YEAST

VOL. 7: 913-923

(1991)

The Allantoinase ( D A L l ) Gene o f Saccharomyces cere v isiae RICHARD G. BUCKHOLZ* AND TERRANCE G. COOPERf Department of Microbiology and Immunology, University of Tennessee, Memphis, Tennesee 38163, U.S.A.

Received 2 May 1991; revised 5 June 1991

The allantoinase ( D A L I ) gene from Saccharomyces cerevisiae has been cloned, sequenced, and found to encode a 472 amino acid protein with a M, of 52 028. D A L l is expressed in an inducer-independent manner in strain M970 (X1278b genetic background) and modestly responds to mutation of the dd80 locus. Expression was also sensitive to nitrogen catabolite repression (NCR). Correlated with these expression characteristics, the upstream region of DALI contained five copies of a sequence that is homologous to the D A L UAS,, element previously shown to be required for transcriptional activation and NCR sensitivity of the DALS and DAL7 genes. Missing from the D A L l 5’ flanking region were any sequences with significant homology to the DAL7 UISelement required for response to inducer. These and DAL7 UIS in the regulation of allantoin pathway gene observations further support the roles of UAS,,, expression. KEY WORDS - Saccharomyces

cerevisiae; nitrogen catabolism; allantoinase; upstream activator sequence.

synthase), have been shown to correlate with the array of cis-acting elements in their 5’ flanking The DALI gene of Saccharomyces cerevisiae regions (Rai et al., 1987, 1989). Only one type of encodes allantoinase, the first enzyme required for cis-acting element, the WAS,, has been found degradation of allantoin (Cooper and Lawther, upstream of DAL.5, which is expressed in an 1973; Lawther et al., 1974; Cooper, 1982).This gene inducer-independent manner (Rai et al., 1989). The is the centromere-proximal member of the allantoin inducible DAL7 gene, on the other hand, contains gene cluster on the right arm of chromosome IX two well-characterized elements, WAS,, and a (Cooper et al., 1979; Yo0 et al., 1985; Yo0 and second element required for response to inducer, Cooper, 1991a). Allantoinase production responds the upstream induction sequence (WZS) (Yo0 to the nature of the nitrogen source provided and to and Cooper, 1989; Bricmont and Cooper, 1989; mutation at da180 in the same way as previously Bricmont et al., 1991; Olive et al., 1991; H. van reported for other allantoin pathway enzymes Vuuren, J. Daugherty and T. G. Cooper, unpub(Cooper and Lawther, 1973; Lawther et al., 1974; lished observations). A third negatively acting Chisholm and Cooper, 1982). Like ureidoglycollate element, designated the upstream repression hydrolase (DALS),allantoinase synthesis is indepen- sequence, has been identified by is not yet characdent of inducer in strain Z1268b and its derivatives, terized (Yo0 and Cooper, 1989). DAL UAS,,,, and like all allantoin pathway enzymes and genes, is a dodecanucleotide element with the sequence sensitive to nitrogen catabolite repression in all GATAA at its core, has been shown to be necessary strains (Bossinger et al., 1974; Cooper, 1982; Yo0 et and sufficient for sensitivity to nitrogen catabolite al., 1985). repression (Cooper e t al., 1989). A function GLN3 Regulatory characteristics observed for expres- product is required for transcriptional activation sion of two allantoin pathway genes, DAL.5 supported by UAS,, (Cooper et al., 1990). (allantoate permease) and DAL7 (probably malate If one assumes that the allantoin pathway genes are subject to common regulatory mechanisms, one *Present address: CIBIA Corp., P.O.Box 85200, San Diego, would expect to find arrays of cis-acting elements in their 5’ flanking regions that reflect their expression California, 92138, U.S.A. characteristics. The purpose of this work has been to tAddressee for correspondence. INTRODUCTION

0749-503X/91/090913-11 $05.50 0 1991 by John Wiley & Sons Ltd

914

R. G. BUCKHOLZ AND T. G. COOPER

Table 1. Strains used in this work

RESULTS AND DISCUSSION

Genotype

Strain Saccharomyces cerevisiae

RH218 VT-21

MATa trpl CUPl GAL2 sue2 mAL MATa trpl CUPl dall-21 (RH218

derivative) M1365-6c

MATa lysl trpl dall-21 ura3-52

M1081

MATa lys2 da180-I MATa lys5 da180-1

M1414

MATa lysl trpl dall-21 ura3-52 (pRB3) MATa his6 ura3

M970

M A Ta lys2 M A Ta lys5

clone and sequence the DALl gene to ascertain whether the expected cis-acting elements are indeed present. METHODS The strains used in this work are shown in Table 1. Media, methods used to clone the DALl gene, and genetic methods required to establish linkage between an integrated plasmid containing cloned sequences and the DAL81 locus have been described already (Yo0 et al., 1985). Maxam and Gilbert sequencing procedures have been described earlier (Maxam and Gilbert, 1977). The GCG DNA sequence and analysis programs have been used for sequence analysis. Northern blot analyses were conducted as described by Yo0 et al. (1985).

Cloning the allantoinase (DAL1) gene The first objective of this work was to clone the DALl gene using transformation-complementation methods (Hinnen et al., 1978). A dull mutant (strain VT-2 1, also designated 0-1 1) was transformed with DNA from genomic plasmid banks prepared by Nasmyth and Reed (1980) using DNA from strain AB320. Transformants were selected in which both the plasmid marker (tryptophan auxotrophy, trpl-289) and the dull mutation (inability to use allantoin as sole nitrogen source) were simultaneously complemented. Eighteen Trp', Dal+ transformants appeared after 4 days of growth. Plamids harboured in these transformants were recovered in Escherichia coli and one of them (pTC-12) was chosen for further study. Purified plasmid pTC 12 DNA transformed dull, but not da12, mutants at high frequency and resulted in appearance of a 9- to 10-fold increase in allantoinase activity compared to that found in the wild-type parent (strain RH218) (Table 2). This high level of allantoinase production was lost when a transformant was cured of plasmid DNA by growth in unselective medium (Table 2). A restriction map of the plasmid was prepared (Figure 1). To localize the dull complementing regions, we prepared subclones of the insert carried in plasmid pTC12. Any subclone carrying a DNA fragment which contained the 1.7 kb XbaI-XhoI region from the left side of plasmid pTC12 was able to complement the dull defect (Figure 1). The smallest subclone isolated in this manner was plasmid pRB12 (Figure 1). To demonstrate linkage of the cloned DNA fragment to the dull locus following integration, we cloned the BglII-SalI insert of plasmid pTC12 into

Table 2. Allantoinase activity in wild-type, mutant and transformed strains of Saccharomyces cerevisiae

Proline

(nmol min-' per mg protein)

Strain assayed RH218 (wild type) VT21 (dall-21) VT21 Transformed VT21 Transformed and cured

ND, none detected

OXLU, oxalurate.

Nitrogen source provided Proline + OXLU Asparagine

8.52 ND 82.35 ND

20.27 ND 86.4

ND ND 10.4

ND

-

AvaI DdeI

EcoRI Hinfl

HpaIl Sau3A Smal

+ +1500

Taql XbaI Xhol

+600

+900

+;200

+300

-300

I

pRB9

Xbal

PStl BamHl BamHl

EwRl

lDALl

pRB13

pRB12

Xhol lDALl

pn4

+

Sac1 DALl-

I

+

-

‘$ALi

Bgin

pRB1

BglIlpRB5Xbal EcoRI ARS-

H

pRB3

BamHI p R M EWRl ARS +

4

Xbal

pRB6

:r~

EcoRl

EWRI pRB2 SalIARS EcoR1 4ARS-

Figure I . Restriction map of the DAL gene cluster on the right arm of chromosome IX, st itegy used to determine the nucleotide sequence of the DALl gene, and the results of complementation experiments used to locate sequences able to complement dull mutations. The results of experiments measuring the ability of subcloned fragments derived from plasmid pTC 12 to complement a dull mutation or to confer high frequency transformation on a plasmid containing them are shown below the restriction site map. DAL+ and DAL- indicate the presence and absence of dull complementation, respectively. ARS+ and ARS- indicate the presence or absence of ability to support high frequency transformation, respectively. The DNA sequencing strategy is shown above the restriction map. Cross-hatched areas indicate the presence ofvector sequences. Closed circles in the sequencing strategy indicate that the DNA fragments used were labeled at their 5’ termini. Open squares indicate the use of 3’ labeled DNA fragments.

916

R. G. BUCKHOLZ AND T. G. COOPER

Table 3. Behaviour of integrated URA3 allele in genetic crosses Cross

Genotype

Gene pair

PD

NPD

TT

M1414

MATa lysl trpl-289 dall-21 ura3-52 (pRB3) MATa ura3 his6

dall-lysl dall- URA3 URA3-his6 URA3-TRpl

72

0 0 9 15

0 48

vector YIPS yielding plasmid pRB 1. High frequency transformation observed when a Ura' phenotype was selected indicated the insert most likely carried an autonomously replicating sequence (ARS). Subcloning localized the putative A R S element to the BglII-EcoRI region of the insert contained in plasmid pRB4 (Figure 1). A plasmid (pRB6) containing the right half of this region (XbaI-EcoRI) did not support A R S function indicating that the cis-acting element(s) required for autonomous replication extended beyond the XbaI site (Figure 1). In view of this information, we cloned the 2.0 kb EcoRI fragment of plasmid pTC 12 (see plasmid pFG3) into vector YIp5. The resulting plasmid (pRB3) was linearized by digestion with endonuclease KpnI, and integrated into the genome of dull mutant strain, M1365-6c. Note that the insert of plasmid pRB3 does not contain sufficient DNA to complement the dull mutation. A stable Ura+,Dal- transformant was selected, cross to a ura3 strain (wild type for D A L I ) , and the meiotic products obtained following sporulation were analysed. All asci segregated 2+:2- for growth on allantoin. The Ura' and Dal- phenotypes cosegregated in all 77 asci analysed, demonstrating tight linkage of the integrated DNA to the DALI locus (Table 3). As expected, more limited linkage to the Zysl locus was also observed. Together these observations supported the conclusion that we had cloned the D A L l gene rather than an unlinked suppressor. Northern blot analysis using DNA fragments (plasmids pRB 16-pRB19)derived from the BarnHIXhoI insert of plasmid pRB12 as probes (Figure 2) revealed that two transcripts, 1.5 and 1-2 kb in length, hybridized to the DNA carried in plasmid pRB16. The 1.5 kb RNA species also hybridized to DNA sequences to the right of the XbaI site only (plasmids pRB17 and pRB19), while the 1.2kb species hybridized predominantly to sequences situated to the left of the XbaI site (plasmid pRB16). A very minor signal was observed hybridizing to DNA derived from plasmid pRBl8 (Figure 2). Since

17

19

23

5 39

the XbaI-XhoI region was required for dull complementation, these results indicated that the DALI transcript was the 1.5 kb species. Expression characteristics of the DAL 1 gene To ascertain the expression characteristics of the D A L l gene, RNA was prepared from wild-type (M970) and da180 mutant (M1081) strains (both diploid strains isogenic to the E 1278b genetic background) grown under conditions of no induction, induction, or nitrogen catabolite repression. As shown in Figure 3, D A L l expression did not respond to induction by oxalurate (OXLU), the gratuitous inducer of the allantoin pathway, but was sensitive to nitrogen catabolite repression when asparagine was provided as nitrogen source in place of proline. OXLU-mediated induction of URA3 expression (Buckholz and Cooper, 1983) provided a control for this experiment (1.0 kb transcript, Figure 3). D A L l expression was also modestly increased in a da180 mutant. These data correlate well with enzyme activities observed under these conditions. Nucleotide sequence of DALl The XhoI-XhoI fragment from plasmid pTC12 was used to sequence the D A L l gene according to the Maxam-Gilbert strategy depicted in Figure 1. Both strands were completely sequenced and all restriction sites used for primary or secondary digestion and/or labeling purposes were crossed. An open reading frame (ORF) of 1425 bp ending with two stop codons (1725-1733) was observed (Figure 4). The deduced amino acid sequence predicts a 472 amino acid protein with a calculated M, of 52 028 and a PI of 6.3. Downstream (250 bp) of the D A L l gene translational stop sites, the beginning of a second O R F extending 594 bp (198 amino acids) to the end of the XhoI fragment was observed (Figure 4). This is probably the protein encoded by the 1.2 kb mRNA

917

ALLANTOINASE GENE IN YEAST

Figure 2. Northern blot analysis of transcripts hybridizing to DNA in the region of sequences required for dall complementation. PolyA+ RNA (5 pg), derived from strain M970 cultured in minimal glucose proline medium, was separated in a 1.5% formaldehyde-agarose gel and transferred to nitrocellulose paper. The blot was then hybridized to plasmid DNA (pBR322 or YRp7) containing the inserts indicated in the figure. The probes were labeled by nick-translation. The sizes of the RNA species were determined by the use of standards (not shown).

described in Figure 2. A recent report suggests that the DAL8I and DALl genes are very close to one another and may be contiguous (Coornaert et al., 1991). Although this report does not correlate with the recombinational map distance between the dall

and da181 loci, previously determined to be 8 cM (Turoscy et al., 1984), we compared the sequences of the unknown O R F and that of DAL81. There was no resemblance, indicating that the 1.2 kb transcript does not encode the DAL8I product. Moreover, the

918

R. G. BUCKHOLZ AND T. G. COOPER

W.T.

n 3 -I

8

da180

+ n

z o o z o cncr a a a an

cncc

1.5 1.2 1.o

A B C D E Figure 3. Northern blot analysis of polyA' RNA derived from strain M970 (wild type) and M 1081 (du180). Cultures were grown in minimal glucose medium containing 0.1% proline (PRO), or asparagine (ASN) as sole nitrogen source. The presence of 0.25 mM-OXalUrate, the allantoin pathway gratuitous inducer, is indicated +OXLU.

DAL8I transcript is 3.2 kb long. Another possibility was that the 1.2 kb transcript derived from a gene situated between DALI and DAL8I. This explanation, however, would still not explain the lack of correlation between distances determined from physical and recombinational mapping experiments. A third explanation more likely accounts for the differing observations. The DNA used to generate the recombinant plasmids by which the DAL81 gene was originally cloned (Bricmont and Cooper, 1989) and used in the present work is different from that subsequently used by Coornaert et al. (1991) in their studies. Moreover, during genetic mapping experiments we conducted with mutations in the da181 and da13 loci in differing genetic backgrounds, we obtained data that are consistent with those expected if Z1278b-related strains contain an

inversion in this area of chromosome IX (R. Rai and T. G. Cooper, unpublished observations). Sequence motifs in the DALl gene and itsflanking regions The DALI expression characteristics depicted in Figure 3 are similar to those previously reported for DAL2 and DAL3 gene expression (Yo0 and Cooper, 1991b,c). Since expression is independent of inducer, a sequence similar to the DAL7 UIS sequence, shown to be responsible for response to the allantoin pathway inducer, would not be expected; none was found. On the other hand, DALl expression is sensitive to nitrogen catabolite repression leading to the expectation that multiple sequences with homology to the DAL UAS,, should be situated in the 5' flanking sequences. Five such sequences were found and are underlined in Figure 4.All of the above sequences were situated upstream of TATA sequences at positions -56 and -39, relative to the start of translation, respectively. The deduced DALl peptide sequence exhibited significant homology to the dihydroorotase (DHOase) domain of a gene family encoding multifunctional proteins that participate in pyrimidine and arginine biosynthesis (Figure 5). Included in this family are the mammalian CAD gene (carbamoylphosphate synthase [GATase + CPSase] aspartate transcarbamoylase [ATCase] - DHOase), and the Dictyostelium PRYI-3 and Drosophila rudimentary genes (Freund and Jarry, 1987; Simmer et al., 1990; Faure et al., 1989). The domain organization of the latter two genes is glutamine amido transferase [GATase]- carbamoyl phosphate synthetase [CPSase] - DHOase - ATCase. Greatest identity was observed in a 48 amino acid region beginning at DALl residue 62. Significant similarity of residues extended for another 52 amino acids (Figure 5). The DHOase amino acid sequences from the three above sources also contained additional homologies throughout their structures that were not shared by yeast allantoinase. The homologous amino acids observed in yeast allantoinase (DALI) and the DHOases are potential candidates for the residues that participate in substrate binding. Consistent with this suggestion is a strong structural similarity shared by the substrates of allantoinase and DHOase, allantoin and N-carbamyl-aspartate, respectively (Figure 5). When DALl sequences were compared to the E. coli and yeast DHOases @yrC and URAB), less homology was observed. However, significant overall similarity was still observed between sequences

-

919

ALLANTOINASE GENE IN YEAST

DAL4

10*

50*

30*

70*

C T G C A T G T T T C G A T T C T A T T G T C C C T T A C n ; C G A A T C A T C T

90*

110*

130*

150*

TTAGCAGGCGAAGTGGTTCTGCGGTGCTTAATTATCTATATAGAGG3iGGCATATCTCATC~CAAT~

170*

190*

210*

230*

TGAGGTAACGCAAAAGTGATGAGTTTCTACTGGTATCT~TAAT~TACCCCTTTTTCTTTT~TATCTTTAAT 250*

270*

290*

TAGGTTAGAAAAGTGTATATTTCGCAAAAACGX-TGUATACTGCGAAGAACAAAG

330*

350*

310* ATG CCT Met P r o

370*

ATC AAT GCC ATC ACT TCC GAC CAT GTC ATT ATC AAT GGT GCA AAT AAA CCT GCG ACT ATT I l e A s n Ala Ile T h r Ser A s p His V a l I l e Ile Asn G l y Ala Asn L y s P ro Ala Thr Ile

390*

410*

430*

GTG TAT TCG ACC GAA TCA GGC ACG ATT CTG GAT GTT TTA GAA GGC TCC GTG GTT ATG GAG V a l T y r Ser T h r G l u Ser G l y T h r I l e L e u A s p V a l Leu G l u G l y Ser V a l V a l Met G l u

450*

470*

490*

AAA ACT GAG ATA ACC AAA TAT GAA ATA CAT ACG CTG GAG AAC GTA TCT CCA TGT ACA ATT L y s T h r G l u I l e T h r L y s T y r G l u Ile His Thr Leu G l u Asn V a l Ser P r o C y s Thr I l e

510* 530* 550* CTG CCT GGA CTT GTG GAC TCT CAT GTT CAC TTG AAC GAG CCC GGT AGG ACT AGC TGG GAA L e u P r o G l y L e u V a l Asp Ser His V a l His Leu A s n G l u Pro G l y Arg T h r Ser T r p G l u 570*

590*

610*

GGA TTC GAA ACT GGA ACT CAA GCT GCT ATT AGT GGC GGG GTC ACA ACG GTG GTT GAT ATG G l y Phe G l u Thr G l y Thr G l n Ala Ala I l e S e r G l y G l y V a l Thr T h r V a l V a l Asp Met

630*

650*

670*

CCG CTA AAT GCT ATT CCT CCC ACA ACA AAT GTG GAG AAT TTC CGA ATT AAA TTG GAA GCT P r o L e u Asn Ala I l e P r o Pro Thr Thr A s n V a l G l u Asn Phe Arg I l e L y s Leu G l u Ala

690*

710*

730*

GCT GAG GGC CAA ATG TGG TGC GAT GTT GGG TTT TGG GGT GGA CTG GTA CCA CAC AAC TTG Ala G l u G l y G l n Met T r p C y s Asp V a l G l y Phe T r p G l y G l y L e u V a l P r o His Asn Leu

750*

770*

790*

CCA GAC TTA ATT CCG CTT GTC AAA GCT GGC GTT CGC GGG TTC AAA GGA TTC TTG CTT GAT P r o A s p Leu I l e Pro L e u V a l L y s Ala G l y V a l Arg G l y Phe L y s G l y Phe Leu L e u Asp

810*

830*

850*

TCT GGT GTG GAA GAA TTC CCT CCA ATT GGC AAA GAA TAT ATA GAA GAA GCC TTG AAG GTC Ser G l y V a l G l u G l u Phe Pro P r o I l e G l y L y s G l u T y r Ile G l u G l u Ala Leu L y s V a l

870* 890* 910* TTA GCC GAG GAG GAT ACC ATG ATG ATG TTT CAT GCT GAG TTG CCC AAG GCA CAT GAG GAC L e u A l a G l u G l u A s p Thr Met Met Met Phe His Ala G l u Leu Pro L y s Ala His G l u Asp

930*

950*

970*

CAA CAG CAA CCC GAG CAA AGC CAT CGT GAA TAT TCT TCG TTT TTG TCC TCG AGG CCG GAT G l n G l n G l n Pro G l u G l n Ser His Arg G l u T y r S e t Ser P h e Leu Ser Ser Arg P r o A s p

990*

1010*

1030*

TCT TTC GAA ATA GAC GCC ATC AAT TTG ATT CTC GAA TGC TTG AGA GCC AGA AAT GGA CCA Ser Phe G l u I l e A s p Ala I l e Asn L e u I l e Leu G l u C y s Leu Arg Ala Arg A m G l y Pro

Figure 4. Nucleotide sequence of the DALI gene and its flanking sequences. The TATA sequences are boldly underlined, while those with homology to UAS,,, are underlined with a finer line. Sequences with homology to the consensus ARS sequence are bracketed near the end of the DALI coding region. Accession number:

920

R. G. BUCKHOLZ AND T. G. COOPER

1050* 1070* 1090* GTT CCT CCT GTA CAT ATA GTT CAT CTG GCA TCA ATG AAA GCA ATT CCC TTG ATC AGA AAG Val P r o P r o Val H i s Ile Val His Leu Ala S i r Mot Lys Ala 11. P r o Leu Ile Arg Lys 1110*

1130*

1150*

GCA CGT GCG TCA GGG CTA CCA GTC ACA ACA GAG ACT TGT TTC CAC TAT TTG TGT ATT GCT

Ala Arg Ala S e t Gly Leu P r o Val Thr Thr Glu Thr Cys P h e H i s Tyr Leu Cys 11.

Ala

1170* 1190* 1210* GAG CAG ATC CCA GAC GGA GCC ACC TAC TTT AAA TGT TGT CCA CCC ATC CGC TCT GAG Ala Glu Gln Ile P r o Asp Gly Ala Thr T y r P h e Lys Cys Cys P r o P r o Ile Arg Ser Glu GCA

1230* 1250* 1270* TCT AAT CGC CAA GGC CTA TGG GAC GCT TTG CGT GAA GGT GTT ATA GGC TCA GTA GTG AGC S e r Asn Arg Gln Gly Leu Trp Asp Ala Leu Arg Glu Gly Val Ile Gly S e r Val Val S i r 1290* 1310* 1330* GAC CAT TCG CCA TGC ACC CCT GAG TTG AAG Mc TTG CAA AAA GGT GAC TTT TTC GAT TCT Asp His Ser P r o Cys Thr P r o Glu Leu Lys Asn Leu Gln Lys Gly Asp P h e P h e Asp S e r 1350* 1370: 1390* 1 TGG GGA GGA ATC GCT TCC GTC GGA CTA GGT TTG CCA TTG ATG TTT ACC CAA GGC TGC TCT Trp Gly Gly Ile Ala Ser Val Gly Leu Gly Leu P r o Leu Met P h e Thr Gln Gly Cys S e r 1410* 1430* 1450* TTG GTC GAT ATC GTT ACA TGG TGC TGT AAA AAT ACA TCC CAT CAG GTA GGA CTA TCT CAC Leu Val Asp Ile Val Thr Trp Cys Cys Lys Asn Thr S e t His Gln Val Gly Leu S e r H i s 1470* 1490* 1510* CAA AAA GGC ACT ATA GCT CCC GGG TAC GAT GCT GAT TTG GTG GTA TTT GAT ACT GCA AGE Gln Lys Gly Thr Ile Ala P r o Gly Tyr Asp Ala Asp Leu Val Val P h e Asp Thr Ala Ser 1530*

1550*

1570*

AAA CAT AAA ATA AGT AAT TCA ACT GTC TAC TTC AAA AAC AAA TTG ACT GCC TAC AAC GGG

Lys His Lys Ile Ser Asn Ser S i r Val T y r P h e Lys Ann Lys Leu Thr Ala T y r Asn Gly 1590* 1610* 1630* ATG ACG GTC AAG GGC ACA GTT TTG AAA ACC ATA TTA AGA GGC CAG TGG TAT ATA CGA ATG Met Thr Val Lys Gly Thr Val Leu Lys Thr Ile Leu Arg Gly Gln Trp T y r Ile Arg h t 1650* 1670* 1690* t i CCA ACG GAG TCT CGA AAA CAC CAT TGG GTC AAA CTT TGC TTG ATT CTA GAC GTT AAA CTA P r o Thr Glu S e r Arg Lys His H i s Trp Val Lys Leu Cys Leu Ile Leu Asp Val Lys Leu 1710* 1730* 1750* AAG TTG CAA ATT TTT ATT AAA GAA ATT CTA TACAAATAAMCAMCAAATTTATAAAAACTTATTATTTACA Lys Leu Gln Ile P h e Ile Lys Glu 11. Leu *** *** 1770* 1790* 1810* 1830* CACATACATATATTAACCACTCTTAGTTTTGAGAT~TTTTAATGATCTACAATATATCCATC~TCTCCAC 1850* 1870* 1890* 1910* GGCTGCAATTTTGUATTTTCTTAGCGCT~TCTAAC~TTATACCTCAWTCATCGAA 1930* 1950* 1970* 1990* TGCATCTAATACAGGTATAAC-T-TTACAGGGAAG ATG GCT GGA AAT Met Ala Gly Ann

Figure 4. Continued

92 1

ALLANTOINASE GENE IN YEAST

2010* 2030* 2050' GCA AAC TCA GTA GAC GAG GAA GTT ACC AGG ATA TTA GGA GGC ATA TAT CTT GGC GGA ATC Ala Ann Ser Val Asp Glu Glu Val Thr Arg Ile L8u Gly Gly Ile Tyr Leu Gly Gly 110 2070* 2090* 2110* CGT CCA ATT ATT GAC CAC AGA CCA TTG GGT GCA GAA TTT AAC ATT ACT CAT ATT CTT TCT Arg Pro 110 Ile Asp H i s Arg Pro Leu Gly Ala Glu Phe Asn Ile Thr H i s Ile Leu Ser 2130* 2150* 2110* GTT ATC AAA TTC CAG GTC ATT CCA GAG TAT CTA ATA AGG AAA GGT TAC ACG CTA AAA AAC Val Ile Lys Phe Gln Val Ile Pro Glu Tyr Leu Ile Arg Lys Gly Tyr Thr Leu Lys Asn 2190* 2210* 2230* ATA CCC ATC GAT GAT GAT GTG ACT GAT GTG CTG CAA TAC TTC GAT GAA ACG AAC CGA TTC Ile Pro Ile Asp Asp Asp Val Thr Asp Val Leu Gln Tyr Phe Asp Glu Thr Asn Arg Phe 2250* 2270* 2290* ATT GAT CAA TGC TTG TTC CCC AAT GAA GTT GAG TAT TCG CCC AGA TTA GTA GAT TTC ZAG Ile Asp Gln Cys Leu Phe Pro Asn Glu Val Glu Tyr Ser Pro Arg Leu Val Asp Phe Lys 2310* 2330* 2350* AAG AAA CCA CAA CGT GGT GCT GTT TTT GCT CAT TGT CAA GCA GGA CTC TCG AGA TCT GTA Lys Lys Pro Gln Arg Gly Ala Val Phe Ala His Cys Gln Ala Gly Leu Ser Arg Ser Val 2370* 2390* 2410* ACC TTC ATA GTA GCC TAC CTA ATG TAT CGT TAT GGA TTG TCA CTA TCA ATG GCT ATG CAC Thr Phe Ile Val Ala Tyr Leu Met Tyr Arg Tyr Gly Leu Ser Leu Ser Met Ala Net H i s 2430* 2450* 2470* GCT GTC AAG AGG AAG AAA CCG AGT GTT GAG CCA AAC GAG AAT TTC ATG GAA CAA TTA CAT Ala Val Lys Arg Lys Lys Pro Ser Val Glu Pro Asn Glu Asn Phe Met Glu Gln Leu H i s 2490* 2510* 2530* CTC TTT GAG AAA ATG GGT GGA GAT TTT GTC GAT TTC GAC AAC CCA GCC TAT AAG CAC TGG Leu Phe Glu Lys Met Gly Gly Asp Phe Val Asp Phe Asp Aan Pro Ala Tyr Lys Gln Trp 2550* 2570* AAG CTG AAG CAA TCT ATC ZAG TTA GAT CCA TCG GGC GCG ATT GG Lys Leu Lys Gln Ser Ile Lys Leu Asp Pro Ser Gly Ala Ile

-DAL81

Figure 4. Continued

of the three genes, and DALl residues 4 to 14 in and DHOase encoded by URA4. The arginineFigure 5 were nearly identical to 11 amino acids specific pathway, on the other hand, consists of situated near the N-terminus of the yeast URA4 separate genes CPAI and CPA2 encoding CATase (DHOase) gene product (Guyonvarch et al., 1988). and CPSase, respectively. The structural relationThe diminished homology may derive from the ships we have noted for the yeast allantoinase and fact that the genes in bacteria, yeast and higher DHOase from Dictyostelium and higher eukaryotes organisms are organized differently. In enteric but not yeast and bacteria probably derive from a bacteria such as E. coli and Salmonella, the above combination of the point at which the evolutionary enzyme activities are encoded by separate genes, pathways followed by the various genes separated carA, carB, pyrB and pyrC. In yeast, the situation is and the selection pressures exerted upon them as a more complex. There are two separate pathways: result of functional requirements of the proteins one specific for pyrimidines and another for they encode. arginine. The pyrimidine-specific pathway consists Data from the cloning experiments suggested that of a multifunctional protein containing GATase, an ARS was situated in the 3' region of DALI CPSase and ATCase encoded by the URA2 gene between the BgZII and EcoRI sites. Consistent

o//c"/; H

-

ALLANTOIN

N Carbamyl Aspartate

Figure 5 . Amino acid sequence homology between the DALl protein (allantoinase), the dihydroorotase (DHOase) domain of the mammalian C A D gene (carbamoylphosphate synthase [GATase CPSase] - aspartate transcarbamoylase [ATCase]- DHOase), and the DHOase domain of the D . discoidium PYRI-3 gene. Below the sequence homologies are the structures of the substrates for allantoinase (allantoin) and DHOase (N-carbamyl-aspartate).

+

with these data was the finding of several sequences that were similar to the A R S consensus sequence (ATTTATATTTA) (Kearsey, 1983; Broach et al., 1983). These sequences were ATTGATGTTTA (positions 1370 to 1380), TAAACATAAAATA (positions 1514 to 1525 and GATTCTAGACGTTAAACT (positions 1676 to 1693) (Figure 4). The latter sequence is bisected by digestion with endonuclease XbaI. A second A R S element has been shown to occur between the DAL2 and DCGI genes approximately 5 to 5.5 kb centromere distal to the one described in this work. This observation and the high degree of clustering of the six contiguous genes that participate in allantoin metabolism raise the intriguing possibility that gene duplication may have played an important role in the evolution of these genes. ACKNOWLEDGEMENT This work was supported by NIH grant GM35642. REFERENCES Bossinger, J., Lawther, R. P. and Cooper, T. G. (1974). Nitrogen repression of the allantoin degradative enzymes in Saccharomyces cerevisiae. J. Bacteriol. 118, 821-829. Bricmont, P. A. and Cooper, T. G. (1989). A gene product needed for induction of allantoin system genes in Saccharomyces cerevisiae but not for their transcriptional activation. Mol. Cell. Biol. 9,3869-3877.

Bricmont, P. A., Daugherty, J. R. and Cooper, T. G. (1991). The D A U I gene is required for induced expression of two differently regulated nitrogen catabolic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 11,1161-1 166. Broach, J. R., Li, Y.-Y., Feldman, J., Jayaram, M., Abraham, J., Nasmyth, K. A. and Hicks, J. B. (1983). Localization and sequence analysis of yeast origins of DNA replication. Cold Spring Harbor Symp. Quant. Biol. 47, 1165-1 173. Buckholz, R. G. and Cooper, T. G. (1983). Oxalurate induction of multiple URA3 transcripts in Saccharomyces cerevisiae. Mol. Cell. Biol. 3, 1889-1897. Chisholm, G. and Cooper, T. G. (1982). Isolation and characterization of mutants that produce the allantoin degrading enzymes constitutively in Saccharomyces cerevisiae. Mol. Cell. Biol. 2, 1088-1095. Cooper, T. G. (1982). Nitrogen metabolism in Saccharomyces cerevisiae. In Strathern, J. N., Jones, E. W. and Broach, J. (Eds), The Molecular Biology of the Yeast Saccharomyces cerevisiae: Metabolism and Gene Expression. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 39-99. Cooper, T. G., Ferguson, D., Rai, R. and Bysani, N. (1990). The GLN3 gene product is required for transcriptional activation of allantoin system gene expression in Saccharomyces cerevisiae. J . Bacteriol. 172,101&1018. Cooper, T. G., Gorski, M. and Turoscy, V. (1979). A cluster of three genes responsible for allantoin degradation in Saccharomyces cerevisiae. Genetics 92, 383-396. Cooper, T. G. and Lawther, R. P. (1973). Induction of the allantoin degradative enzymes in Saccharomyces

ALLANTOINASE GENE IN YEAST

cerevisiae by the last intermediate of the pathway. Proc. Natl. Acad. Sci. U S A 70,23462344. Cooper, T. G., Rai, R. and Yoo, H.-S. (1989). Requirement of upstream activation sequence for nitrogen catabolite repression of the allantoin system genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 5440-5444. Coornaert, D., Vissers, S. and Andre, B. (1991). The pleiotropic UGA35 ( D U R L ) regulatory gene of Saccharomyces cerevisiae: cloning, sequence and identity with the D A U I gene. Gene97,163-171. Faure, M., Camonis, J. H. and Jacquet, M. (1989). Molecular characterization of a Dictyostelium discoideum gene encoding a multifunctional enzyme of the pyrimidine pathway. Eur. J . Biochem. 179, 345-3 58. Freund, J. N. and Jarry, B. P. (1987). The rudimentary gene of Drosophila melanogaster encodes four enzymic functions. J . Mol. Biol. 193, 1-13. Genbauffe, F. S. and Cooper, T. G. (1986). Induction and repression of the urea amidolyase gene in Saccharomyces cerevisiae. Mol. Cell Biol. 6,3954-3964. Guyonvarch, A,, Nguyen-Juilleret, M., Hubert, J.-C. and Lacroute, F. (1988). Structure of the Saccharomyces cereirisiae URA4 gene encoding dihydroorotase. Mol. Gen. Genet. 212, 134-141. Hinnen, A., Hicks, J. B. and Cooper, T. G. (1978). Transformation of yeast. Proc. Natl. Acad. Sci. USA 75, 1929-1 933. Kearsey, S. E. (1983). Analysis of sequences conferring autonomous replication in baker’s yeast. EMBO J . 2, 1571-1575. Lawther, R. P., Riemer, E., Chojnacki, B. and Cooper, T. G. (1974). Clustering of the genes for allantoin degradation in Saccharomyces cerevisiae. J . Bacteriol. 119,461468. Luche, R. M., Sumrada, R. and Cooper, T. G. (1990). A cis-acting element present in multiple genes serves as a repressor protein binding site for the yeast CAR1 gene. Mol. Cell. Biol. 10,38843895, Maxam, A. M. and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. U S A 74, 560-564.

923 Nasmyth, K. A. and Reed, S. 1. (1980). Isolation of genes by complementation in yeast: molecular cloning of a cell cycle gene. Proc. Natl. Acad. Sci. USA 77, 21 19-2123. Olive, M. G., Daugherty, J. R. andcooper, T. G. (1991). DAL82, a second gene required for induction of allantoin system gene transcription in Saccharomyces cerevisiae. J . Bacteriol. 173,255-261. Rai, R., Genbauffe, F. S., Lea, H. Z. andcooper, T. G. (1987). Transcriptional regulation of the DAL5 gene in Saccharomyces cerevisiae. J . Bacteriol. 169,352 1-3524. Rai, R., Genbauffe, F. S., Sumrada, R. A. and Cooper, T. G. (1989). Identification of sequences responsible for transcriptional activation of the allantoate permease gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 602-608. Simmer, J. P., Kelly, R. E., Rinker, A. G., Zimmermann, B. H., Scully, J. L., Simmer, J. P. and Evans, D. R. (1990). Mammalian dihydroorotase: nucleotide sequence, peptide sequences and evolution of the dihydroorotase domain of the multifunctional protein CAD. Proc. Natl. Acad. Sci. USA 87, 174-178. Turoscy, V. and Cooper, T. G. (1982). Pleiotropic control of five eukaryotic genes by multiple regulatory elements. J . Bacteriol. 151, 1237-1246. Turoscy, V., Chisholm, G. and Cooper, T. G. (1984). Location of the genes that control induction of the allantoin-degrading enzymes in Saccharomyces cerevisiae. Genetics 108,827-831. Turoscy, V. and Cooper, T. G. (1979). Allantoate transport in Saccharomyces cerevisiae. J . Bacteriol. 140,971-979. Turoscy-Chisholm, V., Lea, H. Z., Rai, R. and Cooper, T. G. (1987). Regulation of allantoate transport in wild-type and mutant strains of Saccharomyces cerevisiae. J . Bacteriol. 169, 1684-1690. Yoo, H.-S. and Cooper, T. G. (1989). The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene’s expression. Mol. Cell. Biol. 9,323 1-3243. Yoo, H.-S., Genbauffe, F. S. and Cooper, T. G. (1985). Identification of the ureidoglycollate hydrolase gene in the D A L gene cluster of Saccharomyces cerevisiae. Mol. Cell. Biol. 5.2279-2288.