Eur J Dermatol 2014; 24(3): 342-8
Investigative report David JANSON1 Gaëlle SAINTIGNY2 Jeroen ZEYPVELD1 Christian MAHÉ2 Abdoelwaheb EL GHALBZOURI1 1
LUMC, Department of Dermatology, Einthovenweg 20, 2333 ZC, Leiden, The Netherlands 2 CHANEL Parfums Beauté, Paris, France
Reprints: D. Janson
Article accepted on 1/11/2014
B
TGF-1 induces differentiation of papillary fibroblasts to reticular fibroblasts in monolayer culture but not in human skin equivalents Fibroblasts isolated from the papillary and reticular dermis are different from each other in vitro. If papillary fibroblasts are subjected to prolonged serial passaging they will differentiate into reticular fibroblasts. Reticular fibroblasts have been shown to resemble myofibroblasts in several ways. TGF-1 is the most important factor involved in myofibroblast differentiation. Aims: we investigated if TGF-1 can induce differentiation of papillary fibroblasts into reticular fibroblasts, in monolayer cultures and in human skin equivalents. Method: Monolayer cultures of and human skin equivalents generated with papillary fibroblasts were stimulated with TGF-1. The expression of markers specific for reticular and papillary fibroblasts was measured by qPCR and immunohistochemical analysis in monolayer cultures. In human skin equivalents, the morphology and the expression of several markers was analysed and compared to untreated papillary and reticular human skin equivalents. Results: Monolayer cultures of papillary fibroblasts started to express a reticular marker profile after stimulation with TGF-1. Human skin equivalents generated with papillary fibroblast and stimulated with TGF-1 were similar to papillary control equivalents and did not obtain reticular characteristics. Expression of reticular markers was only found in the lower layers of TGF-1-stimulated papillary skin equivalents. Conclusions: TGF-1 can induce differentiation to reticular fibroblasts in monolayer cultures of papillary fibroblasts. In skin equivalents no such effects were found. The major difference between these experiments is the presence of extracellular matrix in skin equivalents. Therefore, we hypothesize that the matrix secreted by papillary fibroblasts protects them from TGF-1 induced differentiation. Key words: papillary, reticular, fibroblasts, TGF-1, differentiation, human skin equivalents
342
broblasts and smooth muscle tissue, is present in several skin appendages, such as blood vessels and smooth muscle cells, but not in fibroblasts [10, 11]. Therefore, fully differentiated myofibroblasts, that is, myofibroblasts with a complete and functional contractile apparatus, are not present in a healthy dermal fibroblast population [9]. Like myofibroblasts, reticular fibroblasts have large cell bodies and cause increased contraction of collagen lattices in vitro [12, 13]. Reticular fibroblasts do not show ␣-SMA expression in vivo and only minimally in vitro, but the number of ␣-SMA positive fibroblasts is increased in reticular fibroblasts compared to papillary fibroblasts in vitro. Several markers for reticular fibroblasts are related to myofibroblasts and contraction, most notably Calponin 1 (CNN1) [14]. The single most important stimulator of myofibroblast differentiation is TGF-1 [15]. Other factors, such as mechanical tension, fibronectin and several growth factors, can also contribute to myofibroblast differentiation, but TGF-1 seems to be essential [7, 9, 16]. Because TGF-1 EJD, vol. 24, n◦ 3, May-June 2014
To cite this article: Janson D, Saintigny G, Zeypveld J, Mahé C, Ghalbzouri AE. TGF-1 induces differentiation of papillary fibroblasts to reticular fibroblasts in monolayer culture, but not in human skin equivalents. Eur J Dermatol 2014; 24(3): 342-8 doi:10.1684/ejd.2014.2312
doi:10.1684/ejd.2014.2312
ased on its morphology, the dermis can be divided in two parts. The upper part, called the papillary dermis, has loose connective tissue and a high cell density. The deeper part, called the reticular dermis, has thick connective tissue and a low cell density [1]. It has been known for quite some time that the fibroblasts isolated from these respective dermal compartments behave differently in monolayer culture and in human skin equivalents (HSEs) [2-5]. Recently, we have shown that papillary fibroblasts can differentiate into reticular fibroblasts in vitro after prolonged culture [6]. In vitro, reticular fibroblasts resemble myofibroblasts in several ways. Myofibroblasts are specialized contractile fibroblasts, which in the skin are known for their role in wound healing. An important step in wound healing is the differentiation of fibroblasts to myofibroblasts [7]. Myofibroblasts provide contractile forces and generate large quantities of matrix to facilitate wound closure [8, 9]. In healthy skin, myofibroblasts are not present. Staining with alpha smooth muscle actin (␣-SMA), a marker of myofi-
is so important for the differentiation of myofibroblasts, and because reticular fibroblasts resemble myofibroblasts, we investigated if TGF-1 can also induce differentiation of papillary fibroblasts to reticular fibroblasts. For this purpose, we treated papillary fibroblasts with TGF-1 in monolayer cultures and analysed changes in expression of reticular and papillary markers. In addition, we supplemented TGF-1 to HSEs generated with papillary fibroblasts and analysed if these HSEs gained phenotypical characteristics of HSEs generated with reticular fibroblasts.
Methods Isolation and cell culture Isolation of reticular and papillary fibroblasts was performed as described before [14]. In short, skin obtained from plastic surgery was cleaned thoroughly and dermatomed at two different depths. First, skin was dermatomed at 300 m to obtain the epidermis and papillary dermis. For the reticular dermis the deep skin was removed with dermatome and scalpel, and the upper part was discarded. This deep dermis was then used for isolation. Fibroblasts were isolated by treatment with Collagenase (Invitrogen, Breda, The Netherlands) and Dispase (Roche Diagnostics, Almere, The Netherlands), mixed in a 3:1 ratio for 2 hours at 37 ◦ C. Fibroblasts were cultured in DMEM medium (Gibco/ Invitrogen, Breda, The Netherlands) containing 5% Fetal Calf Serum (FCS, HyClone, Thermo Scientific, Etten-Leur) and 1% penicillin-streptomycin (Invitrogen). They were kept at 37 ◦ C at 5% CO2 . From all donors, both reticular and papillary fibroblasts were isolated, consequently all analyses were performed on a pairwise basis. When reaching confluence, fibroblasts were passaged at a 1:3 ratio. The fibroblasts used for experiments were in passage 3-6. All experiments were performed on at least three different donors (both papillary and reticular from same donor). Normal human epidermal keratinocytes were isolated from skin obtained from plastic surgery. First the entire skin was treated with Dispase II to separate the dermis from the epidermis. Subsequently, the epidermis was incubated in trypsin to isolate the keratinocytes. After filtering with a cell strainer (70 m pore size), the keratinocytes were seeded and cultured at 37 o C at 7.3 % CO2 . Keratinocyte medium consisted of DMEM and Ham’s F12 medium (3:1) supplemented with 5% FCS, 0.5 M hydrocortisone, 1 M isoproterenol, 0.1 M insulin (Sigma-Aldrich, Zwijndrecht, The Netherlands), 100 U ml-1 penicillin and 100 g ml-1 streptomycin (Invitrogen).
Generation of Human Skin Equivalents Human fibroblast-derived matrix (FDM) equivalents were generated as described earlier [17]. Briefly, 2 * 105 fibroblasts were seeded into 6-well filter inserts (0.4 m pore size Transwell inserts, Corning Incorporated, SchipholRijk, The Netherlands) and cultured submerged for 3 weeks using CNT-05 medium (CELLnTEC, Huissen, The Netherlands) supplemented with 50 M ascorbic acid. After generation of the dermal equivalents, 5 * 105 keratinocytes were seeded on top. Cultures were incubated EJD, vol. 24, n◦ 3, May-June 2014
overnight in keratinocyte medium as described above. After this, the models were cultured for two days in keratinocyte medium with 1% FCS, supplemented with 53 M selenious acid, 10 mM L-serine, 10 M L-carnitine, 1 M dL-␣-tocopherol-acetate, 250 M ascorbic acid phosphate, 24 M bovine serum albumin and a lipid supplement containing 25 M palmitic acid, 15 M linoleic acid and 7 M arachidonic acid (Sigma-Aldrich, Zwijndrecht, The Netherlands). Then, the cultures were air exposed and cultured in supplemented keratinocyte medium as described above but without FCS and with an increased concentration of linoleic acid (30 M). Medium was refreshed twice a week. After 17 days of air-exposed culture the FDM equivalents were harvested for analysis.
TGF-1 stimulation Recombinant TGF-1 (Cell Signaling, Boston, MA, USA) was reconstituted as described in the manufacturer’s protocol. For addition to monolayer cultures, cells were first cultured in starvation medium (1% serum) before supplementing TGF-1 (2 or 10 ng/mL) to the cells. For stimulation of skin equivalents, TGF-1 (2 ng/mL) was supplemented to the standard media, as described above. Two time points were used to start with TGF-1 supplementation, either one week after seeding the fibroblasts or from the air-exposure of the equivalent after the seeding of keratinocytes.
Quantitative PCR cDNA was generated of 1 g RNA using the iScript cDNA synthesis kit (BioRad, Veenendaal, The Netherlands) according to manufacturer’s instructions. PCR reactions were based on the SYBR Green method (BioRad).The PCRs were run on the CFX384 system (BioRad). The PCR protocol was: 5 minutes at 95 ◦ C, 45 cycles of 20 sec 95 ◦ C and 40 sec 60 ◦ C, followed by the generation of a melt curve. Primers were checked beforehand on dilution series of normal fibroblasts cDNA. Expression analysis was performed with the BioRad Software (CFX Manager) and was based on the delta delta Ct method with the reference genes that were most stably expressed. The primers are listed in table 1.
Immunohistochemistry For immunohistochemical analyses on monolayer cell cultures, fibroblasts were grown on glass slides until nearly confluent, washed in PBS and fixed with 4% formaldehyde. Skin equivalents were processed and snap-frozen in liquid nitrogen or fixed in 4% formaldehyde, dehydrated and embedded in paraffin. Sections were cut (5 m) and rehydrated in xylene and ethanol. For cryosections, 5 m were cut and fixed with acetone. Following incubation with the primary antibody, sections were stained with avidin-biotin-peroxidase system (GE Healthcare, Hoevelaken, The Netherlands), as described by the manufacturer’s instructions. Staining was visualized with AEC (3-amino9-ethylcarbazole) and sections were counterstained with haematoxylin. Global morphologic analysis was performed on 5 m thick paraffin sections stained with haematoxylin and eosin (HE).
343
Table 1. Primers used for quantitative PCRs. Underlined genes were used as reference genes. Target
NM number
Sequence forward
Sequence reverse
CDH2 CNN1 EI24 MGP NTN1 PDPN SND1 TGF-1 TGM2
NM_001792.2 NM_001299.4 NM_001007277.1 NM_000900.3 NM_004822.2 NM_001006625.1 NM_014390.2 NM_000660.4 NM_004613.2
ATGTGCCGGATAGCGGGAGC AGCGGAAATTCGAGCCGGGG TTCACCGCATCCGTCGCCTG GCCATCCTGGCCGCCTTAGC CCAACGAGTGCGTGGCCTGT GCCACCAGTCACTCCACGGAGAA CGTGCAGCGGGGCATCATCA CACCGGAGTTGTGCGGCAGT GGTGTCCCTGCAGAACCCGC
ACAGACGCCTGAAGCAGGGC GGTGCCCATCTGCAGCCCAA GAGCGGGTCCTGCCTTCCCT TTGGTCCCTCGGCGCTTCCT CCGGTGGGTGATGGGCTTGC TTGGCAGCAGGGCGTAACCC TGCCCAGGGCTCATCAGGGG GGCCGGTAGTGAACCCGTTGATG CGGGGTCTGGGATCTCCACCG
Antibodies
To investigate whether reticular and papillary fibroblasts express TGF-1, qPCR analysis was performed on RNA isolated from monolayer cultures of both fibroblast populations. As shown in figure 1, in five donors the average expression of TGF-1 was higher in reticular fibroblasts than in papillary fibroblasts (1.31 and 0.64 respectively).
1.5 1.0
Normalized expression
Reticular fibroblasts show increased expression of TGF-1 compared to papillary fibroblasts
0.5
Results
2.0
The antibodies used in this study were: ␣-SMA (1A4, Sigma-Aldrich) 1:1000, Calponin (CALP, Abcam, Cambridge, UK) 1:50, Podoplanin (18H5, Abcam) 1:250, TGM2 (CUB7402, Abcam) 1:75.
Papillary
Reticular
Type
TGF-1 stimulation reduces papillary markerand induces reticular marker expression in papillary fibroblasts Because TGF-1 expression is increased in reticular fibroblasts, we wondered if TGF-1 stimulation can induce differentiation of papillary fibroblasts to reticular fibroblasts. Therefore, papillary fibroblasts were stimulated with TGF-1 and the expression of several papillary and reticular markers was measured by qPCR. A representative experiment is described and shown in figure 2. Papillary fibroblasts were stimulated with TGF-1 for 24 or 48 hours, at 2 or 10 ng/mL. The expression of collagen type I ␣1 was measured by qPCR as a positive control for the TGF-1 stimulation. As expected, the expression of collagen type I ␣1 was increased after TGF-1 stimulation (not shown). After stimulation with TGF-1 the expression of papillary markers PDPN and NTN1 decreased and the expression of reticular markers CDH2, CNN1 and TGM2 increased compared to untreated control papillary fibroblasts. Expression of reticular marker MGP was not affected. When combining both papillary markers and all the reticular markers (including MGP), the differences were statistically significant for each TGF-1 treatment condition compared to untreated controls (paired t-test, P
Investigative report David JANSON1 Gaëlle SAINTIGNY2 Jeroen ZEYPVELD1 Christian MAHÉ2 Abdoelwaheb EL GHALBZOURI1 1
LUMC, Department of Dermatology, Einthovenweg 20, 2333 ZC, Leiden, The Netherlands 2 CHANEL Parfums Beauté, Paris, France
Reprints: D. Janson
Article accepted on 1/11/2014
B
TGF-1 induces differentiation of papillary fibroblasts to reticular fibroblasts in monolayer culture but not in human skin equivalents Fibroblasts isolated from the papillary and reticular dermis are different from each other in vitro. If papillary fibroblasts are subjected to prolonged serial passaging they will differentiate into reticular fibroblasts. Reticular fibroblasts have been shown to resemble myofibroblasts in several ways. TGF-1 is the most important factor involved in myofibroblast differentiation. Aims: we investigated if TGF-1 can induce differentiation of papillary fibroblasts into reticular fibroblasts, in monolayer cultures and in human skin equivalents. Method: Monolayer cultures of and human skin equivalents generated with papillary fibroblasts were stimulated with TGF-1. The expression of markers specific for reticular and papillary fibroblasts was measured by qPCR and immunohistochemical analysis in monolayer cultures. In human skin equivalents, the morphology and the expression of several markers was analysed and compared to untreated papillary and reticular human skin equivalents. Results: Monolayer cultures of papillary fibroblasts started to express a reticular marker profile after stimulation with TGF-1. Human skin equivalents generated with papillary fibroblast and stimulated with TGF-1 were similar to papillary control equivalents and did not obtain reticular characteristics. Expression of reticular markers was only found in the lower layers of TGF-1-stimulated papillary skin equivalents. Conclusions: TGF-1 can induce differentiation to reticular fibroblasts in monolayer cultures of papillary fibroblasts. In skin equivalents no such effects were found. The major difference between these experiments is the presence of extracellular matrix in skin equivalents. Therefore, we hypothesize that the matrix secreted by papillary fibroblasts protects them from TGF-1 induced differentiation. Key words: papillary, reticular, fibroblasts, TGF-1, differentiation, human skin equivalents
342
broblasts and smooth muscle tissue, is present in several skin appendages, such as blood vessels and smooth muscle cells, but not in fibroblasts [10, 11]. Therefore, fully differentiated myofibroblasts, that is, myofibroblasts with a complete and functional contractile apparatus, are not present in a healthy dermal fibroblast population [9]. Like myofibroblasts, reticular fibroblasts have large cell bodies and cause increased contraction of collagen lattices in vitro [12, 13]. Reticular fibroblasts do not show ␣-SMA expression in vivo and only minimally in vitro, but the number of ␣-SMA positive fibroblasts is increased in reticular fibroblasts compared to papillary fibroblasts in vitro. Several markers for reticular fibroblasts are related to myofibroblasts and contraction, most notably Calponin 1 (CNN1) [14]. The single most important stimulator of myofibroblast differentiation is TGF-1 [15]. Other factors, such as mechanical tension, fibronectin and several growth factors, can also contribute to myofibroblast differentiation, but TGF-1 seems to be essential [7, 9, 16]. Because TGF-1 EJD, vol. 24, n◦ 3, May-June 2014
To cite this article: Janson D, Saintigny G, Zeypveld J, Mahé C, Ghalbzouri AE. TGF-1 induces differentiation of papillary fibroblasts to reticular fibroblasts in monolayer culture, but not in human skin equivalents. Eur J Dermatol 2014; 24(3): 342-8 doi:10.1684/ejd.2014.2312
doi:10.1684/ejd.2014.2312
ased on its morphology, the dermis can be divided in two parts. The upper part, called the papillary dermis, has loose connective tissue and a high cell density. The deeper part, called the reticular dermis, has thick connective tissue and a low cell density [1]. It has been known for quite some time that the fibroblasts isolated from these respective dermal compartments behave differently in monolayer culture and in human skin equivalents (HSEs) [2-5]. Recently, we have shown that papillary fibroblasts can differentiate into reticular fibroblasts in vitro after prolonged culture [6]. In vitro, reticular fibroblasts resemble myofibroblasts in several ways. Myofibroblasts are specialized contractile fibroblasts, which in the skin are known for their role in wound healing. An important step in wound healing is the differentiation of fibroblasts to myofibroblasts [7]. Myofibroblasts provide contractile forces and generate large quantities of matrix to facilitate wound closure [8, 9]. In healthy skin, myofibroblasts are not present. Staining with alpha smooth muscle actin (␣-SMA), a marker of myofi-
is so important for the differentiation of myofibroblasts, and because reticular fibroblasts resemble myofibroblasts, we investigated if TGF-1 can also induce differentiation of papillary fibroblasts to reticular fibroblasts. For this purpose, we treated papillary fibroblasts with TGF-1 in monolayer cultures and analysed changes in expression of reticular and papillary markers. In addition, we supplemented TGF-1 to HSEs generated with papillary fibroblasts and analysed if these HSEs gained phenotypical characteristics of HSEs generated with reticular fibroblasts.
Methods Isolation and cell culture Isolation of reticular and papillary fibroblasts was performed as described before [14]. In short, skin obtained from plastic surgery was cleaned thoroughly and dermatomed at two different depths. First, skin was dermatomed at 300 m to obtain the epidermis and papillary dermis. For the reticular dermis the deep skin was removed with dermatome and scalpel, and the upper part was discarded. This deep dermis was then used for isolation. Fibroblasts were isolated by treatment with Collagenase (Invitrogen, Breda, The Netherlands) and Dispase (Roche Diagnostics, Almere, The Netherlands), mixed in a 3:1 ratio for 2 hours at 37 ◦ C. Fibroblasts were cultured in DMEM medium (Gibco/ Invitrogen, Breda, The Netherlands) containing 5% Fetal Calf Serum (FCS, HyClone, Thermo Scientific, Etten-Leur) and 1% penicillin-streptomycin (Invitrogen). They were kept at 37 ◦ C at 5% CO2 . From all donors, both reticular and papillary fibroblasts were isolated, consequently all analyses were performed on a pairwise basis. When reaching confluence, fibroblasts were passaged at a 1:3 ratio. The fibroblasts used for experiments were in passage 3-6. All experiments were performed on at least three different donors (both papillary and reticular from same donor). Normal human epidermal keratinocytes were isolated from skin obtained from plastic surgery. First the entire skin was treated with Dispase II to separate the dermis from the epidermis. Subsequently, the epidermis was incubated in trypsin to isolate the keratinocytes. After filtering with a cell strainer (70 m pore size), the keratinocytes were seeded and cultured at 37 o C at 7.3 % CO2 . Keratinocyte medium consisted of DMEM and Ham’s F12 medium (3:1) supplemented with 5% FCS, 0.5 M hydrocortisone, 1 M isoproterenol, 0.1 M insulin (Sigma-Aldrich, Zwijndrecht, The Netherlands), 100 U ml-1 penicillin and 100 g ml-1 streptomycin (Invitrogen).
Generation of Human Skin Equivalents Human fibroblast-derived matrix (FDM) equivalents were generated as described earlier [17]. Briefly, 2 * 105 fibroblasts were seeded into 6-well filter inserts (0.4 m pore size Transwell inserts, Corning Incorporated, SchipholRijk, The Netherlands) and cultured submerged for 3 weeks using CNT-05 medium (CELLnTEC, Huissen, The Netherlands) supplemented with 50 M ascorbic acid. After generation of the dermal equivalents, 5 * 105 keratinocytes were seeded on top. Cultures were incubated EJD, vol. 24, n◦ 3, May-June 2014
overnight in keratinocyte medium as described above. After this, the models were cultured for two days in keratinocyte medium with 1% FCS, supplemented with 53 M selenious acid, 10 mM L-serine, 10 M L-carnitine, 1 M dL-␣-tocopherol-acetate, 250 M ascorbic acid phosphate, 24 M bovine serum albumin and a lipid supplement containing 25 M palmitic acid, 15 M linoleic acid and 7 M arachidonic acid (Sigma-Aldrich, Zwijndrecht, The Netherlands). Then, the cultures were air exposed and cultured in supplemented keratinocyte medium as described above but without FCS and with an increased concentration of linoleic acid (30 M). Medium was refreshed twice a week. After 17 days of air-exposed culture the FDM equivalents were harvested for analysis.
TGF-1 stimulation Recombinant TGF-1 (Cell Signaling, Boston, MA, USA) was reconstituted as described in the manufacturer’s protocol. For addition to monolayer cultures, cells were first cultured in starvation medium (1% serum) before supplementing TGF-1 (2 or 10 ng/mL) to the cells. For stimulation of skin equivalents, TGF-1 (2 ng/mL) was supplemented to the standard media, as described above. Two time points were used to start with TGF-1 supplementation, either one week after seeding the fibroblasts or from the air-exposure of the equivalent after the seeding of keratinocytes.
Quantitative PCR cDNA was generated of 1 g RNA using the iScript cDNA synthesis kit (BioRad, Veenendaal, The Netherlands) according to manufacturer’s instructions. PCR reactions were based on the SYBR Green method (BioRad).The PCRs were run on the CFX384 system (BioRad). The PCR protocol was: 5 minutes at 95 ◦ C, 45 cycles of 20 sec 95 ◦ C and 40 sec 60 ◦ C, followed by the generation of a melt curve. Primers were checked beforehand on dilution series of normal fibroblasts cDNA. Expression analysis was performed with the BioRad Software (CFX Manager) and was based on the delta delta Ct method with the reference genes that were most stably expressed. The primers are listed in table 1.
Immunohistochemistry For immunohistochemical analyses on monolayer cell cultures, fibroblasts were grown on glass slides until nearly confluent, washed in PBS and fixed with 4% formaldehyde. Skin equivalents were processed and snap-frozen in liquid nitrogen or fixed in 4% formaldehyde, dehydrated and embedded in paraffin. Sections were cut (5 m) and rehydrated in xylene and ethanol. For cryosections, 5 m were cut and fixed with acetone. Following incubation with the primary antibody, sections were stained with avidin-biotin-peroxidase system (GE Healthcare, Hoevelaken, The Netherlands), as described by the manufacturer’s instructions. Staining was visualized with AEC (3-amino9-ethylcarbazole) and sections were counterstained with haematoxylin. Global morphologic analysis was performed on 5 m thick paraffin sections stained with haematoxylin and eosin (HE).
343
Table 1. Primers used for quantitative PCRs. Underlined genes were used as reference genes. Target
NM number
Sequence forward
Sequence reverse
CDH2 CNN1 EI24 MGP NTN1 PDPN SND1 TGF-1 TGM2
NM_001792.2 NM_001299.4 NM_001007277.1 NM_000900.3 NM_004822.2 NM_001006625.1 NM_014390.2 NM_000660.4 NM_004613.2
ATGTGCCGGATAGCGGGAGC AGCGGAAATTCGAGCCGGGG TTCACCGCATCCGTCGCCTG GCCATCCTGGCCGCCTTAGC CCAACGAGTGCGTGGCCTGT GCCACCAGTCACTCCACGGAGAA CGTGCAGCGGGGCATCATCA CACCGGAGTTGTGCGGCAGT GGTGTCCCTGCAGAACCCGC
ACAGACGCCTGAAGCAGGGC GGTGCCCATCTGCAGCCCAA GAGCGGGTCCTGCCTTCCCT TTGGTCCCTCGGCGCTTCCT CCGGTGGGTGATGGGCTTGC TTGGCAGCAGGGCGTAACCC TGCCCAGGGCTCATCAGGGG GGCCGGTAGTGAACCCGTTGATG CGGGGTCTGGGATCTCCACCG
Antibodies
To investigate whether reticular and papillary fibroblasts express TGF-1, qPCR analysis was performed on RNA isolated from monolayer cultures of both fibroblast populations. As shown in figure 1, in five donors the average expression of TGF-1 was higher in reticular fibroblasts than in papillary fibroblasts (1.31 and 0.64 respectively).
1.5 1.0
Normalized expression
Reticular fibroblasts show increased expression of TGF-1 compared to papillary fibroblasts
0.5
Results
2.0
The antibodies used in this study were: ␣-SMA (1A4, Sigma-Aldrich) 1:1000, Calponin (CALP, Abcam, Cambridge, UK) 1:50, Podoplanin (18H5, Abcam) 1:250, TGM2 (CUB7402, Abcam) 1:75.
Papillary
Reticular
Type
TGF-1 stimulation reduces papillary markerand induces reticular marker expression in papillary fibroblasts Because TGF-1 expression is increased in reticular fibroblasts, we wondered if TGF-1 stimulation can induce differentiation of papillary fibroblasts to reticular fibroblasts. Therefore, papillary fibroblasts were stimulated with TGF-1 and the expression of several papillary and reticular markers was measured by qPCR. A representative experiment is described and shown in figure 2. Papillary fibroblasts were stimulated with TGF-1 for 24 or 48 hours, at 2 or 10 ng/mL. The expression of collagen type I ␣1 was measured by qPCR as a positive control for the TGF-1 stimulation. As expected, the expression of collagen type I ␣1 was increased after TGF-1 stimulation (not shown). After stimulation with TGF-1 the expression of papillary markers PDPN and NTN1 decreased and the expression of reticular markers CDH2, CNN1 and TGM2 increased compared to untreated control papillary fibroblasts. Expression of reticular marker MGP was not affected. When combining both papillary markers and all the reticular markers (including MGP), the differences were statistically significant for each TGF-1 treatment condition compared to untreated controls (paired t-test, P
