A) Agarose gel illustrating the kinetics of DNA cleavage by calicheamicinone. Reaction conditions were the same as for the experiment in Fig. 3 except that the concentration of calicheamicinone was 0.84 mM. Lane 1, untreated DNA; lanes 2-9, extent of the reaction at time = 1, 3, 5, 7, 10, 15, 20, and 25 min. (B) Densitometry of a negative of the gel shown on A allowed quantitation of the percentage offorms I (e), 11 (o), and III (A) present at each time point.
double-stranded cuts to single-stranded cuts per DNA molecule of 1:30. This is to be compared, for example, with a ratio of 1:9 for bleomycin (16) and 1:6-1:41 for neocarzinostatin (18), depending on the experimental conditions. Our data suggest that at least at the beginning of the reaction there are true double-stranded cutting events, albeit not very many. For comparison, we have examined the kinetics of cleavage by the natural compound (at a 1.5 nM concentration). We observed the same rapid kinetics at the beginning of the reaction as we did for calicheamicinone, but we obtained very high ratios of double-stranded cuts to single-stranded cuts, -1:2, indicating that the presence of the sugar moiety has increased the potential of the core aglycone as a doublestranded cleaving agent by several orders of magnitude. Sequence Selectivity Requires the Sugar Moiety. We have investigated the sequence selectivity of calicheamicinone by analyzing the cleavage products obtained after incubation with an oligonucleotide containing three cleavage sites for the natural product (5), arranged so that the pyrimidine-rich strand of each site is on the same strand of the molecule. To clearly demonstrate the effect of the carbohydrate moiety we have repeated the experiment using calicheamicin yA instead of the core aglycone (Fig. 5). The synthetic analog does not have any sequence selectivity, as demonstrated by the rather uniform cleavage ladder, whereas three main bands could be easily identified when the natural compound was used. The conclusion was the same from an experiment in which the duplexed oligonucleotide was labeled at the 3' end of the complementary strand (data not shown). It is of interest to analyze in more detail the results obtained with the natural product. The cleavage positions observed on both strands for the central 5'-TCCT site were precisely as expected (5). This was not the case for the 5'-TCCG and 5'-GCCT sites, though. Our results are consistent with the presence of another cleavage site adjacent to the 5'-TCCG site (possibly the 5'-TCTG sequence present in the bottom strand) and with calicheamicin yi cleaving at the homopyrimidine-homopurine region located to the right of the 5'-
Biochemistry: Drak et al. 1 2
-
Biochemistry
The carbohydrate domain of calicheamicin 71 determines its sequence specificity for DNA cleavage JACQUELINE DRAK, NOBUHARU IWASAWA, SAMUEL DANISHEFSKY, AND DONALD M. CROTHERS Department of Chemistry, Yale University, New Haven, CT 06511
Contributed by Samuel Danishefsky, February 22, 1991
ABSTRACT We have investigated the DNA cleaving properties of calicheamicinone, the synthetic core aglycone of calicheamicin y', a natural product with extremely potent antitumor activity. Our experiments have shown that the synthetic analog binds and cleaves DNA, albeit without any sequence selectivity and with less efficiency than the natural compound. We propose that a key element in the sequence recognition process is the thiobenzoate ring present in the natural compound. We have demonstrated by one-dimensional NMR that there is direct hydrogen abstraction from DNA by calicheamicinone, with enhanced binding affinity contributed by the carbohydrate domain. The reduced efficiency of hydrogen abstraction from DNA by bound calicheamicinone, compared with the natural compound, implicates the carbohydrate moiety in positioning the drug for hydrogen abstraction.
Bergman reaction (7). The resulting biradical species is responsible for the DNA cleavage properties of the drug (Fig. 1). The sites of hydrogen abstraction from the DNA have been investigated: it is agreed that the 5'-hydrogen atom from the 5'-cytidine is transferred to the diradical, but there is some controversy as to whether it is the 4'-hydrogen or the 1'-hydrogen that is abstracted from the corresponding residue on the complementary strand (5, 8). Evidence of the role played by the carbohydrate residues attached to the diyneene cleaving functionality comes from comparison of the structure and cleaving properties of calicheamicin 71 and esperamicin Al (9). Even though the aglycone portions of both compounds are identical and they also share some of the hexose units in their carbohydrate domains, esperamicin Al is far less sequence specific than calicheamicin yi. The question remains, then, as to which molecular features are recognized and how this is done. To gain some insight into this problem we have investigated the role of the carbohydrate moiety on the sequence selectivity and the ability of calicheamicin yA to induce double-stranded cuts. Our logic relies on a comparison with the corresponding aglycone, the synthetic analog calicheamicinone (10). We have shown that the sugars are responsible for the sequence selectivity of the natural compound and that the carbohydrate moiety increases the apparent binding affinity with respect to the core aglycone by -3 orders of magnitude. Together with previous studies in which some of the sugars were removed from either calicheamicin yI or esperamicin Al (6, 9), our experiments suggest that the thiobenzoate moiety plays a key role in the recognition event.
One of the mechanisms whereby drug molecules can interact noncovalently with DNA is groove binding. Furthermore, most groove binders that interact with canonical B-DNA appear to be minor groove specific, probably because of overall complementarity between the width and curvature of the groove and the drug's surface (1). The majority of these minor-groove binders exhibit some kind of sequence selectivity, usually toward sequences that contain only ANT base pairs (2), although the hydrogen bonding potential of the DNA minor groove presents only a limited recognition capacity for the two base pairs in their two possible orientations (3). Comparative structural studies of two related minor-groove binding drugs, netropin and Hoechst 33258 (2), showed that the latter includes a G-C pair in the preferred interaction site, probably because of the requirement for a wider minor groove to accommodate the terminal piperazine ring in the drug. In addition to minor-groove conformation as reflected in its width, conformationalflexibility may affect recognition. For example, structural studies of the chromomycin-DNA complex (4) have shown that this drug, which favors G-C pairs in its binding site, induces a conformational change that makes the minor groove wider and shallower to accommodate the drug. The most recent example of a minor-groove binder with very high sequence selectivity for regions including G&C base pairs is calicheamicin 71 (Fig. 1), an extremely potent antitumor agent of the diyne-ene family (ref. 5 and references therein). It has been shown to interact with double-stranded DNA in the minor groove and to produce highly sequencespecific double-stranded cuts (5, 6), primarily at homopyrimidine-homopurine sites such as 5'-TCCT/AGGA and 5'TCTC/GAGA. Cleavage takes place at the 5'C and three nucleotides toward the 3' side of its complementary G residue. It has been proposed (5) that bioreductive activation of the trisulfide leads to formation of a thiolate species, which after a Michael addition to the adjacent trigonal carbon results in aromatization of the diyne-ene moiety by way of a
MATERIALS AND METHODS Comparison of the Overall DNA Damage Produced bjv the Natural Product and Calicheamicinone. Calicheamicin Yi was kindly provided by G. Ellestad (American Cyanamid); calicheamicinone was synthesized as described (10). To assay for DNA cleavage we preincubated 0.5 ,ug (2 .ul) of supercoiled DNA [+X174 replicative form I (RF I), purchased from New England Biolabs] for 5-10 min at room temperature with 10 A.l of 50 mM Tris HCl (pH 8) and 1.5 p.l of different concentrations of either compound. We then added 1.5 p.l of 20 mM dithiothreitol (DTT) and the reaction was allowed to proceed for different lengths of time at 370C. A 3-,4l sample was removed from each reaction mixture, to which we added 3 tul of 80%o glycerol and 1.5 p.1 of loading dye solution (0.02% in bromophenol blue, 0.02% in xylene cyanol, 40%o in sucrose). DNA was resolved on a 1% agarose gel in 1 x TAE buffer (40 mM Tris acetate/2 mM EDTA) run at 6-8 V/cm. The gel was stained in a 1.3 pug/pul ethidium bromide solution and photo-
graphed. Determination of the Extent of Single-Stranded and DoubleStranded DNA Cleavage. For the cleavage experiments to be quantitated, the gels were photographed using Polaroid 665 film and the corresponding negatives were scanned using a
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Abbreviations: DTT, dithiothreitol; RF, replicative form. 7464
Biochemistry: Drak et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
OH
H
OMe
NMt
eOMe
0
for Calicheamicin R FIG. 1. biradical
=
y1l H&DMeH
H for Calicheamicinone
Structures of calicheamicin yv, for DNA cleavage.
calicheamicinone, and the
responsible
model 1650 scanning densitometer (Hoefer). We showed by densitometry that there was a linear variation of signal with DNA concentration over the DNA range studied. In addition, since supercoiled DNA is restricted with respect to its ability to bind ethidium bromide, it was necessary to apply a correction factor to the form I signal, following the method by Lloyd et al. (11). Preparation of the DNA Constructs Used for the Sequence Selectivity Assays. Both strands of a 53-base-pair (bp) oligonucleotide containing three cleavage sites for the natural product (5) were made on a DNA synthesizer (Applied Biosystems) and purified on 15% polyacrylamide (acrylamide:bisacrylamide, 19:1)/50%o urea gels (oligonucleotide A, Fig. 2). Ten micrograms of each purified strand was annealed in 50 mM Tris-HC (pH 8.0) by heating to 90'C and slowly cooling to room temperature. The 3' end of the top strand of the duplex was labeled by incubating half of the annealing reaction mixture (20 ,l) with [a-32P]dGTP (3 ,uCi/ pl; 1 Ci = 37 GBq) in 45 mM Tris-HCI, pH 7.5/25 mM NaCl/5 mM MgCI2/Klenow fragment (0.5 unit/pl) for 10 min at room temperature. [a-32P]dGTP was substituted by [a-32P]dATP to label the 3' end of the bottom strand. The labeled fragments were purified on an 8% polyacrylamide gel in 1 x TBE (89 mM Tris HCI, pH 8.0/2 mM EDTA). Bands were visualized by autoradiography, cut from the gel, and soaked at 37°C in a solution containing 50 mM NaCI, 2 mM Tris HCI, and 0.2 mM EDTA. Samples were concentrated to one-fifth of their original volume, ethanol precipitated, and resuspended in 10 mM Tris HCl, pH 8.0/1 mM EDTA. Gel Electrophoresis. Reaction mixtures with either compound were loaded on 12% polyacrylamide (acrylamide:bisacrylamide 19:1)/50% urea gels after adding an equal volume of 80% formamide dye and heating the samples to 95°C for 3 min. Gels were fixed (in 20% methanol and 10% glacial acetic acid), dried, and autoradiographed. Influence of the Carbohydrate Tail on the Binding Affinity of Calicheamicin yv. We synthesized both strands of two A
5'TTTAACCGATCAGAATTCCGGTGCATGCTCCTAAGTGTACGCCTAAGCTTCTT B 5 'GGGTCCTAAATT
C 5 'GGGTACTAAATT
FIG. 2. Sequences of the oligonucleotides (top strand only) used in the sequence specificity (A) and binding affinity studies (B and C). The sequences in bold letters correspond to the binding sites previ-
ously identified for calicheamicin yv.
7465
oligonucleotides, one of them containing a TCCT cleavage site for the natural product (5, 6), whereas in the other one we modified that sequence to TACT, the assumption being that the latter would not be a cleavage site for calicheamicin yi and could be used as a control in our experiments (oligonucleotides B and C, Fig. 2). Ten micrograms of each purified strand was labeled at the 5' end with [y-32P]ATP (5 gOCi/1.d) in 70 mM Tris-HCI, pH 7.6/5 mM DTT/10 mM MgCI2/T4 polynucleotide kinase (1 unit/izl) at 370C for 30 min. The labeled strands were separated from the unincorporated label on a 20% polyacrylamide/50% urea gel. The bands were visualized and the DNA was extracted and purified as was done for the 53-mer. Each labeled strand was annealed to its complementary unlabeled strand by heating to 80'C and slowly cooling to 10'C. We verified that all of the labeled DNA was in duplex form by running the annealed samples and the labeled single strands on a 20% native polyacrylamide gel at 10'C: the mobilities of single strands are distinctly different from the mobilities of the corresponding annealed duplex. The DNA samples were incubated with either calicheamicin y1 or calicheamicinone for 2 hr at 4TC; care was taken to ensure that the drug was always present in excess with respect to the DNA concentration. The reaction mixtures were then lyophilized to dryness, resuspended in 4 td of 80% formamide dye, and loaded on 20%o polyacrylamide (acrylamide:bisacrylamide, 19:1)/50% urea gels that were run until the bromophenol blue had moved 20 cm. The intensities of all bands of interest were measured using a Betascope blot analyzer (Betagen, Waltham, MA). The intensity of the band resulting from DNA cleavage at a specific site (for example TCCT) divided by the intensity of the uncut starting material was plotted against drug concentration: this allowed determination of the drug's concentration at half saturation, a value that provides a crude estimate of the drug's apparent binding affinity for a given binding site. Direct Hydrogen Atom Transfer Between DNA and Calicheamicinone. It had been previously shown that calicheamicin y1 abstracts nonexchangeable hydrogens from the DNA to initiate strand scission. Zein and coworkers (12) demonstrated that in the presence of DNA, deuterated buffer, and deuterated methylthioglycolate, the 1H NMR spectrum of the inactivated calicheamicin species indicated no deuterium incorporation at C1 or C4, whereas when the experiment was repeated in the absence of DNA, these positions were >98% deuterated. The presence of deuterium at the positions where the biradical forms could be easily verified by the absence of the corresponding 1H NMR signal. Furthermore, the 2H-1H coupling is so weak that there is usually no splitting of the proton's signal. When the C1 and C4 positions were fully deuterated, the aromatic portion of the 1H NMR spectrum showed the two doublets corresponding to the hydrogens present at C2 and C3, whereas when the C1 and C4 positions were fully hydrogenated, the spectrum showed two doublets and two triplets, corresponding to the hydrogens present at C1-C4 and C2-C3, respectively. We took a similar approach to test if calicheamicinone was capable of direct hydrogen abstraction from DNA. Highly polymerized calf thymus DNA (Sigma) was phenol and chloroform extracted and then sonicated to give fragments ranging in size from -100 to 400 bp. It was then ethanol precipitated from a solution 150 mM in NaCl. After spinning for 15 min and washing the pellet twice with 70o ethanol, the DNA was repeatedly lyophilized and resuspended in 2H20. The DNA concentration was determined spectrophotometrically at 260 nm. The dried sample was finally redissolved in the deuterated reaction buffer (27 mM Tris.2HCl, p2H 8.0/39 mM sodium phosphate, p2H 7.6/11o C22H502H, 2H20). Calicheamicinone (2 mM) was incubated in the deuterated buffer in the presence or absence of DNA (%42 mM in bp).
7466
Proc. Natl. Acad. Sci. USA 88 (1991)
Biochemistry: Drak et al.
1
The aromatization reaction was started by addition of deuterated DTT (final concentration, 2 mM). After 15 min at 37TC the sample was extracted three times with ethyl acetate, and the combined extracts were dried over MgSO4 and purified by silica-gel column chromatography (ethyl acetate:methanol, 97:3). The extent of hydrogen incorporation was measured by integration of the characteristic signals of the four aromatic protons.
1 2 3 4 5 6 7 8
II
_
III_ FIG. 3. Agarose gel showing the extent of DNA cleavage produced by calicheamicin vy and calicheamicinone. Forms I, II, and III refer to supercoiled, nicked, and linear DNA, respectively. Lane 1, untreated DNA; lanes 2-5, reactions in 1.5 1&M, 73 nM, 7.3 nM, and 0.73 nM calicheamicin vy; lanes 6-8, reactions in 0.65 mM, 0.13 mM, and 13 1LM calicheamicinone.
7 X (
;
II III I
RESULTS AND DISCUSSION Extent of DNA Cleavage Induced by Calicheamicinone. In the presence of DTT calicheamicinone induced DNA cleavage at concentrations as low as 13 ,M (Fig. 3). There was no detectable DNA damage in the absence of a reducing agent, but it was possible to substitute DTT by other reducing thiols such as glutathione, methylthioglycolate, or 2-mercaptoethanol; the extent of cleavage varied somewhat with the nature of the reducing agent. We have shown for comparison the result of the analogous reaction where we used the natural compound: in the latter case there is extensive DNA damage even at concentrations as low as 0.7 nM, and at 1.5 AM the extent of cleavage is such that all of the supercoiled DNA has been converted to very short oligonucleotides (there is a smear ahead of the bromophenol blue marker). The DNA cleaving potential of calicheamicinone (at 10 AM concentration) can be assessed against values taken from the literature for other cleaving agents. MPE-Fe(II) [methidiumpropylEDTA-iron(II)] at 1 AM concentration in the absence of DTT produces comparable DNA damage (13); a conjugated cyclodecaenediyne synthesized by Nicolaou and coworkers (14) causes comparable DNA damage at 100 ,M concentration and much longer reaction times. Quantitation of Double-Stranded and Single-Stranded Breaks. We monitored the kinetics of DNA cleavage in a series of experiments in which calicheamicinone was incubated with supercoiled plasmid and DTT. Typical results are illustrated in Fig. 4. The fast kinetics during the first 5 min of the reaction might possibly indicate that supercoiled DNA is a better substrate for calicheamicinone binding than nicked DNA. More likely, it could reflect conversion of the drug to a less active form, whose action accounts for the slower terminal kinetics (15). Similar results were obtained at lower drug concentrations: rapid initial kinetics and a rather low percentage of linear molecules, even when all of the DNA was cut at the end of the experiment. We assumed a Poisson distribution for the formation of single-stranded breaks and double-stranded breaks so that we could calculate the average number of single and doublestranded cuts per DNA molecule (16). We also estimated the fraction of linear molecules that would have been obtained by accumulation of single-stranded breaks using the FreifelderTrumbo equation (17). The data from the first 5 min of the reaction can be fitted to a linear equation, with a ratio of
A A1
'.
A
100 S~o - - r
80 z 0
//
F: 60
/
U.: 40 U)
2o1 20
1
Xi
k~~~A
0
2
4
6
8
10 12
14 16
TIME (minutes)
B FIG. 4. (A) Agarose gel illustrating the kinetics of DNA cleavage by calicheamicinone. Reaction conditions were the same as for the experiment in Fig. 3 except that the concentration of calicheamicinone was 0.84 mM. Lane 1, untreated DNA; lanes 2-9, extent of the reaction at time = 1, 3, 5, 7, 10, 15, 20, and 25 min. (B) Densitometry of a negative of the gel shown on A allowed quantitation of the percentage offorms I (e), 11 (o), and III (A) present at each time point.
double-stranded cuts to single-stranded cuts per DNA molecule of 1:30. This is to be compared, for example, with a ratio of 1:9 for bleomycin (16) and 1:6-1:41 for neocarzinostatin (18), depending on the experimental conditions. Our data suggest that at least at the beginning of the reaction there are true double-stranded cutting events, albeit not very many. For comparison, we have examined the kinetics of cleavage by the natural compound (at a 1.5 nM concentration). We observed the same rapid kinetics at the beginning of the reaction as we did for calicheamicinone, but we obtained very high ratios of double-stranded cuts to single-stranded cuts, -1:2, indicating that the presence of the sugar moiety has increased the potential of the core aglycone as a doublestranded cleaving agent by several orders of magnitude. Sequence Selectivity Requires the Sugar Moiety. We have investigated the sequence selectivity of calicheamicinone by analyzing the cleavage products obtained after incubation with an oligonucleotide containing three cleavage sites for the natural product (5), arranged so that the pyrimidine-rich strand of each site is on the same strand of the molecule. To clearly demonstrate the effect of the carbohydrate moiety we have repeated the experiment using calicheamicin yA instead of the core aglycone (Fig. 5). The synthetic analog does not have any sequence selectivity, as demonstrated by the rather uniform cleavage ladder, whereas three main bands could be easily identified when the natural compound was used. The conclusion was the same from an experiment in which the duplexed oligonucleotide was labeled at the 3' end of the complementary strand (data not shown). It is of interest to analyze in more detail the results obtained with the natural product. The cleavage positions observed on both strands for the central 5'-TCCT site were precisely as expected (5). This was not the case for the 5'-TCCG and 5'-GCCT sites, though. Our results are consistent with the presence of another cleavage site adjacent to the 5'-TCCG site (possibly the 5'-TCTG sequence present in the bottom strand) and with calicheamicin yi cleaving at the homopyrimidine-homopurine region located to the right of the 5'-
Biochemistry: Drak et al. 1 2
-
