Vol. 12, No. 11

MOLECULAR AND CELLULAR BIOLOGY, Nov. 1992, p. 4937-4945

0270-7306/92/114937-09$02.00/0 Copyright X 1992, American Society for Microbiology

The 70-Kilodalton Adenylyl Cyclase-Associated Protein Is Not Essential for Interaction of Saccharomyces cerevisiae Adenylyl Cyclase with RAS Proteins JUN WANG, NOBORU SUZUKI, AND TOHRU KATAOKA*

Department of Physiology, Kobe University School of Medicine, Kobe 650, Japan Received 15 June 1992/Returned for modification 16 July 1992/Accepted 12 August 1992

In the yeast Saccharomyces cerevisiae, adenylyl cyclase is regulated by RAS proteins. We show here that the yeast adenylyl cyclase forms at least two high-molecular-weight complexes, one with the RAS proteindependent adenyWl cyclase activity and the other with the Mn2+-dependent activity, which are separable by their size difference. The 70-kDa adenylyl cyclase-associated protein (CAP) existed in the former complex but not in the latter. Missense mutations in conserved motifs of the leucine-rich repeats of the catalytic subunit of adenylyl cyclase abolished the RAS-dependent activity, which was accompanied by formation of a very high molecular weight complex having the Mn2+-dependent activity. Contrary to previous results, disruption of the gene encoding CAP did not alter the extent of RAS protein-dependent activation of adenylyl cyclase, while a concominant decrease in the size of the RAS-responsive complex was observed. These results indicate that CAP is not essential for interaction of the yeast adenylyl cyclase with RAS proteins even though it is an inherent component of the RAS-responsive adenylyl cyclase complex.

The ras oncogenes have been identified as the transforming genes of retroviruses, and their physiological function in higher eukaryotes remains to be elucidated (for a review, see reference 3). The yeast Saccharomyces cerevisiae has two RAS genes, RASI and RAS2, whose protein products are structurally, functionally, and biochemically similar to their mammalian counterparts (6, 8, 9, 21, 29, 36, 37). Genetic and biochemical studies demonstrated that the yeast RAS proteins are essential regulatory elements of adenylyl cyclase (6, 39). The S. cerevisiae adenylyl cyclase, a product of the CYRI gene (25), consists of 2,026 amino acid residues that comprise at least four domains: the amino-terminal, the middle repetitive, the catalytic, and the carboxy-terminal domains (20, 43). The catalytic domain, located between amino acid positions 1646 and 1890, retains the Mn2+dependent adenylyl cyclase activity, but the remaining portion appears to be required for activation of the Mg2edependent activity by GTP-bound forms of RAS proteins (7, 17, 20, 34, 43). The middle repetitive region is composed of a repetition of 23-amino-acid leucine-rich motifs which have homology to the leucine-rich repeats family proteins of yeasts, mammals, and Drosophila melanogaster (16, 18, 24, 26, 28, 30, 35, 38). Studies using deletion and insertion mutagenesis showed that the leucine-rich repeats are required for interaction of adenylyl cyclase with RAS proteins (7, 34). The mammalian Ras proteins can activate the S. cerevisiae adenylyl cyclase, but neither the mammalian Ras nor the yeast RAS proteins can regulate the mammalian adenylyl cyclase (4, 6, 9, 21). Even in a lower eukaryote, such as the fission yeast Schizosaccharomyces pombe, adenylyl cyclase is not regulated by RAS proteins (14, 43). These observations suggest that regulatory proteins of adenylyl cyclase have changed during the course of evolution, as has the nature of an effector molecule of RAS proteins. To solve this enigma, it is essential to elucidate the precise mode of interaction between RAS proteins and the yeast

*

Corresponding author. 4937

adenylyl cyclase. Recently, a 70-kDa yeast protein called CAP (cyclase-associated protein), or the SRV2 gene product, was found to be associated with the catalytic subunit of adenylyl cyclase (the CYR1 protein), and the gene encoding it was cloned (10, 13). CAP was proposed to be critical for the RAS protein-dependent adenylyl cyclase activity. CAP appeared to have another function that was required for normal cell morphology and responsiveness to nutrient deprivation and excess (13, 15). We report here the characterization of the RAS protein-responsive adenylyl cyclase. We show that CAP does not appear to be essential for interaction of adenylyl cyclase with RAS proteins. In addition, we used site-specific mutagenesis to examine structural elements in the leucine-rich repeats which are essential for the interaction with RAS proteins. MATERIALS AND METHODS

Cell strains, growth media, and transformation. S. cerevisiae strains TK35-1 (MATct leu2 his3 trpl ura3 cyrl-2 ras2::LEU2) and SP1 (AM Ta leu2 his3 trpl ura3 ade8 canl) have been described elsewhere (21, 34). Disruption of the CAP gene was performed by transformation of an 1.85-kb EcoRI fragment of pHSPN5 (13) into SP1 as described previously (31). Yeast cells were cultured in yeast synthetic medium (6.7 g of yeast nitrogen base per liter, 2% glucose) with appropriate auxotrophic supplements. Transformation into yeast cells was carried out by using lithium acetate (19). Plasmid construction and oligonucleotide-directed mutagenesis. The structure of YEP24-ADCJ-CYRI, which overexpressed the complete wild-type CYRI gene under the yeast alcohol dehydrogenase I (ADCJ) promoter (1), was described elsewhere (34). A HindIII-XbaI fragment (corresponding to amino acid positions 957 to 1540) and a PstI fragment (positions 597 to 1172) of the CYRI gene were cloned into the matched restriction cleavage sites of M13tv18 (Takara Shuzo, Kyoto, Japan). The single-stranded-form DNAs of the clones were subjected to site-directed mutagenesis according to the gapped duplex method (22),

4938

MOL. CELL. BIOL.

WANG ET AL.

TABLE 1. Oligonucleotides used for site-specific mutagenesis Oligonucleotide

Amino acid change

Pro-1080-Gln, Arg, Leu 5'-TAGACTGC(A,G,T)ACAGGAGA-3'................................... 5'-ATCCAAGT(C,G)GACTAAAT-3' ....................................Leu-1086-Ser, Trp Leu-1089--Ser 5'-GACTAAAT(C)AGlT'lCC-3' ................................... 5'-AG'TTTCC(A,C,G)TTCAGTGG-3'....................................Leu-1092His,a Pro, Arg 5'-GGCGAGAA(C,G,T)CAAACTAG-3' ....................................Asn-1097-Thr, Ser, Ilea 5'-AAACAAAC(A,C,G)AGAGTATA-3' ....................................Leu-1099--Gln, Pro, Arga 5'-AATCCAAAGCT1fAGGCGACTITATCGG-3' ................................... Deletion of amino acids 948-970 -1 l'GACTAGACTGCCACCCGAGCITAT31b .Glu-1081-*Pro, Ile-1083-*Leuc a The mutants were not successfully obtained. b Originally intended to introduce a deletion between amino acids 1080 and 1102 but unexpectedly caused the indicated double mutation as a result of a redundancy of the leucine-rich repeat unit sequences. I The mutations were introduced simultaneously.

using appropriate mutagenic oligonucleotides (Table 1). Replicative-form DNAs of the mutated M13 clones were used to reconstruct YEP24-ADCl-CYRI having the corresponding mutations by restriction enzyme cleavage and ligation. The presence of the mutations was confirmed by nucleotide sequencing (5). pGEX-CAP was constructed by cloning the whole coding sequence of the CAP gene (13) into pGEX-2T (32) (Pharmacia, Uppsala, Sweden). This plasmid overexpressed CAP as a fusion protein with Schistosoma japonicum glutathione S-transferase (GST) in Eschenchia coli. Membrane preparation and fractionation of adenylyl cyclase complexes. Yeast cells were disrupted by shaking with glass beads and crude membrane fractions were prepared as described previously (34, 43). Adenylyl cyclase complexes were solubilized by extraction of the membrane fraction with buffer C {50 mM 2-(N-morpholino)ethanesulfonic acid (MES; pH 6.2), 0.1 mM MgCl2, 0.1 mM [ethylenebis(oxyethylenenitrilo)]tetraacetic acid, 1 mM 2-mercaptoethanol} containing 1% Lubrol PX, 0.5 M NaCl, and 0.5 mM phenylmethylsulfonyl fluoride and subsequent centrifugation at 105 x g for 1 h. About 50% of the Mn +-dependent adenylyl cyclase activity residing in the membrane was recovered in the supernatant. A 500-,u aliquot of the supernatant (2 to 4 mg of protein) was applied on a Superose 6 HR 10/30 column (10 mm by 30 cm) (Pharmacia) and fractionated in the same buffer without phenylmethylsulfonyl fluoride, using a highperformance liquid chromatography system (FPLC system; Pharmacia). Fractions of 400 ,ul were collected, and an aliquot of each fraction was assayed for adenylyl cyclase activity as described below. Western immunoblotting and immunoprecipitation. A polyclonal antiserum against CAP was prepared by immunizing rabbits with whole CAP, which was produced as a fusion protein with GST in E. coli harboring plasmid pGEX-CAP and purified by glutathione-agarose chromatography as described previously (32). An antiserum to a segment of the CYR1 product (amino acid positions 335 to 596; antiCYRlHP antiserum) was described previously (43). Both antisera were devoid of antibodies against the fusion partners by repeated absorption with Sepharose beads onto which the respective fusion partner proteins were attached and then further purified by affinity chromatography, using Sepharose beads onto which the respective antigens were covalently attached. CAP and the CYR1 protein were detected by Western immunoblotting as described previously

(40, 43). Adenylyl cyclase complexes were immunoprecipi-

tated in buffer C containing 0.5 M NaCl, 1% Lubrol PX, and 0.04% sodium dodecyl sulfate (SDS) to preserve the cyclase complexes. Protein A-Sepharose (Pharmacia) was used for isolation of the immunoprecipitates.

Adenylyl cyclase assay. Adenylyl cyclase activities were measured under various conditions essentially as described previously (6, 34, 43) except that yeast membranes were pretreated with 1% Lubrol PX-0.5 M NaCl for 1 h at 0°C in 10 ,ul of buffer C containing 10% glycerol and then added to the 90-pl reaction mixture. Where indicated, 2.0 p,g of purified RAS2 protein (6) was preincubated with 5 ,ul of 1 mM guanosine 5'-O-(3-thiotriphosphate) (GTP-yS) or guanosine 5'-O-(2-thiodiphosphate) (GDPIS) and added to the reaction mixture. For column fractions, 40-pl aliquots were used for the assays. The presence of Lubrol PX up to 0.5% and NaCl up to 0.3 M in the reaction mixture had no significant effect on adenylyl cyclase activities. Other methods and materials. Preparation of yeast genomic DNA and Southern blot hybridization were performed as described previously (21, 33). DNA fragments were 32p labeled by the random primer-labeling method (11). Commercial sources of other reagents are provided elsewhere (34, 43). RESULTS Separation of adenylyl cyclase complexes. To examine the molecular structure of the RAS-responsive adenylyl cyclase, we fractionated it by Superose 6 chromatography after solubilization from the membrane fraction of yeast cells harboring the CYR1-overexpressing plasmid YEP24-ADClCYR1. Aliquots of each fraction were assayed for adenylyl cyclase activities under three different conditions, i.e., in the presence of Mn2+, of Mg2+ and GTP-yS, or of Mg2+, GTP-yS, and the purified RAS2 protein (Fig. 1A). Almost all of the Mn2+-dependent and RAS-dependent activities were recovered after chromatography. We found that the peaks of the Mn2+-dependent activity and of the RAS2 protein-dependent activity were separated from each other. The apparent molecular weights were estimated as about 890,000 for the RAS-responsive adenylyl cyclase and about 670,000 for the Mn2+-dependent protein. The sizes were much larger than the observed molecular size (-220 kDa) for the CYR1 product monomer (12, 27, 34, 43), indicating formation of complexes. The complexes were resistant to treatment with 0.04% SDS in addition to 1% Lubrol PX-0.5 M NaCl, and inclusion of protease inhibitors (leupeptin at 10 p,M, pepstatin at 1 p,M, and bestatin at 1 p,M) in the cell lysis and extraction buffer did not affect the elution pattern (data not shown). Also, the sizes of the complexes were not affected by the presence of RAS2 protein in the extract because an essentially similar elution profile was observed when either SP1 (RAS2+) or SP1 harboring a RAS2-overexpressing plasmid was used as a host strain to overexpress the CYR1

ROLE OF CAP IN RAS-ADENYLYL CYCLASE INTERACI1ON

VOL. 12, 1992

A

u

n232k

2000k

669k 440k 158k

>_ 50E 40


20


25

:5

20

.s x

15

3.9kb-

10

2.Okb-' -` 1.8kb-

-

SPI

_.

TK79-1 lkb

10

B

I5

20

25

30

35 Fraction No.

40

45

50

B

2 3k 20 669k 1- 30 100

669k 440k 158k

2 000 k

\\\

lll

vA,

C

Is:,

x

80-

60_




10

250-

20

25

30

35

40

45

50

Fraction No. FIG. 5. Fractionation of adenylyl cyclase complexes from cap cells. A Lubrol PX-0.5 M NaCl extract (2 mg of protein) from TK79-1-1 cells (cap) was chromatographed on a Superose 6 column as described in Materials and Methods. A 40-,ul aliquot of each fraction was assayed for RAS2 protein-dependent adenylyl cyclase activity (A) or Mn2+-dependent activity (El). Molecular size markers were as described in the legend to Fig. 1.

200150 -

,bW 100X~E

15

50-

DISCUSSION 0

0.2

1.0 1.2 0.4 0.6 0.8 RAS2 Protein Added(pg)

1.4

FIG. 4. Activation of the cap adenylyl cyclase by RAS proteins. Crude membrane fractions from cap and CAP' cells harboring plasmid YEP24-ADCl-CYRI were assayed for adenylyl cyclase activity in the presence of Mg2" and increasing concentrations of the yeast RAS2 protein as described in Materials and Methods. (A) Membrane from TK79-1-1 cells (cap) was assayed in the presence of 50 pFM GTPyS (0) or 50 pM GDPOS (A). (B) Membrane from SPl cells (C4P+) harboring YEP24-ADCl-CYRI (strain SPl-1) was assayed in the presence of 50 p,M GTPyS (0) or 50 pM GDPf3S (A).

adenylyl cyclase activity in the presence of Mg2+, GTPyS, and increasing concentrations of the purified RAS2 protein, the adenylyl cyclase in the cap cells could be activated (Fig. 4). The activation was dependent on the presence of GTP-yS, and the relationship between the extent of activation and the concentration of the RAS2 protein was found to be indistinguishable from that of the CAP+ adenylyl cyclase. An identical result was obtained with use of TK79-2-1 (data not shown). The result unequivocally demonstrated that CAP was not essential for interaction of adenylyl cyclase with RAS proteins. We next examined whether CAP was an inherent component of the adenylyl cyclase complexes. A Lubrol PX-0.5 M NaCl extract of TK79-1-1 was fractionated on a Superose 6 column, and the fractions were assayed for adenylyl cyclase activities under the three conditions described above. The molecular size of the complex with RAS protein-dependent activity was reduced from 890 kDa in the CAP+ cells to 610 kDa in the cap cells, while the size of the complex with Mn2'-dependent activity was unchanged at 670 kDa (Fig. 5). The result clearly showed that in the CAP+ cells, almost all of the RAS-dependent adenylyl cyclase formed a complex with CAP but a major population of the Mn2+-dependent adenylyl cyclase remained unbound to CAP. These results supported the finding that almost no CAP was detected at the peak fractions of the Mn2+dependent activity (Fig. 1C).

We have partially purified and characterized the yeast adenylyl cyclase complexes to analyze the structural basis for the interaction with RAS proteins. In the course of purification, we found that the complex bearing the RAS protein-dependent adenylyl cyclase activity was separable from that having the Mn2+-dependent activity by gel exclusion chromatography. The peak of the RAS-responsive activity eluted on the skirt of the Mn2+-dependent peak without any trace of an extra peak of the CYR1 protein and the Mn2+-dependent activity (Fig. 1A and B). The result implies that the RAS-dependent activity resides in a minor complex that is separate from that having the Mn2+-dependent activity. The RAS-dependent complex appears to have much higher specific activity in the presence of RAS proteins than in the presence of Mn2+. Since the yeast adenylyl cyclase is a peripheral membrane protein that can be solubilized with high salt only (27), we assume that the separation reflects a size difference between the two protein complexes, without a significant contribution from the bound detergents or lipids. Thus, the larger molecular size and higher specific activity of the RAS-dependent complex than of the Mn2+-dependent complex suggest that a specific association of other proteins to the Mn +-dependent complex may form a molecular basis for interaction with RAS proteins. The molecular sizes of the complexes were not affected by the presence or absence of RAS2 protein. This result presumably reflects a rather low affinity of RAS proteins to adenylyl cyclase which resulted in dissociation of RAS proteins during extraction and purification of the adenylyl cyclase complexes as reported previously (12). The observed molecular size of the Mn2+-dependent complex was similar to that obtained by other groups using wild-type yeast cells (17) or yeast cells overexpressing the CYRJ gene (12, 27). We next examined the content of CAP in the adenylyl cyclase complexes and found that the Mn2+-dependent complex did not contain CAP at its peak fractions. Although a minor but significant population of the CYR1 protein was bound to CAP at the peak fraction of the RAS-responsive

VOL. 12, 1992

complex,

ROLE OF CAP IN RAS-ADENYLYL CYCLASE INTERACTION

we could not infer the extent of involvement of CAP in it because the RAS-responsive complex may have represented only a fraction of the CYR1 protein in the peak fraction. In addition, we observed that a majority of CAP bound to the CYR1 protein formed another complex whose molecular size appeared to be larger than those of the two active complexes. The result prompted us to examine the effect of disruption of the CAP gene. Plasmid pHSPN5 used for the disruption contained the CAP gene with a deletion of the internal 374 amino acid residues and had been used to create the null allele of the CAP gene (13, 15). The result unexpectedly showed that the cap adenylyl cyclase could be fully activated by RAS proteins in vitro, demonstrating the nonessential role of CAP in the RAS-adenylyl cyclase interaction. A subsequent fractionation of the solubilized cap adenylyl cyclase clearly showed that the size of the RAS-responsive complex was reduced by approximately 280 kDa without degradation of the CYR1 protein. The result indicates that CAP is an inherent component of the RAS-responsive adenylyl cyclase complex. The absence of CAP in the majority of the Mn2+-dependent complex was confirmed by observation that its size was not reduced in the cap cells. The data are contradictory to reports from other groups. Field et al. (12, 13) fractionated the adenylyl cyclase complex by sedimentation through a glycerol gradient and observed no size difference between the Mn2+-dependent and RAS-dependent complexes. Moreover, they observed a comigration of CAP with the activities. We speculate that the single peak that they observed may actually have been a mixture of the three complexes mentioned above, which were not well separated because of the difference in the principles of separation or in resolution power. Mitts et al. (27) fractionated the Mn2+-dependent complex by gel exclusion chromatography and obtained a molecular weight of -600,000, which was similar to our data. However, they did not assay the RAS-dependent activity of the fractions, nor did they detect CAP bound to the CYR1 protein because the immunoprecipitation was done under a very harsh condition. Studies using disruption of the chromosomal CAP (SRV2) gene or its recessive mutant have shown that a loss of CAP function results in a loss of the response of adenylyl cyclase to the activated RAS2 protein both in vivo (10) and in vitro (13). In the cap cells, however, the CYR1 protein was found to be undetectable even when overexpressed (13). This observation raised the possibility that CAP might not be directly involved in the RAS response of the CYR1 protein but have a function to somehow stabilize it. This possibility, too, is incompatible with the data shown in Fig. 3C, where no apparent degradation of the CYR1 protein was observed in the cap cells. The discrepancy may be explained as follows. (i) In the in vitro experiments of other groups, the cap adenylyl cyclase might have been degraded. This possibility is supported by the observation of a quite high Mg2+dependent activity in the absence of RAS proteins and absence of the full-length adenylyl cyclase in cap cells (13). The high Mg2e-dependent activity in the absence of RAS is characteristic of the truncated adenylyl cyclase (20). A possible cause of the degradation might be that the cap cells were cultured too long to survive, since we observed that the cap cells rew slowly, reached saturation at a density of as low as 10 cells per ml, and gradually died out. (ii) The in vivo data which measured the cyclic AMP (cAMP) concentration in the cells might have been influenced by factors, such as intracellular localization of adenylyl cyclase or activities of other components in the cAMP pathway, which

4943

were not directly related to the RAS-cyclase interaction. Also, degradation of adenylyl cyclase in the cap cells may be implicated as described for the in vitro experiments. Studies on the function of CAP have revealed that CAP is a bifunctional protein. Gerst et al. (15) showed that the N-terminal 168 amino acid residues of CAP were required for cellular response to activated RAS protein and the C-terminal 158 residues were required for normal cell morphology and responsiveness to nutrient deprivation and excess. The latter function appeared to be suppressed by overexpression of the profilin gene, suggesting a possible

link between CAP and the cytoskeleton (41). Considering our results, the observed in vivo function of CAP on the RAS-adenylyl cyclase pathway may involve regulation of other factors such as the subcellular localization of adenylyl cyclase than the RAS-adenylyl cyclase interaction. We observed that a vast excess of CAP over that bound to the CYR1 protein existed in all column fractions (Fig. 1E), which suggests that a majority of CAP may form a complex with proteins other than the CYR1 protein or make large

self-aggregates. Our results suggest that three types of adenylyl cyclase complexes exist in yeast cells: a major one with only the Mn2+-dependent activity and no CAP, a minor one with the high RAS-dependent activity and CAP, and a minor one with CAP and no RAS-dependent activity. The intensity of the Mn2+-dependent activity of the latter two complexes could not be estimated because the separation achieved was incomplete. A large difference in apparent molecular size was observed between the CAP' and cap RAS-responsive adenylyl cyclase complexes, which implies that the difference is contributed by CAP and/or other proteins bound to CAP. However, we do not think that the observed size difference between the RAS-responsive complex and the Mn2+-dependent complex in the CAP' cells can be fully explained by the presence and absence of CAP in the respective complex because CAP was found not to be required for the RAS response. Recently, we have identified adenylyl cyclaseassociated proteins which were present only in the RASresponsive complex and different in molecular size from the 70-kDa CAP (42). These proteins might be responsible for the formation of the RAS-responsive adenylyl cyclase complex. The low levels of these proteins may explain why they were not detected as adenylyl cyclase-associated proteins in previous studies (12, 13). Genetic and biochemical studies on the CYR1 protein have shown that the leucine-rich repeats are essential for the activation by RAS proteins (7, 34). All of the two-amino-acid insertions affecting the regular positioning of the consensus residues were found to destroy the response to RAS proteins. In this study, we examined the effect of single-aminoacid substitutions in the consensus amino acid residues of a representative repeat unit. Leucines at positions 10, 13, and 20 of the consensus sequence, PXXaXXLXXLXXLXLXX NXcxXXa, appeared to be unmutable without loss of activation (Table 2). The first proline is also critical but mutable to glutamine without complete loss of the RAS response. In contrast, leucine 7 and asparagine 18 were found to be mutable even though they were as well conserved as the other consensus residues. The data suggest that the consensus sequences themselves, especially the middle three leucines or aliphatic residues, are critical for the activation in addition to their arrangement with the regular spacing. We also examined the effect of an exact deletion of a representative repeat unit and observed a loss of the RAS response, suggesting that all of the repeat units are not

4944

WANG ET AL.

equivalent. When effects of the mutations on the structure of the adenylyl cyclase complexes were examined, the mutant CYR1 proteins were found to form an Mn2+-dependent complex whose molecular weight was considerably greater than that of wild-type Mn2+-dependent complex. These data suggest that a gross change in conformation, presumably involving an alteration of the multimerization state, may have occurred. The result supports the notion presented by us and others that the leucine-rich repeats may form a rigid stereo structure which is essential for a protein-protein interaction (7, 34). The interaction is presumably homophilic in the yeast adenylyl cyclase, and mutations in the leucinerich repeats may induce an aberrant aggregation. In this respect, the leucine-rich repeats might not be directly involved in the interaction with RAS proteins but function to maintain a proper structure of the CYR1 protein which is prerequisite for the interaction with RAS proteins. Finally, even though our work has shown that CAP is not essential for the RAS protein-adenylyl cyclase interaction, it is highly probable that the association of CAP with adenylyl cyclase has other important functional consequences. ACKNOWLEDGMENTS We are grateful to Michael Wigler (Cold Spring Harbor Laboratory) for kindly providing pHSPN5 and the CAP cDNA. We thank Yoshimitsu Nishida for helpful advice, Kayoko Tsujino and Toshinori Minato for producing antibodies, and Akiko Sumi for help in preparation of the manuscript. This work was supported by a grant-in-aid for Scientific Research from the Ministry of Education, Science and Culture of Japan and by research grants from the Naito Foundation, from the Kato Memorial Bioscience Foundation, and from the Yamanouchi Foundation for Research on Metabolic Disorders. REFERENCES 1. Ammerer, G. 1983. Expression of genes in yeast using theADCI promoter. Methods Enzymol. 101:192-201. 2. Andrews, P. 1965. The gel-filtration behaviour of proteins related to their molecular weights over a wide range. Biochem. J. 96:595-606. 3. Barbacid, M. 1987. ras genes. Annu. Rev. Biochem. 56:779827. 4. Beckner, S. K., S. Hattori, and T. Y. Shih. 1985. The ras oncogene product p21 is not a regulatory component of adenylate cyclase. Nature (London) 317:71-72. 5. Biggin, M. D., T. J. Gibson, and G. F. Hong. 1983. Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80:3963-3965. 6. Broek, D., N. Samiy, 0. Fasano, A. Fujiyama, F. Tamanoi, J. Northup, and M. Wigler. 1985. Differential activation of yeast adenylate cyclase by wild-type and mutant RAS proteins. Cell 41:763-769. 7. Colicelli, J., J. Field, R. Ballester, N. Chester, D. Young, and M. Wigler. 1990. Mutational mapping of RAS-responsive domains of the Saccharomyces cerevisiae adenylyl cyclase. Mol. Cell. Biol. 10:2539-2543. 8. Defeo-Jones, D., E. M. Scolnick, R. Kolier, and R. Dhar. 1983. ras-related gene sequences identified and isolated from Saccharomyces cerevisiae. Nature (London) 306:707-709. 9. Defeo-Jones, D., K. Tatchell, L. C. Robinson, I. Sigal, W. Vass, D. R. Lowy, and E. M. Scolnick. 1985. Mammalian and yeast RAS gene products: biological function in their heterologous systems. Science 228:179-184. 10. Fedor-Chaiken, M., R. J. Deschenes, and J. R. Broach. 1990. SRV2, a gene required for RAS activation of adenylate cyclase in yeast. Cell 61:329-340. 11. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13. 12. Field, J., J.-I. Nikawa, D. Broek, B. MacDonald, L. Rogers, I. A.

MOL. CELL. BIOL. Wilson, R. A. Lerner, and M. Wigler. 1988. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165. 13. Field, J., A. Vojtek, R. Ballester, G. Bolger, J. Colicelli, K. Ferguson, J. Gerst, T. Kataoka, T. Michaeli, S. Powers, M. Riggs, L. Rodgers, I. Wieland, B. Wheland, and M. WVigler. 1990. Cloning and characterization of CAP, the S. cerevisiae gene encoding the 70 kd adenylyl cyclase-associated protein. Cell 61:319-327. 14. Fukui, Y., T. Kozasa, Y. Kajiro, T. Takeda, and M. Yamamoto.

1986. Role of a ras homologue in the life cycle of Schizosaccharomyces pombe. Cell 44:329-336. 15. Gerst, J. E., K. Ferguson, A. Vojtek, M. Wigler, and J. Field. 1991. CAP is a bifunctional component of the Saccharomyces cerevisiae adenylyl cyclase complex. Mol. Cell. Biol. 11:12481257. 16. Hashimoto, C., K. L. Hudson, and K. V. Anderson. 1988. The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 52:269-279. 17. Heideman, W., G. F. Casperson, and H. Bourne. 1987. Adenylyl cyclase in yeast. J. Biol. Chem. 262:7087-7091. 18. Hofsteenge, J., B. Kieffer, R. Marthies, B. A. Hemmings, and S. R. Stone. 1988. Amino acid sequence of the ribonuclease inhibitor from porcine liver reveals the presence of leucine-rich repeats. Biochemistry 27:8537-8544. 19. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168. 20. Kataoka, T., D. Broek, and M. Wigler. 1986. DNA sequence and characterization of the S. cerevisiae gene encoding adenylate cyclase. Cell 43:493-505. 21. Kataoka, T., S. Powers, S. Cameron, 0. Fasano, M. Goldfarb, J. Broach, and M. Wigler. 1985. Functional homology of mammalian and yeast RAS genes. Cell 40:19-26. 22. Kramer, W., and H.-J. Fritz. 1987. Oligonucleotide-directed construction of mutations via gapped duplex DNA. Methods Enzymol. 154:350-367. 23. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:681-685. 24. Lopez, J. A., D. W. Chung, K. Fujikawa, F. S. Hagen, E. W. Davie, and G. J. Roth. 1988. The alpha and beta chains of human platelet glycoprotein lb are both transmembrane proteins containing a leucine-rich amino acid sequence. Proc. Natl. Acad. Sci. USA 85:2135-2139. 25. Matsumoto, K., I. Uno, and T. Ishikawa. 1984. Identification of the structural gene and nonsense alleles for adenylate cyclase in Saccharomyces cerevisiae. J. Bacteriol. 157:277-282. 26. McFarland, K. C., R. Sprengel, H. S. Phillips, M. Koehler, N. Rosemblit, K. Nikolics, D. L Segaloff, and P. H. Seeburg. 1989. Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245:494-499. 27. Mitts, M. R., D. B. Grant, and W. Heideman. 1990. Adenylate cyclase in Saccharomyces cerevisiae is a peripheral membrane protein. Mol. Cell. Biol. 10:3873-3883. 28. Ohkura, H., and M. Yanagida. 1991. S. pomnbe gene sds22+ essential for a midmitotic transition encodes a leucine-rich repeat protein that positively modulates protein phosphatase-1. Cell 64:149-157. 29. Powers, S., T. Kataoka, 0. Fasano, M. Goldfarb, J. Strathern, J. Broach, and M. Wigler. 1984. Genes in S. cerevisiae encoding proteins with domains homologous to the mammalian ras proteins. Cell 36:607-612. 30. Reinke, R., D. E. Krantz, D. Yen, and S. L. Zipursky. 1988. Chaoptin, a cell surface glycoprotein required for Drosophila photoreceptor cell morphogenesis, contains a repeat motif found in yeast and human. Cell 52:291-301. 31. Rothstein, R. J. 1983. One-step gene disruption in yeast. Methods Enzymol. 101:202-211. 32. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in E. coli as fusions with glutathione

VOL. 12, 1992

ROLE OF CAP IN RAS-ADENYLYL CYCLASE INTERACTION

S-transferase. Gene 67:31-40. 33. Struhl, K, D. Stinchcomb, S. Scherer, and R. Davis. 1979. High frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sci. USA 76:1035-

39.

1039.

34. Suzuki, N., H.-R Choe, Y. Nishida, Y. Yamawaki-Kataoka, S. Ohnishi, T. Tamaoki, and T. Kataoka. 1990. Leucine-rich repeats and carboxyl terminus are required for interaction of yeast adenylate cyclase with RAS proteins. Proc. Natl. Acad. Sci. USA 87:8711-8715. 35. Takahashi, N., Y. Takahashi, and F. W. Putnam. 1985. Periodicity of leucine and tandem repetition of a 24-amino acid segment in the primary structure of leucine-rich a2-glycoprotein of human serum. Proc. Natl. Acad. Sci. USA 82:1906-1910. 36. Tamanoi, F., M. Walsh, T. Kataoka, and M. Wigler. 1984. A product of yeast RAS2 gene is a guanine nucleotide binding protein. Proc. Natl. Acad. Sci. USA 81:6924-6928. 37. Temeles, G. L., J. B. Gibbs, J. S. D'Alonzo, I. S. Sigal, and E. M. Scolnick. 1984. Yeast and mammalian ras proteins have conserved biochemical properties. Nature (London) 313:700-703. 38. Titani, K, L Takio, M. Handa, and Z. M. Ruggeri. 1987.

40.

41.

42. 43.

4945

Amino acid sequence of sialic acid binding lectin from frog (Rana catesbeiana) eggs. Proc. Natl. Acad. Sci. USA 84:56105614. Toda, T., L Uno, T. Ishikawa, S. Powers, T. Kataoka, D. Broek, S. Cameron, J. Broach, K. Matsumoto, and M. WIgler. 1985. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 40:27-36. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354. Vojtek, A., B. Haarer, J. Field, J. Gerst, T. D. Pollard, S. Brown, and M. Wigler. 1991. Evidence for a functional link between profilin and CAP in the yeast S. cerevisiae. Cell 66:497-505. Wang, J., and T. Kataoka. Unpublished data. Yamawakl-Kataoka, Y., T. Tamaoki, H.-R Choe, H. Tanaka, and T. Kataoka. 1989. Adenylate cyclases in yeast: a comparison of the genes from Schizosaccharomyces pombe and Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86:56935697.