Journal of Virological Methods, 27 (1990) 29-38
29
Elsevier VIRMET 00963
The application of polymerase chain reaction to the detection of rotaviruses in faeces L. Xui, D. Harbouri
and M.A.
McCrae2
‘School of Veterinary Science, University of Bristol, Langford, Bristol, U.K. and ‘Department of Biological Sciences, University of Warwick, Coventry, U.K.
(Accepted 8 September 1989)
summary
An assay protocol based on exploiting the polymerase chain reaction (PCR) for the detection of rotavirus in infected faeces is described. The assay is 100 000 times more sensitive than the standard electropherotype method that is widely used. It also gives a 5000-fold increase in sensitivity over the hybridisation based assay previously developed (Pedley and McCrae, 1984) and does not require the use of radioisotopes. The amplified product is a full length c-DNA copy of the gene encoding the major neutralisation antigen of the virus whose molecular cloning and sequence analysis will allow detailed information on the molecular basis of epidemiological variation to be rapidly collected. Rotavirus; Polymerase
chain reaction; Viral diagnosis
Introduction
The development of rapid and sensitive procedures for the detection of viruses is a necessary prerequisite to work on control methods to alleviate the disease states that they cause. In the case of assay protocols aimed at detecting the nucleic acid of the virus in question the traditional approach has been to employ hybridisationbased techniques. In these the nucleic acids present in the clinical specimen are immobilised on an insoluble support and the presence of viral sequences detected using a sequence specific probe that is usually radioactively labelled and hence a Correspondence
too: M.A. McCrae, Department entry CV4 7AL, U.K.
of Biological Sciences, University of Warwick, Cov-
0166~0934/90/$03.50 @ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
30
positive result is represented by a radioactive spot on the immobilising support visualised by autoradiography (Thomas, 1980; Brandsma and Miller, 1980; Berninger et al., 1982; Stalhandske and Pettersson, 1982; Chou and Merigan, 1983). This format of assay is limited in its sensitivity by the relative levels of positive signal to background non-specific binding of the probe to irrelevant nucleic acids present in the sample. The problem of variable ‘noise’ levels in the assay due to large variations in the level of irrelevant nucleic acids in the specimen obviously limits the working sensitivity of the assay and is particularly acute in clinical samples such as faeces, urine and sputum which have variable consistencies (Pedley and McCrae, 1984; Echeverria et al., 1984). The polymerase chain reaction (PCR) provides a technique by which the pathogen nucleic acid in any sample can be specifically amplified by up to 106-fold prior to attempting to detect it (Saiki et al., 1985; Saiki et al., 1988). The obvious potential of this new technique in the field of viral diagnosis and epidemiological surveying has already resulted in its application in several virus systems (Kwok et al., 1987; Gama et al., 1988; Melchers et al., 1989; Hsia et al., 1989). Rotaviruses are the major etiological agents of acute viral gastroenteritis in the young of a wide range of avian and mammalian species including humans and all the major species of domestic livestock (Flewett and Woode, 1978; Kapikian et al., 1986). As a consequence they are major medical and veterinary pathogens responsible for an estimated 2-5 million infant deaths per annum predominantly in the third world (Argarwal, 1979) and in the region of three million pounds of economic loss per annum to the British dairy industry alone. The viruses have been divided into five distinct groups (A-E) using serological and nucleic acid based assays (Pedley et al., 1983, 1986) of which group A is at present by far the most frequently isolated in cases of rotaviral diarrhoea. Nucleic acid based diagnostic assays for rotaviruses have in the main focused on detecting the highly characteristic pattern of genomic double stranded (ds)RNA segments (electropherotype) produced when the viral genome is fractionated on polyacrylamide gels (Rodger et al., 1975; Todd et al., 1980; Clarke and McCrae, 1981) although ‘dot-blot’ hybridisation assays of the type mentioned above have been reported (Flores et al., 1983; Pedley and McCrae, 1984). In this report we describe a diagnostic assay for group A rotaviruses based on exploiting polymerase chain reaction technology to dramatically increase the working sensitivity of detection when applied to faecal samples.
Materials and Methods Growth and purification of UKtc bovine rotavirus The UK tissue culture adapted strain of bovine rotavirus was grown in and purified from BSC-1 cells as previously described (McCrae and Faulkner-Valle, 1981).
31
Extraction of nucleic acids from infected faeces
A 10% faecal suspension in 50 mM Tris-HCl buffer, pH 8.0, was made from each infected faeces. A 200-500 ~1 sample of this faecal suspension was centrifuged at low speed (2000 x g for 10 min) to remove large particulate material and the supernatant extracted twice with phenol saturated with Tris buffer. Residual phenol was removed from the aqueous phase by extracting four times with ether, the last traces of ether being removed using a nitrogen stream. Non-specific inhibitors of the PCR reaction present in the extracted samples were removed by purification using the Isogene kit according to the manufacturer’s instructions. The nucleic acids eluted from the ‘DNA binder’ using water were ethanol precipitated and resuspended in a final volume of 10-20 ~1 of water for use in PCR reactions. Amplification of rotaviral sequences using PCR
Extracted faecal nucleic acid (5-10 l.~l)was mixed with 100 ngm of each PCR primer and dimethyl sulphoxide to a final concentration of 10% in a final volume of 12.5 ~1. This was then heated in a Perkin Elmer Cetus Thermocycler to 94°C for 2 min to denature the dsRNA and then cooled to 42°C. An equal volume (12.5 l.~l)of reverse transcription/PCR amplification mix was added and incubation continued at 42°C for 30 min to generate c-DNA copies of the rotavirus dsRNA. This reverse transcription step was immediately followed by PCR amplification of the c-DNA using 20 cycles of a regime in which each cycle involved denaturation at 94°C for 2 min, annealing at 55°C for 1 min and synthesis at 70°C for 4 min. The final concentrations in the reaction were 30 mM Tris-HCl buffer, pH 8.3, 55 mM KCl, 3.5 mM MgCl,, 0.3 mM DTT, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM TI’P, 0.5 mg/ml gelatin, 6 units AMV reverse transcriptase, 1 unit Taq DNA polymerase . Electrophoretic fractionation of rotavirus &RNA
and amplijied DNA
Viral genomic dsRNA was fractionated on 5.5% polyacrylamide gels as previously described (McCrae and McCorquodale, 1982). The dsRNA was visualised by silver staining as described by Herring et al. (1982). Amplified DNA bands were fractionated on 1.5% agarose gels run in TBE buffer and visualised by staining with ethidium bromide.
Results The primary aim of this work was to develop a PCR based assay for the diagnosis of rotavirus in faecal samples. However, as a subsidiary objective we wished to generate material to further our interests in studying the molecular basis of epidemiological variation within rotaviruses (Clarke and McCrae, 1982; Pedley and McCrae, 1984). To satisfy both of these requirements the oligonucleotide primers
32 Smal BamHl
Ncol
Nad
5;:C~GGGAT:cATGGC:GGCTTTA**AG WCGAAATTTTCGCTCTTAAA - SENSE STRAND
5’ + SENSE
END
PRIMER
FOR
GENE
8
STRAND
TAGAGTTGTATGATGTGACC3’ ATCTCAACATACTACACTGGACGTCTTAAGCGCTAGC5’ A JLI ECoRl NriI i&l
Pdl
3’
END
PRIMER
FOR
GENE
8
Fig. 1. Sequence of primers used for the reverse transcription/PCR
amplification of rotavirus gene 8.
shown in Fig. 1 were constructed for use in the reverse transcription/PCR amplification steps. As can be seen from Fig. 1 the 3’ half of each primer was complementary to either the 3’ end of the gene 8 plus strand or the 3’ end of the gene 8 minus strand. Because of the genomic segment specific terminal conservation seen in group A rotaviruses (McCrae and McCorquodale, 1983; Clarke and McCrae, 1983), it was expected that reverse transcription/PCR amplification using these primers would give a specific full length c-DNA product of gene 8/9, irrespective of the origin of the rotavirus isolate. The 5’ half of each primer contained the recognition sequences of a number of restriction enzymes that are either not present at all or present only rarely in the gene 8/9 sequences published to date. Therefore, using these primers, the product of the reverse transcription/PCR amplification reaction is a full length DNA copy of the viral gene encoding the major neutralisation antigen (VP7/7c) of the virus (McCrae and McCorquodale, 1982). The DNA product also has convenient restriction enzyme sites at each end to facilitate its cloning and subsequent sequence analysis to analyse epidemiological variation in this important viral gene. A second strategic consideration in designing the final assay protocol was that it should be as simple as possible such that it could be simultaneously applied to large numbers of clinical samples. Also, if possible, radioisotopes should be avoided as they are either difficult to obtain or to use in many routine diagnostic laboratory environments. To accommodate these requirements the reverse transcription and PCR amplification reactions were carried out sequentially in a single tube without the need for any intervention between the two reactions (see Materials and Methods) and the PCR product was detected by ethidium bromide staining following fractionation on an agarose gel. The most widely used nucleic acid-based procedure for rotavirus diagnosis is that of genome profile or electropherotype analysis (Rodger et al., 1975; Todd et al., 1980; Herring et al., 1982). In order to compare the sensitivity of the PCR based assay with electropherotype detection a preparation of purified bovine rotavirus (UKtc strain) was serially diluted in either Tris buffer or a 10% faecal suspension
33
and viral dsRNA extracted as described in Materials and Methods. The resulting extracted samples were then divided in two and 50% was directly analysed by polyacrylamide gel electrophoresis and silver staining whilst the dsRNA in the other half was reverse transcribed and amplified before detection of the amplified DNA on an agarose gel. The results showed that when dilution was carried out in buffer
MABCDEFGHIM
MABCDEFGHI
Fig. 2. Comparison of PCR-based detection with electropherotyping for the diagnosis of rotavirus. Purified UKtc bovine rotavirus was serially diluted either in 50 mM Tris-HCl buffer, pH 8.0 (A) or a 10% faecal suspension (B) and viral RNA extracted as described in Materials and Methods. Viral dsRNA was then detected either by electrophoresis on polyacrylamide and silver staining (upper panels) or by agarose gel electrophoresis and staining with ethidium bromide following reverse transcription/PCR amplification (lower panels). Track M, ladder of DNA size markers (GibcoBRL); track A, sample containing 8 X 10” virus particles; track B, sample containing 8 X log virus particles; track C, sample containing 8 X lo* virus particles; track D, sample containing 8 x 10’ virus particles; track E, sample containing 8 X 106 virus particles; track F, sample containing 8 x lo5 virus particles; track G, sample containing 8 X 104 virus particles; track H, sample containing 8 X lo3 virus particles; track I, sample containing 8 x 102 virus particles.
34
a genome profile could be detected with the RNA from 8 x 10s particles (Fig. 2A) whereas when the virus was diluted in a 10% faecal suspension there was an approximately lo-fold drop in sensitivity to 8 X 10’ particles (Fig. 2B). The exact reason for this fall in sensitivity when the extraction is done from faecal suspensions is not clear but it possibly reflects the trapping of nucleic acid in protein lost in the phenol extraction step. Irrespective of the reason for the fall, Fig. 2B gives a true indication of the sensitivity obtainable when extracting rotavirus positive clinical samples. Using the PCR detection assay developed in this study the RNA present in 8 x 16 particles could be detected when virus was diluted in buffer (Fig. 2A) with there being again about a lo-fold drop in sensitivity when the dilution was carried out in a 10% faecal suspension (Fig. 2B). That is the PCR based assay gave an approximately 100000 fold increase in sensitivity compared to electropherotype detection. In the initial assay procedure used on faecal samples known to contain rotavirus following phenol extraction, the nucleic acid was simply concentrated by ethanol precipitation and used directly in the PCR assay. However, when this was done a number of samples failed to produce an amplified viral band despite being known to contain sufficient viral particles to be easily detected in the assay (results not shown). To investigate the possibility that the extracted faecal samples in some cases contained non-specific inhibitors of the PCR reaction that carried through the extraction procedure a series of reconstruction experiments were carried out. In these RNA extracted from BSC-1 cells infected with the UKtc bovine rotavirus, was mixed with the extracted faecal samples before carrying out the PCR reaction. An
Fig. 3. Detection of non-specific inhibitors of the PCR assay in extracted faecal samples. Equal volumes of RNA extracted from UKtc bovine virus were subjected to reverse transcription/PCR amplification either after mixing with an equal volume of buffer or with the nucleic acid fraction obtained by simple phenol extraction of faeces. The amplified products were analyzed on an agarose gel as described in Materials and Methods. Track M, ladder of DNA size markers (Gibco/BRL); Track A, amplified product obtained when UKtc RNA was mixed with 50 mM Tris-HCl buffer, pH 8.0; Track B, amplified product obtained when UKtc RNA was mixed with the extracted nucleic acid fraction from faecal sample 15312; Track C, amplified product obtained when UKtc RNA was mixed with the extracted nucleic acid fraction from faecal sample 26114.
35
MA
BCDEFGHI
Fig. 4. Typical results from screening unselected diarrhoeic faeces using PCR. The PCR assay was carried out as described in Materials and Methods. Track M, ladder of DNA size markers (Gibco/BRL); track A, positive control of UKtc RNA; track B, faecal sample 1817; track C, faecal sample 035; track D, faecal sample 1319; track E, faecal sample 2109; track F, faecal sample 0181; track G, faecal sample 033; track H, faecal sample 0137; track I, faecal sample 232.
example of the results typically obtained from this experiment are shown in Fig. 3. From this it is clear that some faecal extracts contain little or no non-specific inhibitor and would therefore be expected to give a positive PCR result if they contained rotavirus RNA (Fig. 3, track C). In other cases the presence of a nonspecific inhibitor in the extracted faecal specimen was able to completely inhibit the PCR amplification of the added rotaviral RNA (Fig. 3, track B). A wide range of modifications of the original simple extraction procedure were tried in an attempt to effectively remove the non-specific inhibitor(s) found in some faecal extracts. Of these the most effective was the use of the ‘Isogene’ extraction kit based on the selective adsorption of nucleic acid to glass in the presence of sodium iodide (Vogelstein and Gillespie, 1979). Incorporation of this purification step into the extraction procedure as described in Materials and Methods circumvented the problem of carriage of non-specific inhibitors present in some faecal samples through to the reverse transcription/PCR amplification reaction. An example of the type of result obtained when the final assay protocol was used to screen eight unselected diarrhoeic faeces is shown in Fig. 4, with five of the eight scoring positive for rotavirus.
Comparison of the assay described in this paper with our previous hybridisation based screening assay (Pedley and McCrae, 1984) shows that it is approximately five thousand times more sensitive. On comparing the PCR based assay with genome profile analysis by silver staining the former was found to be approximately one hundred thousand times more sensitive. Obviously this very large improve-
ment in sensitivity would be reduced if the silver staining procedure was abnormally insensitive in our hands. Herring et al. (1982) indicated that the limit of detection in their hands was 3-400 pgm, which is broadly comparable to the amount of dsRNA present in the smallest band at our limit of detection. Therefore the largest increase in sensitivity of the PCR detection assay over electrophoretic analysis is a real one. In addition to greatly enhanced sensitivity the PCR based assay produces a full length c-DNA copy of the viral gene being detected which could easily be molecularly cloned and subjected to sequence analysis allowing the rapid accumulation of information on the molecular basis of epidemiological variation. Given that PCR has been shown to be capable of detecting single DNA molecules it is reasonable to ask why the sensitivity achieved is in fact considerably below this. The most likely step in which sensitivity was lost was reverse transcription. In choosing to combine the reverse transcription&CR amplification steps, the reaction conditions chosen were not absolutely optimum for either reaction; however, this approach does greatly simplify the assay, making it more amenable to handling a large numbers of clinical specimens. A further drop in sensitivity certainly results from the assay procedure specifically selecting only full length c-DNA’s for amplification since it is well documented from molecular cloning experiments that reverse transcriptase gives a relatively poor conversion of RNA into full length c-DNA. Thus, if further increases in sensitivity were required then these could almost certainly be achieved by using internal primer pairs which would result in a smaller amplified product. However, in our experience the levels of group A virus found in clinical specimens falls in the range 108-10’2 particles/ml and so even at the low end of this range, which is rarely seen, the PCR assay as described here would require less than 1 ~1 of infected faeces to give a positive result. Also although this assay was developed for the group A rotaviruses as sequence information becomes available for the type members of the other rotavirus groups it could be easily applied to their detection. Therefore, as in many other cases, the application of PCR based detection to the rotavirus system can give very large increases in sensitivity and will revolutionize the rate at which information on the molecular basis of epidemiological variation in this important group of viral pathogens can be accumulated.
Acknowledgements
This work was supported by grants from AFRC and EEC. We would like to thank Graham Beards for access to some of the clinical samples used. L.X. is supported by a postgraduate studentship from the University of Bristol. MAM is a Lister Institute Fellow. References Argarwal, A. (1979) Nature (London) 278, 389. Beminger, M., Hammer, M., Hoyer, B. and Gerin, J.L. (1982) J. Med. Viral. 9, 57.
37
Brandsma, J. and Miller, G. (1980) Proc. Natl. Acad. Sci. USA 77, 6851. Chou, S. and Merigan, T.C. (1983) N. Engl. J. Med. 308,921. Clarke, I.N. and McCrae, M.A. (1981) J. Virol. Methods 2, 203. Clarke, I.N. and McCrae, M.A. (1982) Infect. Immun. 36, 392. Clarke, I.N. and McCrae, M.A. (1983) J. Gen. Viral. 64, 1877. Echeverria, P.. Leksomboon, U., Chaicumpa, W., Seriwatana, J., Tirapat, C. and Rowe, B. (1984) Lancet i, 63. Flewett, T.H. and Woode, G.N. (1978) Arch. Viral. 57, 1. Flores, J., Boeggeman, E., Purcell, R.H., Sereno, M., Perez, I., White, L., Wyatt, R.G., Chanock, R.M. and Kapikian, A.Z. (1983) Lancet i, 555. Gama, R.E., Hughes, P.J., Bruce, C.B. and Stanway, G. (1988) Nucl. Acids Res. 16, 9346. Herring, A.J., Inglis, N.F., Ojeh, C.K., Snodgrass, D.R. and Menzies, J.D. (1982) J. Clin. Microbial. 16, 473. Hsia, K., Spector, D.H., Lawrie, J. and Spector, S.A. (1989) J. Clin. Microbial. 27, 1802. Kapikian, A.Z., Flores, J., Hoshino, Y., Glass, R.I., Midthun, K., Gorziglia, M. and Chanock, R.M. (1986) J. Infect. Dis. 153, 815. Kwok, S., Mack, D.H., Mullis, K.B., Poiesz, B., Ehrlich, G., Blair, D., Friedman-Kein, A. and Sninsky, J.J. (1987) J. Virol. 61, 1690. McCrae, M.A. and Faulkner-Valle, G.P. (1981) J. Viral. 39, 490. McCrae, M.A. and McCorquodale, J.G. (1982) Virology 117, 435. McCrae, M.A. and McCorquodale, J.G. (1983) Virology 126, 204. Melchers, W.J.G., Schift, R., Stolz, E., Lindeman, J. and Quint, W.G.V. (1989) J. Clin. Microbial. 27, 1711. Pedley, S. and McCrae, M.A. (1984) J. Virol Methods 9, 173. Pedley, S., Bridger, J.C., Brown, J.F. and McCrae, M.A. (1983) J. Gen. Virol. 64, 2093. Pedley, S., Bridger, J.C., Chasey, D. and McCrae, M.A. (1986) J. Gen. Virol. 67, 131. Rodger, SM., Schnagl, R.D. and Holmes, I.H. (1975) J. Virol. 16, 1229. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N. (1985) Science 230, 1350. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Science 239, 487. Stalhandske, P. and Pettersson, U. (1982) J. Clin. Microbial. 15, 744. Thomas, P. (1980) Proc. Natl. Acad. Sci. USA 77, 5201. Todd, D., McNulty, SM. and Allan, G.M. (1980) Arch. Viral. 63, 87. Vogelstein, B. and Gillespie, D. (1979) Proc. Natl. Acad. Sci. USA 76, 615.
29
Elsevier VIRMET 00963
The application of polymerase chain reaction to the detection of rotaviruses in faeces L. Xui, D. Harbouri
and M.A.
McCrae2
‘School of Veterinary Science, University of Bristol, Langford, Bristol, U.K. and ‘Department of Biological Sciences, University of Warwick, Coventry, U.K.
(Accepted 8 September 1989)
summary
An assay protocol based on exploiting the polymerase chain reaction (PCR) for the detection of rotavirus in infected faeces is described. The assay is 100 000 times more sensitive than the standard electropherotype method that is widely used. It also gives a 5000-fold increase in sensitivity over the hybridisation based assay previously developed (Pedley and McCrae, 1984) and does not require the use of radioisotopes. The amplified product is a full length c-DNA copy of the gene encoding the major neutralisation antigen of the virus whose molecular cloning and sequence analysis will allow detailed information on the molecular basis of epidemiological variation to be rapidly collected. Rotavirus; Polymerase
chain reaction; Viral diagnosis
Introduction
The development of rapid and sensitive procedures for the detection of viruses is a necessary prerequisite to work on control methods to alleviate the disease states that they cause. In the case of assay protocols aimed at detecting the nucleic acid of the virus in question the traditional approach has been to employ hybridisationbased techniques. In these the nucleic acids present in the clinical specimen are immobilised on an insoluble support and the presence of viral sequences detected using a sequence specific probe that is usually radioactively labelled and hence a Correspondence
too: M.A. McCrae, Department entry CV4 7AL, U.K.
of Biological Sciences, University of Warwick, Cov-
0166~0934/90/$03.50 @ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
30
positive result is represented by a radioactive spot on the immobilising support visualised by autoradiography (Thomas, 1980; Brandsma and Miller, 1980; Berninger et al., 1982; Stalhandske and Pettersson, 1982; Chou and Merigan, 1983). This format of assay is limited in its sensitivity by the relative levels of positive signal to background non-specific binding of the probe to irrelevant nucleic acids present in the sample. The problem of variable ‘noise’ levels in the assay due to large variations in the level of irrelevant nucleic acids in the specimen obviously limits the working sensitivity of the assay and is particularly acute in clinical samples such as faeces, urine and sputum which have variable consistencies (Pedley and McCrae, 1984; Echeverria et al., 1984). The polymerase chain reaction (PCR) provides a technique by which the pathogen nucleic acid in any sample can be specifically amplified by up to 106-fold prior to attempting to detect it (Saiki et al., 1985; Saiki et al., 1988). The obvious potential of this new technique in the field of viral diagnosis and epidemiological surveying has already resulted in its application in several virus systems (Kwok et al., 1987; Gama et al., 1988; Melchers et al., 1989; Hsia et al., 1989). Rotaviruses are the major etiological agents of acute viral gastroenteritis in the young of a wide range of avian and mammalian species including humans and all the major species of domestic livestock (Flewett and Woode, 1978; Kapikian et al., 1986). As a consequence they are major medical and veterinary pathogens responsible for an estimated 2-5 million infant deaths per annum predominantly in the third world (Argarwal, 1979) and in the region of three million pounds of economic loss per annum to the British dairy industry alone. The viruses have been divided into five distinct groups (A-E) using serological and nucleic acid based assays (Pedley et al., 1983, 1986) of which group A is at present by far the most frequently isolated in cases of rotaviral diarrhoea. Nucleic acid based diagnostic assays for rotaviruses have in the main focused on detecting the highly characteristic pattern of genomic double stranded (ds)RNA segments (electropherotype) produced when the viral genome is fractionated on polyacrylamide gels (Rodger et al., 1975; Todd et al., 1980; Clarke and McCrae, 1981) although ‘dot-blot’ hybridisation assays of the type mentioned above have been reported (Flores et al., 1983; Pedley and McCrae, 1984). In this report we describe a diagnostic assay for group A rotaviruses based on exploiting polymerase chain reaction technology to dramatically increase the working sensitivity of detection when applied to faecal samples.
Materials and Methods Growth and purification of UKtc bovine rotavirus The UK tissue culture adapted strain of bovine rotavirus was grown in and purified from BSC-1 cells as previously described (McCrae and Faulkner-Valle, 1981).
31
Extraction of nucleic acids from infected faeces
A 10% faecal suspension in 50 mM Tris-HCl buffer, pH 8.0, was made from each infected faeces. A 200-500 ~1 sample of this faecal suspension was centrifuged at low speed (2000 x g for 10 min) to remove large particulate material and the supernatant extracted twice with phenol saturated with Tris buffer. Residual phenol was removed from the aqueous phase by extracting four times with ether, the last traces of ether being removed using a nitrogen stream. Non-specific inhibitors of the PCR reaction present in the extracted samples were removed by purification using the Isogene kit according to the manufacturer’s instructions. The nucleic acids eluted from the ‘DNA binder’ using water were ethanol precipitated and resuspended in a final volume of 10-20 ~1 of water for use in PCR reactions. Amplification of rotaviral sequences using PCR
Extracted faecal nucleic acid (5-10 l.~l)was mixed with 100 ngm of each PCR primer and dimethyl sulphoxide to a final concentration of 10% in a final volume of 12.5 ~1. This was then heated in a Perkin Elmer Cetus Thermocycler to 94°C for 2 min to denature the dsRNA and then cooled to 42°C. An equal volume (12.5 l.~l)of reverse transcription/PCR amplification mix was added and incubation continued at 42°C for 30 min to generate c-DNA copies of the rotavirus dsRNA. This reverse transcription step was immediately followed by PCR amplification of the c-DNA using 20 cycles of a regime in which each cycle involved denaturation at 94°C for 2 min, annealing at 55°C for 1 min and synthesis at 70°C for 4 min. The final concentrations in the reaction were 30 mM Tris-HCl buffer, pH 8.3, 55 mM KCl, 3.5 mM MgCl,, 0.3 mM DTT, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM TI’P, 0.5 mg/ml gelatin, 6 units AMV reverse transcriptase, 1 unit Taq DNA polymerase . Electrophoretic fractionation of rotavirus &RNA
and amplijied DNA
Viral genomic dsRNA was fractionated on 5.5% polyacrylamide gels as previously described (McCrae and McCorquodale, 1982). The dsRNA was visualised by silver staining as described by Herring et al. (1982). Amplified DNA bands were fractionated on 1.5% agarose gels run in TBE buffer and visualised by staining with ethidium bromide.
Results The primary aim of this work was to develop a PCR based assay for the diagnosis of rotavirus in faecal samples. However, as a subsidiary objective we wished to generate material to further our interests in studying the molecular basis of epidemiological variation within rotaviruses (Clarke and McCrae, 1982; Pedley and McCrae, 1984). To satisfy both of these requirements the oligonucleotide primers
32 Smal BamHl
Ncol
Nad
5;:C~GGGAT:cATGGC:GGCTTTA**AG WCGAAATTTTCGCTCTTAAA - SENSE STRAND
5’ + SENSE
END
PRIMER
FOR
GENE
8
STRAND
TAGAGTTGTATGATGTGACC3’ ATCTCAACATACTACACTGGACGTCTTAAGCGCTAGC5’ A JLI ECoRl NriI i&l
Pdl
3’
END
PRIMER
FOR
GENE
8
Fig. 1. Sequence of primers used for the reverse transcription/PCR
amplification of rotavirus gene 8.
shown in Fig. 1 were constructed for use in the reverse transcription/PCR amplification steps. As can be seen from Fig. 1 the 3’ half of each primer was complementary to either the 3’ end of the gene 8 plus strand or the 3’ end of the gene 8 minus strand. Because of the genomic segment specific terminal conservation seen in group A rotaviruses (McCrae and McCorquodale, 1983; Clarke and McCrae, 1983), it was expected that reverse transcription/PCR amplification using these primers would give a specific full length c-DNA product of gene 8/9, irrespective of the origin of the rotavirus isolate. The 5’ half of each primer contained the recognition sequences of a number of restriction enzymes that are either not present at all or present only rarely in the gene 8/9 sequences published to date. Therefore, using these primers, the product of the reverse transcription/PCR amplification reaction is a full length DNA copy of the viral gene encoding the major neutralisation antigen (VP7/7c) of the virus (McCrae and McCorquodale, 1982). The DNA product also has convenient restriction enzyme sites at each end to facilitate its cloning and subsequent sequence analysis to analyse epidemiological variation in this important viral gene. A second strategic consideration in designing the final assay protocol was that it should be as simple as possible such that it could be simultaneously applied to large numbers of clinical samples. Also, if possible, radioisotopes should be avoided as they are either difficult to obtain or to use in many routine diagnostic laboratory environments. To accommodate these requirements the reverse transcription and PCR amplification reactions were carried out sequentially in a single tube without the need for any intervention between the two reactions (see Materials and Methods) and the PCR product was detected by ethidium bromide staining following fractionation on an agarose gel. The most widely used nucleic acid-based procedure for rotavirus diagnosis is that of genome profile or electropherotype analysis (Rodger et al., 1975; Todd et al., 1980; Herring et al., 1982). In order to compare the sensitivity of the PCR based assay with electropherotype detection a preparation of purified bovine rotavirus (UKtc strain) was serially diluted in either Tris buffer or a 10% faecal suspension
33
and viral dsRNA extracted as described in Materials and Methods. The resulting extracted samples were then divided in two and 50% was directly analysed by polyacrylamide gel electrophoresis and silver staining whilst the dsRNA in the other half was reverse transcribed and amplified before detection of the amplified DNA on an agarose gel. The results showed that when dilution was carried out in buffer
MABCDEFGHIM
MABCDEFGHI
Fig. 2. Comparison of PCR-based detection with electropherotyping for the diagnosis of rotavirus. Purified UKtc bovine rotavirus was serially diluted either in 50 mM Tris-HCl buffer, pH 8.0 (A) or a 10% faecal suspension (B) and viral RNA extracted as described in Materials and Methods. Viral dsRNA was then detected either by electrophoresis on polyacrylamide and silver staining (upper panels) or by agarose gel electrophoresis and staining with ethidium bromide following reverse transcription/PCR amplification (lower panels). Track M, ladder of DNA size markers (GibcoBRL); track A, sample containing 8 X 10” virus particles; track B, sample containing 8 X log virus particles; track C, sample containing 8 X lo* virus particles; track D, sample containing 8 x 10’ virus particles; track E, sample containing 8 X 106 virus particles; track F, sample containing 8 x lo5 virus particles; track G, sample containing 8 X 104 virus particles; track H, sample containing 8 X lo3 virus particles; track I, sample containing 8 x 102 virus particles.
34
a genome profile could be detected with the RNA from 8 x 10s particles (Fig. 2A) whereas when the virus was diluted in a 10% faecal suspension there was an approximately lo-fold drop in sensitivity to 8 X 10’ particles (Fig. 2B). The exact reason for this fall in sensitivity when the extraction is done from faecal suspensions is not clear but it possibly reflects the trapping of nucleic acid in protein lost in the phenol extraction step. Irrespective of the reason for the fall, Fig. 2B gives a true indication of the sensitivity obtainable when extracting rotavirus positive clinical samples. Using the PCR detection assay developed in this study the RNA present in 8 x 16 particles could be detected when virus was diluted in buffer (Fig. 2A) with there being again about a lo-fold drop in sensitivity when the dilution was carried out in a 10% faecal suspension (Fig. 2B). That is the PCR based assay gave an approximately 100000 fold increase in sensitivity compared to electropherotype detection. In the initial assay procedure used on faecal samples known to contain rotavirus following phenol extraction, the nucleic acid was simply concentrated by ethanol precipitation and used directly in the PCR assay. However, when this was done a number of samples failed to produce an amplified viral band despite being known to contain sufficient viral particles to be easily detected in the assay (results not shown). To investigate the possibility that the extracted faecal samples in some cases contained non-specific inhibitors of the PCR reaction that carried through the extraction procedure a series of reconstruction experiments were carried out. In these RNA extracted from BSC-1 cells infected with the UKtc bovine rotavirus, was mixed with the extracted faecal samples before carrying out the PCR reaction. An
Fig. 3. Detection of non-specific inhibitors of the PCR assay in extracted faecal samples. Equal volumes of RNA extracted from UKtc bovine virus were subjected to reverse transcription/PCR amplification either after mixing with an equal volume of buffer or with the nucleic acid fraction obtained by simple phenol extraction of faeces. The amplified products were analyzed on an agarose gel as described in Materials and Methods. Track M, ladder of DNA size markers (Gibco/BRL); Track A, amplified product obtained when UKtc RNA was mixed with 50 mM Tris-HCl buffer, pH 8.0; Track B, amplified product obtained when UKtc RNA was mixed with the extracted nucleic acid fraction from faecal sample 15312; Track C, amplified product obtained when UKtc RNA was mixed with the extracted nucleic acid fraction from faecal sample 26114.
35
MA
BCDEFGHI
Fig. 4. Typical results from screening unselected diarrhoeic faeces using PCR. The PCR assay was carried out as described in Materials and Methods. Track M, ladder of DNA size markers (Gibco/BRL); track A, positive control of UKtc RNA; track B, faecal sample 1817; track C, faecal sample 035; track D, faecal sample 1319; track E, faecal sample 2109; track F, faecal sample 0181; track G, faecal sample 033; track H, faecal sample 0137; track I, faecal sample 232.
example of the results typically obtained from this experiment are shown in Fig. 3. From this it is clear that some faecal extracts contain little or no non-specific inhibitor and would therefore be expected to give a positive PCR result if they contained rotavirus RNA (Fig. 3, track C). In other cases the presence of a nonspecific inhibitor in the extracted faecal specimen was able to completely inhibit the PCR amplification of the added rotaviral RNA (Fig. 3, track B). A wide range of modifications of the original simple extraction procedure were tried in an attempt to effectively remove the non-specific inhibitor(s) found in some faecal extracts. Of these the most effective was the use of the ‘Isogene’ extraction kit based on the selective adsorption of nucleic acid to glass in the presence of sodium iodide (Vogelstein and Gillespie, 1979). Incorporation of this purification step into the extraction procedure as described in Materials and Methods circumvented the problem of carriage of non-specific inhibitors present in some faecal samples through to the reverse transcription/PCR amplification reaction. An example of the type of result obtained when the final assay protocol was used to screen eight unselected diarrhoeic faeces is shown in Fig. 4, with five of the eight scoring positive for rotavirus.
Comparison of the assay described in this paper with our previous hybridisation based screening assay (Pedley and McCrae, 1984) shows that it is approximately five thousand times more sensitive. On comparing the PCR based assay with genome profile analysis by silver staining the former was found to be approximately one hundred thousand times more sensitive. Obviously this very large improve-
ment in sensitivity would be reduced if the silver staining procedure was abnormally insensitive in our hands. Herring et al. (1982) indicated that the limit of detection in their hands was 3-400 pgm, which is broadly comparable to the amount of dsRNA present in the smallest band at our limit of detection. Therefore the largest increase in sensitivity of the PCR detection assay over electrophoretic analysis is a real one. In addition to greatly enhanced sensitivity the PCR based assay produces a full length c-DNA copy of the viral gene being detected which could easily be molecularly cloned and subjected to sequence analysis allowing the rapid accumulation of information on the molecular basis of epidemiological variation. Given that PCR has been shown to be capable of detecting single DNA molecules it is reasonable to ask why the sensitivity achieved is in fact considerably below this. The most likely step in which sensitivity was lost was reverse transcription. In choosing to combine the reverse transcription&CR amplification steps, the reaction conditions chosen were not absolutely optimum for either reaction; however, this approach does greatly simplify the assay, making it more amenable to handling a large numbers of clinical specimens. A further drop in sensitivity certainly results from the assay procedure specifically selecting only full length c-DNA’s for amplification since it is well documented from molecular cloning experiments that reverse transcriptase gives a relatively poor conversion of RNA into full length c-DNA. Thus, if further increases in sensitivity were required then these could almost certainly be achieved by using internal primer pairs which would result in a smaller amplified product. However, in our experience the levels of group A virus found in clinical specimens falls in the range 108-10’2 particles/ml and so even at the low end of this range, which is rarely seen, the PCR assay as described here would require less than 1 ~1 of infected faeces to give a positive result. Also although this assay was developed for the group A rotaviruses as sequence information becomes available for the type members of the other rotavirus groups it could be easily applied to their detection. Therefore, as in many other cases, the application of PCR based detection to the rotavirus system can give very large increases in sensitivity and will revolutionize the rate at which information on the molecular basis of epidemiological variation in this important group of viral pathogens can be accumulated.
Acknowledgements
This work was supported by grants from AFRC and EEC. We would like to thank Graham Beards for access to some of the clinical samples used. L.X. is supported by a postgraduate studentship from the University of Bristol. MAM is a Lister Institute Fellow. References Argarwal, A. (1979) Nature (London) 278, 389. Beminger, M., Hammer, M., Hoyer, B. and Gerin, J.L. (1982) J. Med. Viral. 9, 57.
37
Brandsma, J. and Miller, G. (1980) Proc. Natl. Acad. Sci. USA 77, 6851. Chou, S. and Merigan, T.C. (1983) N. Engl. J. Med. 308,921. Clarke, I.N. and McCrae, M.A. (1981) J. Virol. Methods 2, 203. Clarke, I.N. and McCrae, M.A. (1982) Infect. Immun. 36, 392. Clarke, I.N. and McCrae, M.A. (1983) J. Gen. Viral. 64, 1877. Echeverria, P.. Leksomboon, U., Chaicumpa, W., Seriwatana, J., Tirapat, C. and Rowe, B. (1984) Lancet i, 63. Flewett, T.H. and Woode, G.N. (1978) Arch. Viral. 57, 1. Flores, J., Boeggeman, E., Purcell, R.H., Sereno, M., Perez, I., White, L., Wyatt, R.G., Chanock, R.M. and Kapikian, A.Z. (1983) Lancet i, 555. Gama, R.E., Hughes, P.J., Bruce, C.B. and Stanway, G. (1988) Nucl. Acids Res. 16, 9346. Herring, A.J., Inglis, N.F., Ojeh, C.K., Snodgrass, D.R. and Menzies, J.D. (1982) J. Clin. Microbial. 16, 473. Hsia, K., Spector, D.H., Lawrie, J. and Spector, S.A. (1989) J. Clin. Microbial. 27, 1802. Kapikian, A.Z., Flores, J., Hoshino, Y., Glass, R.I., Midthun, K., Gorziglia, M. and Chanock, R.M. (1986) J. Infect. Dis. 153, 815. Kwok, S., Mack, D.H., Mullis, K.B., Poiesz, B., Ehrlich, G., Blair, D., Friedman-Kein, A. and Sninsky, J.J. (1987) J. Virol. 61, 1690. McCrae, M.A. and Faulkner-Valle, G.P. (1981) J. Viral. 39, 490. McCrae, M.A. and McCorquodale, J.G. (1982) Virology 117, 435. McCrae, M.A. and McCorquodale, J.G. (1983) Virology 126, 204. Melchers, W.J.G., Schift, R., Stolz, E., Lindeman, J. and Quint, W.G.V. (1989) J. Clin. Microbial. 27, 1711. Pedley, S. and McCrae, M.A. (1984) J. Virol Methods 9, 173. Pedley, S., Bridger, J.C., Brown, J.F. and McCrae, M.A. (1983) J. Gen. Virol. 64, 2093. Pedley, S., Bridger, J.C., Chasey, D. and McCrae, M.A. (1986) J. Gen. Virol. 67, 131. Rodger, SM., Schnagl, R.D. and Holmes, I.H. (1975) J. Virol. 16, 1229. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N. (1985) Science 230, 1350. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Science 239, 487. Stalhandske, P. and Pettersson, U. (1982) J. Clin. Microbial. 15, 744. Thomas, P. (1980) Proc. Natl. Acad. Sci. USA 77, 5201. Todd, D., McNulty, SM. and Allan, G.M. (1980) Arch. Viral. 63, 87. Vogelstein, B. and Gillespie, D. (1979) Proc. Natl. Acad. Sci. USA 76, 615.
