Fungal Genetics and Biology 81 (2015) 261–270

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

The actin-related protein Sac1 is required for morphogenesis and cell wall integrity in Candida albicans Bing Zhang a, Qilin Yu a, Chang Jia a, Yuzhou Wang a, Chenpeng Xiao a, Yijie Dong a, Ning Xu a, Lei Wang a,b, Mingchun Li a,⇑ a b

Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, Department of Microbiology, Nankai University, Tianjin, PR China Nankai University, TEDA, Sch Biol Sci & Biotechnol, Tianjin, PR China

a r t i c l e

i n f o

Article history: Received 18 September 2014 Revised 22 December 2014 Accepted 27 December 2014 Available online 6 January 2015 Keywords: Sac1 Phosphatase Actin organization Hyphal development CWI Candida albicans

a b s t r a c t Candida albicans is a common pathogenic fungus and has aroused widespread attention recently. Actin cytoskeleton, an important player in polarized growth, protein secretion and organization of cell shape, displays irreplaceable role in hyphal development and cell integrity. In this study, we demonstrated a homologue of Saccharomyces cerevisiae Sac1, in C. albicans. It is a potential PIP phosphatase with Sac domain which is related to actin organization, hyphal development, biofilm formation and cell wall integrity. Deletion of SAC1 did not lead to insitiol-auxotroph phenotype in C. albicans, but this gene rescued the growth defect of S. cerevisiae sac1D in the insitiol-free medium. Hyphal induction further revealed the deficiency of sac1D/D in hyphal development and biofilm formation. Fluorescence observation and real time PCR (RT-PCR) analysis suggested both actin and the hyphal cell wall protein Hwp1 were overexpressed and mislocated in this mutant. Furthermore, cell wall integrity (CWI) was largely affected by deletion of SAC1, due to the hypersensitivity to cell wall stress, changed content and distribution of chitin in the mutant. As a result, the virulence of sac1D/D was seriously attenuated. Taken together, this study provides evidence that Sac1, as a potential PIP phosphatase, is essential for actin organization, hyphal development, CWI and pathogenicity in C. albicans. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction Candida albicans is a common commensal of our mucosal surfaces and intestinal tracts, usually without pathogenicity. But this pathogenic fungus may lead to serious infections in vulnerable patients (David, 2012; Kadosh and Lopez-Ribot, 2013). Several factors determine the virulence of C. albicans, including morphogenesis, adhesion, biofilm formation and adaptation to host niches (Calderone and Fonzi, 2001). Morphogenesis, also termed as dimorphic switching, in particular, has been noted as the most

Abbreviations: PI, phosphatidylinositol; PIP phosphatase, phosphatidylinositol phosphate phosphatase; PI(3)P, phosphatidylinositol-3-phosphate; PI(4)P, phosphatidylinositol-4-phosphate; PI(3,5)P, phosphatidylinositol-3,5-phosphate; PI(4,5)P, phosphatidylinositol-4,5-phosphate; CWI, cell wall integrity; CFW, calcofluor white; 5-FOA, 5-fluoroorotic acid; FBS, fetal bovine serum; SC, synthetic complete; SD, synthetic drop-out; cAMP, cyclic adenosine monophosphate; GPI, glycosylphoshatidylinositol. ⇑ Corresponding author at: Department of Microbiology, College of Life Science, Nankai University, Tianjin 300071, PR China. Fax: +86 22 23508800. E-mail address: [email protected] (M. Li). http://dx.doi.org/10.1016/j.fgb.2014.12.007 1087-1845/Ó 2015 Elsevier Inc. All rights reserved.

crucial for infection and pathogenesis in this pathogen (Gow et al., 2012). In general, there are three main forms of C. albicans cells, yeast, pseudohypha and hypha. Although the yeast form is considered to be associated with fungal dissemination in host tissues, the hyphal form has been demonstrated to be most invasive. The defect in hyphal formation would impair infection ability of C. albicans, even causing avirulence of this pathogen. It is generally accepted that morphogenetic switching from yeast to hypha is a confusing and complicated program, which is affected by environmental conditions such as temperature, pH and CO2, and is related to specific expression of hypha-related genes and polarized transport of morphogenesis factors (Gow et al., 2012; Inglis et al., 2013; Saville et al., 2003). Especially, many hypha-related proteins would be expressed and localized at specific subcellular positions to coordinate this asymmetric growth. In this process, the actin cytoskeleton, consisted of actin patches and actin cables, displays asymmetric distribution and is responsible for this polarized growth (Akashi et al., 1994; Berman, 2006). Due to the essential role of the actin cytoskeleton in polarized growth, the fungus evolves an elaborate mechanism to maintain the polarity of this

262

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

structure. Many factors, including actin binding proteins (ABPs), signal molecules and ion homeostasis, have been demonstrated to be responsible for the accurate actin organization (Cantiello, 1997; Li et al., 2005). For example, deletion of CDC42 results in disturbance of polarized organization of actin, indicating the actin cytoskeleton is a downstream part of signal transduction in regulating polarized morphogenesis (Brand et al., 2014; Ushinsky et al., 2002). In Saccharomyces cerevisiae, Sac1, an important actin-related protein, was originally discovered as a ‘suppressor of actin’ (Novick et al., 1989). Further studies demonstrated that this protein participates in many cellular processes, such as organization of the actin cytoskeleton, secretory pathway, vacuolar function, ER function and sphingolipid metabolism (Blagoveshchenskaya and Mayinger, 2009; Foti et al., 2001). Deletion of ScSAC1 also results in inositol auxotrophy (Whitters et al., 1993), implying an essential role in inositol metabolism. Furthermore, this protein has the activity of phospholipase and could dephosphorylate PI(3)P, PI(4)P, PI(3,5)P2 in vitro. But its activity of dephosphorylating PI(4)P is likely to be the origin of its functions (Guo et al., 1999; Hsu and Mao, 2013). Coincidently, there are a variety of proteins containing Sac domain, such as ScSac1, ScFig4, ScInp51, AtSac1, hSac1 and rSac1, possessing phospholipase activity (Guo et al., 1999; Rohde et al., 2003). In Arabidopsis, AtSac1 plays crucial roles in cell elongation and cell wall biosynthesis by the regulation of actin cytoskeleton (Zhong et al., 2005). However, in C. albicans, the homolog of ScSac1 and other proteins containing Sac domain remains to be investigated. In this study, we identified a protein containing the Sac domain in C. albicans, also termed as Sac1, and investigated its role in inositol metabolism, morphogenesis and cell wall integrity. This protein was proposed to have potential phospholipase activity similar to ScSac1 and other proteins containing this domain. Although there is no growth differences of sac1D/D on inositol-free medium and synthetic complete medium, SAC1 could rescue inositol auxotrophy of Scsac1D completely, suggesting the functional similarity between Sac1 and ScSac1, at least in inositol metabolism. We further demonstrated Sac1 functions in hyphal development, Hwp1 localization, cell wall integrity (CWI), chitin distribution and consequently attenuated virulence of this pathogen. We speculate that the phenotypes of sac1D/D may be attributed to abnormal localization of actin cytoskeleton, which is associated with changed PI levels. 2. Materials and methods 2.1. Strains and growth conditions All strains used in this study are listed in Table 1. BWP17 was the parental strain and used as the wild-type strain in subsequent experiments. Strains were routinely cultivated in YPD medium (1% yeast extract, 2% peptone, 2% glucose) supplemented with 80 lg/ ml uridine, synthetic complete medium (SC, 0.67% yeast nitrogen base without amino acids, 2% glucose, 0.2% complete amino acid mixture) or synthetic drop-out medium (SD, SC medium without specific ingredients). To obtain the homozygous strain without URA3 gene, the SD medium supplemented with 0.1% 5-fluoroorotic acid (5-FOA) was used for counter-selecting. The media M199, RPMI-1640 (Gibco) and YPD containing 10% (v/v) FBS (fetal bovine serum) were used for morphogenesis analysis. For dot assay experiments, different concentrations of calcofluor white (CFW), Hygromycin B and Congo Red were added into YPD medium, respectively. 2.2. Strains and plasmids construction Primers used in our study are all listed in Table 2.

For generating the reconstituted plasmid pDDB78-SAC1, the SAC1 complementary fragment which was composed of 898 bp promoter region, 1857 bp ORF and 333 bp terminator region was amplified by SAC1-5con and SAC1-3con, digested with Spe I and EcoR I and recombined into the plasmid pDDB78. To construct the sac1::LEU1 cassette for ScSAC1 disruption, a 1036 bp fragment was amplified by Sc.SAC1-5DR and Sc.SAC1-3DR from the wildtype genome of S. cerevisiae (Invitrogen, USA), and then cloned into pGEM-T easy vector (Promega, USA), generating the plasmid TScSAC1. This plasmid was digested with Xba I and HindIII and the fragment containing the LEU1 screening marker from plasmid TLEU was inserted, obtaining the plasmid T-sac1::LEU1. For homology analysis of SAC1 in S. cerevisiae and C. albicans, the C. albicans SAC1 fragment was amplified with the primers CtoS-Sac1-5com and CtoS-Sac1-3com from BWP17 genome, and then cloned into the YE-PPGK1, generating the final plasmid YE-PPGK1-SAC1. To obtain the SAC1-disrupted mutant sac1D/D(NKF301), the sac1::ARG4 cassette was amplified from pRS-ARG4DSpeI with the deletion primers SAC1-5DR and SAC1-3DR and transformed into BWP17. The obtained heterozygous mutant was transformed with the sac1::URA3-dpl200 cassette amplified from pDDB57, generating NKF301. The recombinant strains were confirmed with the detection primers SAC1-5det and SAC1-3det. To obtain the sac1D/D strain without URA3 selectable marker (NKF302), NKF301 was streaked on the SD medium containing 5-FOA. To construct the SAC1 reconstituted strain sac1D/D + SAC1 (NKF303), NKF302 was transformed with the NruI-digested pDDB78-SAC1. To investigate ACT1 expression, BWP17, NKF302 and NKF303 were transformed with BglIIdigested pAU34M-GFP, generating the strains NKF306, NKF307 and NKF308, respectively. For expression analysis of HWP1, the fragment amplified from pHWP1-GFP with primers HG-50 and HG-30 was transformed into BWP17, NKF302 and NKF303, obtaining the strains NKF309, NKF310 and NKF311, respectively. To avoid the effect of URA3 on virulence analysis, BglII-PstI-digested pLUBP (containing URA3 and IRO1) was transformed into BWP17, NKF302 and NKF303 to generate the corresponding strains BWP17⁄, NKF304 and NKF305, with the URA3 gene at its normal genetic loci. To obtain Scsac1D (NKF315), the sac1::LEU1 cassette was amplified from T-sac1::LEU1 with the deletion primers Sc.SAC1-5DR and Sc.SAC1-3DR and transformed into INVSc1. Then the plasmid YEPPGK1-SAC1 was transformed into NKF315 to generate Scsac1D + CaSAC1 (NKF316). 2.3. Filamentous growth assays RPMI-1640 and YPD medium with 10% (v/v) FBS were used for liquid induction of filamentous growth. RPMI-1640 and M199 solid media were used for observation of colony morphology, and YPD containing 10% (v/v) FBS with 1.5% agar was used for invasive growth. For colony morphology observation, all strains were diluted in sterile water to an OD600 of 0.8, then dotted on the corresponding plates and cultured 4–5 days at 30 °C and 37 °C. In invasive growth experiments, the colonies incubated in solid hyphal inducing conditions were washed and vertically sliced, obtaining 0.1 mm slices for microscopic observation. In embedded growth experiments, cells were cultured to exponential phase, washed, mixed in molten YPD semi-solid medium (1% agar) and incubated at 25 °C for 8 days. 2.4. Adhesion and biofilm formation assays The ability of adhesion and biofilm formation on polystyrene surface was performed as follows. Cells were overnight cultured in YPD medium, washed with PBS and resuspended in RPMI1640 medium. The cells were then incubated on 24-well polystyrene microtiter plates at 37 °C for 4 h (adhesion analysis)

263

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270 Table 1 Strains and plasmids used in this study. Strains & plasmids

Genotype

Source

C. albicans strains BWP17 BWP17a NKF301 NKF302 NKF303 NKF304 NKF305 NKF306 NKF307 NKF308 NKF309 NKF310 NKF311

ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG URA3::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::URA3-dpl200 ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl200 ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1:: dpl200, pDDB78-SAC1 URA3::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl200 URA3::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl200, pDDB78-SAC1 ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG, pAU34M-ACT1-GFP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl200, pAU34M-ACT1-GFP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1:: dpl200, pDDB78-SAC1, pAU34M-ACT1-GFP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG, pHWP1-GFP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl 200, pHWP1-GFP ura3D::kimm434/ura3D::kimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG sac1::ARG4/sac1::dpl200, pDDB78-SAC1, pHWP1-GFP

Dana Davis This study This study This study This study This study This study This study This study This study This study This study This study

S. cerevisiae strains INVSc1 NKF315 NKF316

MATa his3D1 leu2 trp1–289 ura3–52 MATa his3D1 trp1–289 ura3–52 sac1::LEU2 MATa his3D1 trp1–289 ura3–52 sac1::LEU2, YE-PPGK1-SAC1

Invitrogen This study This study

Containing ARG4 marker, Ampr Containing URA3 marker, Ampr Containing a 4.9 kb IRO1-URA3 cassette ApR TRP1 HIS1 ApR SAC1 TRP1 HIS1 ApR PPGK1 URA3 ApR LEU1 ApR sac1::LEU1 ApR PPGK1-SAC1 URA3 ApR PACT1-ACT1-GFP URA3

Dana Davis Dana Davis Gerald Fink Dana Davis This study This study This study This study This study Qilin Yu

ApR PHWP1-HWP1-GFP URA3

Qilin Yu

Plasmids pRS-ARG4DSpeI pDDB57 PLUBP pDDB78 pDDB78-SAC1 YE-PPGK1 T-LEU T-sac1::LEU1 YE-PPGK1-SAC1 pAU34 M-ACT1GFP pHWP1-GFP a

Strain that the URA3 gene was reintroduced at its common locus.

Table 2 Primers used in this study. Primer

Sequence (50 –30 )

SAC1-5DR SAC1-3DR SAC1-5det SAC1-3det Sc.SAC1-5DR Sc.SAC1-3DR Sc.SAC1-5det Sc.SAC1-3det SAC1-5con SAC1-3con CtoS-SAC1-5com CtoS-SAC1-3com HG-50 HG-30 SCR1-5RT SCR1-3RT HWP1-5RT HWP1-3RT ECE1-5RT ECE1-3RT ALS3-5RT ALS3-3RT

ACACTATTTTTTCCACTTTCTTTAATCTAACCTTATACGCAACTATACAATTATATAACATTTCCCAGTCACGACGTT CTGATATTGGTTTTGAAAGTGTGATATCATGTAGTGAAGTGATAATAAGTGGTACAGTAAGTGGAATTGTGAGCGGATA TTCTTCTGTAGTTGGTGATT TGAGGGAAGGTGTATATATA TGAATCATCCACAGCTACCAC CAATTCTAGGATCTTGATGAGC CCGAGCCATTGGTCATCTT GTGCACGACTGATTCATAGC GGACTAGTACCACAGTAAGTAAAACAAT CCGGAATTCTAAAGAGAAAAGGTTTGTAT CGGGAGCTCTCTAACCTTATACGCAACTA CCGGAATTCATGAGGGAAGGTGTATATAT AGGAAGCTCTTATTCAAAAGAGATCTTATGATTACTATCAAGAACCATGTGATGATTACCCACAACAATCTAAAGGTGAAGAATTATTC TGTAGAAATAGGAGCGACACTTGAGTAATTGGCAGATGGTTGCATGAGTGGAACTGATTCTAATGTAGTTTTGTACAATTCATCCATAC CTGCTCGTGTACCTGCTGTT CTTCCCTCCAGTGGTTATGCT TGTCTACACTACATTCTGTC AGGAATAGATGGTTGTGAAC CCAAGCACCTACTGTTCC GATACCAGCAACAACAGAAT CTCATTACACCAACCATACA GGATTCTGTGGTTGTAGTAT

or 24 h (biofilm formation analysis). The plates were washed twice to remove non-adhered cells, and then stained with 1% (w/v) crystal violet for 2 min. The stained plates were washed with PBS buffer and photographed. Crystal violet in adhered cells was extracted with 10% (v/v) acetic acid, and OD595 was measured as the evaluation standard of adhesion and biofilm formation (Yu et al., 2012).

many). For actin observation, cells were stained with rhodamine– phalloidin as described previously (Oberholzer et al., 2002). Then the samples were observed and photographed as mentioned above. The GFP-labled Hwp1 was also observed and photographed with the same microscope. 2.6. Measurement of GFP fluorescence

2.5. Fluorescence microscopy To visualize hypha structure, cells were stained with 100 lg/ml CFW and observed with a fluorescence microscope (Leica, Ger-

As mentioned above, cells with GFP-labled ACT1 or HWP1 were grown in liquid YPD medium overnight, washed, then resuspended in RPMI-1640. All strains were adjusted to an OD600 of 0.05, and

264

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

then cultured at 37 °C for 6 h. The fluorescence intensities were determined using a fluorescence microplate reader (excitation wavelength 488 nm, emission wavelength 520 nm, Perkin Elmer, USA). 2.7. Real time PCR (RT-PCR) analysis For RNA extraction, cells were cultured with liquid RPMI-1640 medium as mentioned above. The extraction method of total RNA was performed as described previously (Davis et al., 2000). Total RNA was then used for reverse transcriptional synthesis of cDNA with oligo(dT)-primed RT reagent Kit (Promega, USA). Quantitative RT-PCR analysis for expression of ACT1, HWP1, ECE1, ALS3 was performed using the RealMasterMix (SYBR Green) Kit (TransGen, China). The transcript level was normalized by SCR1 RNA (Guffanti et al., 2006; Singh et al., 2011), which is transcribed by RNA polymerase III. The expression level was analyzed and shown as fold change compared with the wild-type strain. 2.8. Sensitivity to cell wall stresses To test the sensitivity to cell wall stresses, cells were overnight grown in liquid YPD medium, adjusted to an OD600 of 0.1 with sterile water, and spotted on YPD plates containing CFW, Congo Red or Hygromycin B. The plates were incubated at 30 °C for 2–4 days and photographed. For detection of cell wall ruggedness, cells were cultured overnight as mentioned above, suspended in sterile water, vortexed with glass beads for 5 min and then centrifuged. In addition, total proteins were extracted as previously mentioned (Yu et al., 2013). Then, the total proteins and released proteins in supernatants after 5 min of vortexing were analyzed by Commassie assays. Finally, the cell wall ruggedness was determined by the value of released proteins relative to the total proteins. 2.9. Chitin content and deposition assays To measure chitin contents of the cell wall, the cells were cultured in YPD medium with or without 5 lg/mL CFW to exponential phase at 30 °C. The harvested cells were washed with PBS buffer and resuspended. The cell suspension was stained with 20 lg/mL CFW and washed several times. The fluorescence intensities of the cells were determined by a fluorescence microplate reader (excitation wavelength 325 nm, emission wavelength 435 nm, Perkin Elmer, USA). To examine the deposition of chitin, the cells were incubated in hyphal induced condition as described previously, stained with CFW as above and observed with a fluorescence microscope (Olympus, Japan). 2.10. Systemic infection of mice and virulence assay To test the infection ability of relevant strains, the protocol was performed as described previously (Yu et al., 2014b). 10 Mice in each group were injected with 5  105 cells which were suspended in 0.9% NaCl solution. The quantity of survival mice was recorded per day for one month. Statistics were performed using the SPSS software (Version 20.0). 3. Results 3.1. Identification of C. albicans Sac1 Sac1 in S. cerevisiae, together with its homologs in mammals and plants, contains a Sac homology domain with phosphoinositide phospholipase activity and two transmembrane helix regions

(Liu et al., 2008; Wei et al., 2003; Zhong et al., 2005). To identify its homolog in C. albicans, we blasted the protein sequence of ScSac1 in C. albicans SC5314 (Assembly 22) genome based on the Candida Genome Database web server (http://www.candidagenome.org) and analyzed the homology domains with online software SMART (http://smart.embl-heidelberg.de). An uncharacterized protein containing 618 amino acids encoded by orf19.4865, termed as Sac1, displays high homology with ScSac1. This protein also contains a Sac domain and two similar transmembrane regions, suggesting conservation property of these proteins in eukaryotic cells. In S. cerevisiae, Sac1 is a phosphoinositide phosphatase and the Scsac1D mutant failed to grow in inositol-free medium. To confirm the function conservation of Sac1, we constructed a plasmid containing C. albicans SAC1 under control of the S. cerevisiae PGK1 promoter, and transformed it into the Scsac1D mutant. Plate streaking was then performed on the SC medium and corresponding inositolfree medium. Expectedly, while the Scsac1D mutant had a defect in growing on the inositol-free medium, the CaSAC1-restored Scsac1D strain had a growth rate similar to the wild-type S. cerevisiae strain (Fig. 1), indicating the function conservation between CaSac1 and ScSac1 in inositol metabolism. Surprisingly, the C. albicans sac1D/ D mutant showed normal growth rate on both synthetic complete medium and inositol-free medium (Fig. 1), implying that this pathogen may have other redundant proteins sharing the function of ScSac1 and maintaining cell growth when SAC1 was deleted. Nevertheless, the rescued growth of the CaSAC1-restored Scsac1D strain suggested that Sac1, similar to ScSac1, is related to inositol metabolism in C. albicans. 3.2. Sac1 is required for hyphal development, invasive and embedded growth In C. albicans, morphogenetic processes, such as hyphal development, invasive growth and biofilm formation, are closely associated with its virulence. To elucidate the role of SAC1 in morphogenesis, we performed filamentous growth assays under different hypha-inducing conditions. In liquid RPMI-1640 medium, the wild-type and reconstituted strains formed regular hyphae after 3 h of culturing, and maintained hyphal growth even after 28 h of incubation. In contrast, the mutant remained yeast-like or germ tube-like cells and had a defect in hyphal elongation in the tested time (Fig. 2A). Similarly, in the liquid serum-containing medium, the mutant showed yeast-like cells after 1 h of incubation, while the wild-type and reconstituted strains formed short germ tube. After 2 or 3 h, the control strains developed regular hyphae. In contrast, the mutant only exhibited short filamentous cells (Fig. S1). These results suggested that SAC1 is responsible for cell germination and hyphal elongation. Moreover, the mutant had a defect in filamentation on solid media, including RPMI-1640 and M199 media, only forming smooth and edge-clear colonies (Fig. 2B). In addition, whereas the control strains exhibited filamentous growth and invaded extensively the agar substrate, the invasion ability was largely impaired in the mutant (Fig. 2C). Consistently, the yeast-to-hypha transition of the mutant was largely attenuated in embedded conditions (Fig. 2D). 3.3. The sac1D/D mutant is defective in adhesion and biofilm formation As a kind of organized sessile communities encased in extracellular matrix, biofilms enhanced the ability of C. albicans to resist to drugs and mechanical treatments. Biofilm formation is initiated by adhesion of fungal cells to the host surfaces, followed by hyphal development and production of extracellular matrix material

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

265

Fig. 1. Sac1 is related to inositol metabolism. Overnight cultures of cells were cultured to the exponential phase in YPD, washed with sterile water and equally streaked on insitol free synthetic medium ( insitol) and synthetic complete medium (+ insitol). Then the plates were cultured at 30 °C for 3 days. The letters a–f represent different strains of Candida albicans (Ca) or Saccharomyces cerevisiae (Sc). (a) INVSc1 (ScWT), (b) NKF315 (Scsac1D), (c) NKF316 (Scsac1D + CaSAC1), (d) BWP17 (CaWT), (e) NKF301 (Casac1D/D), and (f) NKF303 (Casac1D + CaSAC1).

(Garcia-Sanchez et al., 2004; Nobile et al., 2012). To explore the potential role of Sac1 in adhesion and biofilm formation, all strains were cultured in RPMI-1640 in vitro on 24-well polystyrene microtiter plates. After 4 h of incubation, much less sac1D/D cells adhered to the polystyrene plates than control cells (Fig. S2), indicating that disruption of SAC1 had a severe impact on adhesion ability of this pathogen. Scanning electron microscopy further showed that the control strains intertwined and formed thick biofilms after 24 h of incubation. However, the mutant failed to form biofilms, with scarce cells adhering to the polystyrene plate surface. Crystal violet staining further revealed that the biomass levels of the mutant were only half of those of the control strains (Fig. 2E). 3.4. Sac1 is required for polarized organization of actin cytoskeleton during hyphal development In C. albicans, actin organization is important for establishment of polarity which plays decisive role in germ tube formation and hyphal elongation. Due to the putative role of Sac1 in regulation of actin organization, we hypothesized that the defect in cell germination and hyphal elongation of the mutant is attributed to abnormal organization of actin cytoskeleton. As is expected, majority of actin clustered at the hyphal apex and distributed in a regular pattern in wild-type and reconstituted strains, and only a few of actin scattered at the inner surface of the cell wall or in the cytoplasm. In contrast, there was no regular pattern of actin distribution in the mutant. The actin almost randomly distributed throughout the stubby hyphal cells without polarized accumulation (Fig. 3A). This pattern is certainly an unexceptionable interpretation of highly swollen hyphal cells formation of the mutant. Interestingly, RT-PCR analysis and Act1-GFP fluorescence detection revealed that the expression levels of ACT1 of the sac1D/D mutant amounted 3 folds of the control hyphae (Figs. 3B, S3), further confirming a close link between Sac1 and actin dynamics.

3.5. Sac1 is required for polarized localization of Hwp1 Hwp1, a hypha-specific protein, is localized at the cell wall, the hyphal tip and the septum of hyphal cells, and its transport depends on the actin-mediated secretory pathway. Hence we examined distribution of GFP-labeled Hwp1 by fluorescence analysis at hyphal inducing conditions. As anticipated, this protein randomly distributed throughout the whole cell rather than on the cell surface and septum in the sac1D/D cells (Fig. 4A). These results suggested that the failed orientation of Hwp1 may be related to the defect of hyphal development in the mutant. 3.6. Deletion of SAC1 leads to up-regulation of hypha-related genes We then investigated whether the defect of hyphal development in the sac1D/D cells is associated with decreased expression of hypha-related genes, besides abnormal localization of Hwp1. Interestingly, RT-PCR analysis revealed that all of the tested hypha-related genes, including HWP1, ECE1 and ALS3, were remarkably up-regulated in the sac1D/D cells as compared to the control cells (Fig. 4B). Hwp1-GFP fluorescence detection also demonstrated significant increase of Hwp1 expression in the mutant (Fig. S4). Therefore, deceased expression of hypha-related genes is not responsible for the failure of hyphal development in the sac1D/D mutant. 3.7. Disruption of SAC1 results in defect in CWI As reported previously, yeast division and filamentous growth largely depend on cell wall expansion and reassembly (BartnickiGarcia et al., 2000; Smits et al., 2001). To investigate whether Sac1 is associated with CWI, we first tested the sensitivity of the mutant to the cell wall stress agents CFW, Congo Red and Hygromycin B. The mutant exhibited severe growth defect in tolerance to these agents, and this defect was reversed by reconstitution of

266

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

Fig. 2. The sac1D/D mutant is defective in hyphal development and biofilm formation. (A) The wild-type, sac1D/D and sac1D/D + SAC1 strains were incubated in liquid RPMI1640 medium at 37 °C for indicated time. Cultures were sampled at certain intervals, stained with CFW and observed with a fluorescence microscope. (B) Strains were spotted on solid RPMI-1640, M199 medium equally, and incubated at 37 °C for 4 days. (C) Invasive growth. Cells were dotted on solid YPD + 10% (v/v) serum medium (1.5% agar). The colonies were washed, sliced vertically and photographed. (D) Embedded growth. Cells were cultured to the exponential phase, washed, mixed in molten YPD semi-solid medium (1% agar) and incubated at 25 °C for 8 days. (E) Cells were cultured in RPMI-1640 on polystyrene plates at 37 °C for 24 h. Polystyrene plates were washed to remove non-adhered cells and photographed by SEM (left). Crystal violet in adhered cells was extracted with 10% (v/v) acetic acid, and OD595 of the extract was measured (right). ⁄ Significant differences between the mutant and the control strains, P < 0.05.

SAC1 (Fig. 5A), indicating attenuated resistance to chemical cell wall stresses. Furthermore, we tested the resistance of the mutant cell wall to physical vortex stress. The mutant released much more intracellular proteins than the control strains (Fig. 5B), suggesting less integrated cell wall in this mutant. In fungal cells, chitin is one of the most important cell wall components, and its contents increased under certain cell wall stress conditions. Therefore, an increase of chitin contents may imply that the cells are suffered from cell wall stresses. Herein, an obvious increase of chitin contents was observed in the mutant as compared to the control strains, and this increase was pronounced with the addition of CFW (Fig. 5C). The increased chitin contents of the mutant implied impaired CWI. When chitin distribution was observed, we found chitin abundantly deposited at the septum and hyphal tips in the control cells, forming chitin ring and chitin spots on the hyphae. Interestingly, in the sac1D/D cells, chitin

appeared not only at the septum and hyphal tips, but also deposited at the laterals (Fig. 5D), indicating an alternation of the cell wall structure in this mutant. Therefore, the sac1D/D mutant had a defect in maintenance of CWI. 3.8. Sac1 is required for virulence of C. albicans The ability of hyphal development, biofilm formation and maintenance of CWI are crucial for the virulence of C. albicans (Gow et al., 2012; Staniszewska et al., 2012). Therefore, we explored the effect of SAC1 deletion on C. albicans virulence by the mouse systemic model. As expected, the inoculation of the wild-type and reconstituted strains led to death of all mice within 30 days. Interestingly, all of the mice injected by the mutant survived during this period (Fig. 6). Therefore, deletion of SAC1 severely attenuated the virulence of C. albicans.

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

267

Fig. 3. SAC1 deletion affects actin distribution and ACT1 expression. (A) Overnight cells incubated to hyphal form in RPMI-1640. The cells were washed, fixed with 4% formaldehyde, permeabilized by Triton X-100 and stained by rhodamine–phalloidin. Then actin binding to phalloidin was observed and photographed. Bar = 10 lm. (B) Cells were incubated in RPMI-1640 medium and harvested. RNA was extracted and reverse-transcribed into cDNA. Expression of ACT1 was analyzed by RT-PCR using SCR1 as the normalization gene. ⁄Significant differences between the mutant and the control strains, P < 0.05.

Fig. 4. Deletion of SAC1 affects localization and transcripted levels of HWP1, ECE1 and ALS3. (A) Cells were transformed with the plasmid pHWP1-GFP. The strains were then cultured in RPMI-1640 medium for 6 h to induce hyphae. The localization of Hwp1 was photographed using a fluorescence microscope. Bar = 10 lm. (B) The wild-type, sac1D/ D and the reconstituted strain sac1D/D + SAC1 were incubated in RPMI-1640 medium and harvested. Then RNA was extracted and reverse-transcribed into cDNA. Expression of HWP1, ECE1, ALS3 was analyzed by RT-PCR using SCR1 as the normalization gene. ⁄Significant differences between the mutant and the control strains, P < 0.05.

4. Discussion In eukaryotic cells, Sac1 and most of its homologs contain a characteristic Sac domain and possess PIP phosphatase activity (Hsu and Mao, 2013; Zhong et al., 2005). In S. cerevisiae, Sac1 is required for a variety of cell processes, including organization of actin cytoskeleton, secretory traffic, lipid metabolism and ER ATP transport (Blagoveshchenskaya and Mayinger, 2009; Foti et al., 2001). In this study, we identified homologous Sac1 in the dimorphic fungus, C. albicans, and characterized its functions in morphogenesis, cell wall integrity (CWI) and pathogenicity. In functional homology analysis, the SAC1 deletion strain in C. albicans had similar growth rates with the control, while SAC1 rescued inositol auxotrophy of Scsac1D completely. Given the existence of the Sac domain and identical conserved CX5R (T/S) catalytic motif (Hsu and Mao, 2013), we propose that Sac1 has PIP phosphatase activity and regulates the intracellular PI levels. Herein, we further showed that the sac1D/D mutant had a severe defect in actin organization. Because there is no direct evidence that Sac1 is related to actin organization, we propose that the fluctuation of PI levels plays an important role in bridging the gap. Deletion of SAC1 may hinder processes of certain phosphoinositides turnover, resulting in disturbance of certain PI substrates or products and interruption of signal transduction related to actin

organization. In S. cerevisiae, it has been demonstrated that ScSac1 is the utmost phosphatase in regulating PI(4)P levels and it is also a direct regulator of SAC1 gene expression (Hsu and Mao, 2013; Hughes et al., 2000; Knodler et al., 2008). What is more, previous studies have demonstrated that asymmetry distribution of PI(4,5)P2 is related to actin organization (Shewan et al., 2011; Strahl and Thorner, 2007; Vernay et al., 2012). Coincidentally, the Sac domain-containg protein in Arbidopsis, AtSac1, was found to be a PI(3,5)P2 phosphatase and to affect actin organization (Zhong et al., 2005). Although little is known about the detailed relationship, common properties of Sac1 homologues in PIP phosphatase activity and actin organization are quite notable. Therefore, Sac1 may overlap, at least in part, with ScSac1 at the actin organization, which is likely associated with dephosphorylation in regulating phosphoinositides levels. As for the detailed regulation pattern, various actin regulatory proteins in S. cerevisiae should not be neglected, such as profilin, actin depolymerizing factors, and a-actinin (Takenawa and Itoh, 2001). Overall, these results suggest that CaSac1 is homologous with ScSac1 in the structure and function, and is required for polarized cortical actin localization. In this study, we found that Sac1 is required for many physiological processes in C. albicans, such as polarized actin organization, morphogenesis, maintenance of CWI and pathogenesis.

268

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

Fig. 5. Disruption of SAC1 results in hypersensitivity to cell wall stresses and abnormal distribution of chitin in C. albicans. (A) Cells were cultured to the exponential phase, washed, adjusted to an OD600 of 0.1, and spotted on YPD plates containing CFW, Congo Red or Hygromycin B. Then the plates were incubated at 30 °C for 2–4 d and photographed. (B) The released proteins after 5 min of votexing and the total proteins were extracted and analyzed by Commassie assays. The relative value was normalized to the total proteins of each strains. ⁄Significant differences between the mutant and the control strains, P < 0.05. (C) Cells were cultured in YPD medium with (dark gray bars) or without (light gray bars) 5 lg/mL CFW to exponential phase at 30 °C. The harvested cells were washed and resuspended with PBS. The cell suspension was stained with 20 lg/mL CFW and washed several times. The fluorescence intensities of the cells were then determined. ⁄Significant differences between the mutant and the control strains, P < 0.05. (D) Cells were incubated in RPMI-1640 for 6 h, stained with CFW and observed. Mislocalization of chitin is indicated by arrowheads. Bar = 10 lm.

Fig. 6. Deletion of SAC1 leads to attenuated virulence in the mouse systemic model. C. albicans cells were cultured to the exponential phase, washed, resuspended in 0.9% NaCl and injected into mice. The survival rate was recorded and analyzed by the SPSS software.

Given the importance of Sac1 as a general phosphatidylinositol phosphate phosphatase, and phosphatidylinositol phosphate is associated with abundant physiological processes, it is reasonable that deletion of SAC1 gene results in a lot of defects in cellular metabolism. We speculate that most of the functions of Sac1 could be indirect and be mediated by phosphatidylinositol phosphate. It has been demonstrated that actin cytoskeleton mediates multiple processes arranging from cell polarity to cell division and hyphal tip growth (Akashi et al., 1994; Caballero-Lima et al., 2013). In this study, the sac1D/D mutant displayed a severe defect in hyphal development, regardless of liquid or solid incubation. We speculate that actin disturbance may contribute to abnormal filamentation. This speculation is emphasized by the fact that the sac1D/D mutant displayed scattered and depolarized actin distribution under hyphal inducing conditions, followed by swollen and shorter hyphae. Because the polarized distribution of actin cytoskeleton serves as the director of polarized site selection and elongation, actin disturbance would lead to disruption of actindependent cellular processes, such as retardative extension of the hyphal tip and cell wall reconstruction. Thus, the defect in hyphal development is inevitable. Together, hyphal development is largely

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

dependent on Sac1-regulated actin organization in C. albicans. Meanwhile, we found that the sac1D/D mutant displayed slower growth rate than the control strains under hypha-inducing conditions (data not shown), suggesting that a growth defect may be also involved in the failure of hyphal development and other morphogenetic processes. Nevertheless, the mutant only formed short hyphae or germ tubes even after 28 h of hypha induction, revealing a direct or indirect role of Sac1 in C. albicans morphogenesis. Hwp1, a cell surface mannoprotein, is covalently linked to cell wall glucan through its glycosylphoshatidylinositol (GPI) anchor. Functional analysis has demonstrated that it is required for hyphal growth and adherence to oral epithelial cells (Ene and Bennett, 2009; Nobile et al., 2006). During hyphal development, the expression of HWP1 is activated by the cyclic AMP (cAMP) signaling pathway. Then, Hwp1 is processed routinely in the ER and transported to the cell surface by the secretory pathway (Yu et al., 2014a). Yet the cellular secretory pathway is largely dependent on bundling and polarization of actin (Karpova et al., 2000). In our studies, the mutant displayed mislocalization of Hwp1, which is likely to be a direct cause of failure in hyphal development. The increased expression of hypha-related genes led us to propose the link between the polarized distribution of Hwp1 and Sac1 functions. However, actin is related to cellular secretory pathway and critical for vesicle oriented trafficking. Thus, actin dysfunction might be the source of mislocalization of Hwp1 in the mutant, which resulted in the defects of hyphal development and biofilm formation. Collectively, the defects of sac1D/D in hyphal formation and adhesion are related to the overexpression and mislocalization of Hwp1, which may be attributed to disrupted organization of actin cytoskeleton. Previous study has demonstrated that actin stabilizer jasplakinolide led to a sustained gradual increase in cAMP levels, resulting in up-regulated expression of HWP1 (Wolyniak and Sundstrom, 2007). Given this contact between expression of HWP1 and actin stability, it is tempting to speculate that high levels of Hwp1 in the mutant may result from a change of actin stability. This is consistent with the previous results in mammalian that actin rearrangements can directly influence gene expression (Kusner et al., 2002). Meanwhile, these results also suggested that expression of hypha-related genes should not account for decreased adhesion and biofilm formation in sac1D/D, since this expression was up-regulated rather than down-regulated in this mutant. The cell wall of C. albicans is a coherent structure, containing several cross-linked components, including glucan, mannoproteins and chitin (Walker et al., 2008). Undoubtedly, CWI is essential for cell viability and complicated mechanisms are responsible for stress response under cell wall stresses. In this study, the mutant displayed hypersensitivity to chemical and physical stresses and increased chitin contents. We proposed that this is a result of disrupted CWI, which in turn activates the CWI pathway, resulting in increased chitin synthesis (Heilmann et al., 2013; Walker et al., 2008). As is reported previously, chitin synthesis is enhanced by chitin synthases in response to cell wall stress to reinforce the cell wall, which confers to a self-defense mechanism and is required for cell survival (Lenardon et al., 2010; Sorgo et al., 2011; Walker et al., 2008). This has been demonstrated in many actin patch mutants of S. cerevisiae, such as act1-1 and sla1D (Utsugi et al., 2002). Because activation of the CWI pathway derived from severe cell wall damage in response to SAC1 deletion, we propose that this may be also related to the actin dysfunction and the resulting abnormal secretion pathway. Another possibility resulting in activation of the CWI pathway might stem from intracellular change of the PI levels. A recent study in S. cerevisiae has demonstrated that fluctuation of PI(4,5)P2 is related to abnormal activation of the CWI pathway (Guillas et al., 2013). Inp51, which also contains Sac domain and possesses phosphatase activity, provides potent foundation for

269

the inference (Badrane et al., 2008). Thus, disruption of CWI and abnormal activation of the CWI pathway may be linked to actin dysfunction and change of PI levels in SAC1 mutant, although the details are still uncertain. Taken together, our studies demonstrated that Sac1 plays an important role in CWI maintenance, and deletion of SAC1 activates the CWI pathway due to dysfunction of actin cytoskeleton and a consequent defect in CWI. Deletion of SAC1 also caused attenuated virulence of C. albicans in the mouse model. We speculate that the defects in hyphal development, biofilm formation and CWI caused by deletion of SAC1 cooperatively contribute to this attenuation. Due to these defects, the mutant could not effectively adhere to and invade the mouse tissue, resulting in avirulence of this strain. In conclusion, our studies demonstrated that the potential PIP phosphatase Sac1 in C. albicans is required for actin organization, hyphal development, biofilm formation, CWI maintenance and infection. The connection between the phosphoinositide pathway and actin organization was confirmed again, although the detailed information is still unclear. Further studies will provide more evidence and reveal the detailed relation among these cellular processes. Acknowledgments We thank Dana Davis (University of Minnesota, USA) and Gerald Fink (Whitehead Institute for Biomedical Research, MIT, USA) for generously providing strains and plasmids. This work was supported by National Natural Science Foundation of China (Nos. 81471923 and 31400132), Natural Science Foundation of Tianjin (13JCYBJC20700), China Postdoctoral Science Foundation (2014M560180) and the Fundamental Research Funds for the Central Universities.

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2014.12.007. References Akashi, T. et al., 1994. The role of the cytoskeleton in the polarized growth of the germ tube in Candida albicans. Microbiology 140 (Pt 2), 271–280. Badrane, H. et al., 2008. The Candida albicans phosphatase Inp51p interacts with the EH domain protein Irs4p, regulates phosphatidylinositol-4,5-bisphosphate levels and influences hyphal formation, the cell integrity pathway and virulence. Microbiology 154, 3296–3308. Bartnicki-Garcia, S. et al., 2000. Mapping the growth of fungal hyphae: orthogonal cell wall expansion during tip growth and the role of turgor. Biophys. J. 79, 2382–2390. Berman, J., 2006. Morphogenesis and cell cycle progression in Candida albicans. Curr. Opin. Microbiol. 9, 595–601. Blagoveshchenskaya, A., Mayinger, P., 2009. SAC1 lipid phosphatase and growth control of the secretory pathway. Mol. BioSyst. 5, 36–42. Brand, A.C. et al., 2014. Cdc42 GTPase dynamics control directional growth responses. Proc. Natl. Acad. Sci. USA 111, 811–816. Caballero-Lima, D. et al., 2013. The spatial distribution of the exocyst and actin cortical patches is sufficient to organize hyphal tip growth. Eukaryot. Cell 12, 998–1008. Calderone, R.A., Fonzi, W.A., 2001. Virulence factors of Candida albicans. Trends Microbiol. 9, 327–335. Cantiello, H.F., 1997. Role of actin filament organization in cell volume and ion channel regulation. J. Exp. Zool. 279, 425–435. David, R., 2012. Fungal pathogenesis: C. albicans makes an entrance. Nat. Rev. Microbiol. 10, 672. Davis, D., Wilson, R.B., Mitchell, A.P., 2000. RIM101-dependent and -independent pathways govern pH responses in Candida albicans. Mol. Cell. Biol. 20, 971–978. Ene, I.V., Bennett, R.J., 2009. Hwp1 and related adhesins contribute to both mating and biofilm formation in Candida albicans. Eukaryot. Cell 8, 1909–1913. Foti, M. et al., 2001. Sac1 lipid phosphatase and Stt4 phosphatidylinositol 4-kinase regulate a pool of phosphatidylinositol 4-phosphate that functions in the control of the actin cytoskeleton and vacuole morphology. Mol. Biol. Cell 12, 2396–2411.

270

B. Zhang et al. / Fungal Genetics and Biology 81 (2015) 261–270

Garcia-Sanchez, S. et al., 2004. Candida albicans biofilms: a developmental state associated with specific and stable gene expression patterns. Eukaryot. Cell 3, 536–545. Gow, N.A. et al., 2012. Candida albicans morphogenesis and host defence. Discriminating invasion from colonization. Nat. Rev. Microbiol. 10, 112–122. Guffanti, E. et al., 2006. A minimal promoter for TFIIIC-dependent in vitro transcription of snoRNA and tRNA genes by RNA polymerase III. J. Biol. Chem. 281, 23945–23957. Guillas, I. et al., 2013. Phosphatidylinositol 4,5-bisphosphate is required for invasive growth in Saccharomyces cerevisiae. J. Cell Sci. 126, 3602–3614. Guo, S. et al., 1999. SAC1-like domains of yeast SAC1, INP52, and INP53 and of human synaptojanin encode polyphosphoinositide phosphatases. J. Biol. Chem. 274, 12990–12995. Heilmann, C.J. et al., 2013. Surface stress induces a conserved cell wall stress response in the pathogenic fungus Candida albicans. Eukaryot. Cell 12, 254–264. Hsu, F., Mao, Y., 2013. The Sac domain-containing phosphoinositide phosphatases: structure, function, and disease. Front Biol. (Beijing) 8, 395–407. Hughes, W.E. et al., 2000. Sac phosphatase domain proteins. Biochem. J. 350 (Pt 2), 337–352. Inglis, D.O. et al., 2013. Improved gene ontology annotation for biofilm formation, filamentous growth, and phenotypic switching in Candida albicans. Eukaryot. Cell 12, 101–108. Kadosh, D., Lopez-Ribot, J.L., 2013. Candida albicans: adapting to succeed. Cell Host Microbe 14, 483–485. Karpova, T.S. et al., 2000. Role of actin and Myo2p in polarized secretion and growth of Saccharomyces cerevisiae. Mol. Biol. Cell 11, 1727–1737. Knodler, A. et al., 2008. Expression of yeast lipid phosphatase Sac1p is regulated by phosphatidylinositol-4-phosphate. BMC Mol. Biol. 9, 16. Kusner, D.J. et al., 2002. Regulation of phospholipase D activity by actin. Actin exerts bidirectional modulation of Mammalian phospholipase D activity in a polymerization-dependent, isoform-specific manner. J. Biol. Chem. 277, 50683–50692. Lenardon, M.D. et al., 2010. Chitin synthesis and fungal pathogenesis. Curr. Opin. Microbiol. 13, 416–423. Li, C.R. et al., 2005. The formin family protein CaBni1p has a role in cell polarity control during both yeast and hyphal growth in Candida albicans. J. Cell Sci. 118, 2637–2648. Liu, Y. et al., 2008. The Sac1 phosphoinositide phosphatase regulates Golgi membrane morphology and mitotic spindle organization in mammals. Mol. Biol. Cell 19, 3080–3096. Nobile, C.J. et al., 2006. Function of Candida albicans adhesin Hwp1 in biofilm formation. Eukaryot. Cell 5, 1604–1610. Nobile, C.J. et al., 2012. A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell 148, 126–138. Novick, P. et al., 1989. Suppressors of yeast actin mutations. Genetics 121, 659–674. Oberholzer, U. et al., 2002. Myosin I is required for hypha formation in Candida albicans. Eukaryot. Cell 1, 213–228. Rohde, H.M. et al., 2003. The human phosphatidylinositol phosphatase SAC1 interacts with the coatomer I complex. J. Biol. Chem. 278, 52689–52699. Saville, S.P. et al., 2003. Engineered control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during infection. Eukaryot. Cell 2, 1053–1060.

Shewan, A. et al., 2011. Phosphoinositides in cell architecture. Cold Spring Harbor Perspect. Biol. 3, a004796. Singh, R.P. et al., 2011. Cap2-HAP complex is a critical transcriptional regulator that has dual but contrasting roles in regulation of iron homeostasis in Candida albicans. J. Biol. Chem. 286, 25154–25170. Smits, G.J. et al., 2001. Differential regulation of cell wall biogenesis during growth and development in yeast. Microbiology 147, 781–794. Sorgo, A.G. et al., 2011. Effects of fluconazole on the secretome, the wall proteome, and wall integrity of the clinical fungus Candida albicans. Eukaryot. Cell 10, 1071–1081. Staniszewska, M. et al., 2012. Virulence factors of Candida albicans. Przegl. Epidemiol. 66, 629–633. Strahl, T., Thorner, J., 2007. Synthesis and function of membrane phosphoinositides in budding yeast, Saccharomyces cerevisiae. Biochim. Biophys. Acta 1771, 353– 404. Takenawa, T., Itoh, T., 2001. Phosphoinositides, key molecules for regulation of actin cytoskeletal organization and membrane traffic from the plasma membrane. Biochim. Biophys. Acta 1533, 190–206. Ushinsky, S.C. et al., 2002. CDC42 is required for polarized growth in human pathogen Candida albicans. Eukaryot. Cell 1, 95–104. Utsugi, T. et al., 2002. Movement of yeast 1,3-beta-glucan synthase is essential for uniform cell wall synthesis. Genes Cells 7, 1–9. Vernay, A. et al., 2012. A steep phosphoinositide bis-phosphate gradient forms during fungal filamentous growth. J. Cell Biol. 198, 711–730. Walker, L.A. et al., 2008. Stimulation of chitin synthesis rescues Candida albicans from echinocandins. PLoS Pathog. 4, e1000040. Wei, H.C. et al., 2003. The Sac1 lipid phosphatase regulates cell shape change and the JNK cascade during dorsal closure in Drosophila. Curr. Biol. 13, 1882–1887. Whitters, E.A. et al., 1993. SAC1p is an integral membrane protein that influences the cellular requirement for phospholipid transfer protein function and inositol in yeast. J. Cell Biol. 122, 79–94. Wolyniak, M.J., Sundstrom, P., 2007. Role of actin cytoskeletal dynamics in activation of the cyclic AMP pathway and HWP1 gene expression in Candida albicans. Eukaryot. Cell 6, 1824–1840. Yu, Q. et al., 2012. Spf1 strongly influences calcium homeostasis, hyphal development, biofilm formation and virulence in Candida albicans. Microbiology 158, 2272–2282. Yu, Q. et al., 2013. The P-type ATPase Spf1 is required for endoplasmic reticulum functions and cell wall integrity in Candida albicans. Int. J. Med. Microbiol. 303, 257–266. Yu, Q. et al., 2014a. Inhibitory effect of verapamil on Candida albicans hyphal development, adhesion and gastrointestinal colonization. FEMS Yeast Res. 14, 633–641. Yu, Q. et al., 2014b. A novel role of the vacuolar calcium channel Yvc1 in stress response, morphogenesis and pathogenicity of Candida albicans. Int. J. Med. Microbiol. 304, 339–350. Zhong, R. et al., 2005. Mutation of SAC1, an Arabidopsis SAC domain phosphoinositide phosphatase, causes alterations in cell morphogenesis, cell wall synthesis, and actin organization. Plant Cell. 17, 1449–1466.