Vol. 12, No. 3

MOLECULAR AND CELLULAR BIOLOGY, Mar. 1992, p. 1021-1030 0270-7306/92/031021-10$02.00/0 Copyright © 1992, American Society for Microbiology

Temperature-Dependent Regulation of a Heterologous Transcriptional Activation Domain Fused to Yeast Heat Shock Transcription Factor J. JOSE BONNER,* SCOTT HEYWARD, AND DONNA L. FACKENTHAL Department of Biology, Institute for Molecular and Cellular Biology, Indiana University, Bloomington, Indiana 47405 Received 9 September 1991/Accepted 3 December 1991 The heat shock transcription factor (HSF) of the yeast Saccharomyces cerevisiae is posttranslationally modified. At low growth temperatures, it activates transcription of heat shock genes only poorly; after shift to high temperatures, it activates transcription readily. In an effort to elucidate the mechanism of this regulation, we constructed a series of HSF-VP16 fusions that join the HSF DNA-binding domain to the strong transcriptional activation domain from the VP16 gene of herpes simplex virus. Replacement of the endogenous C-terminal transcriptional activation domain with that of VP16 generates an HSF derivative that exhibits behavior reminiscent of HSF itself: low transcriptional activation activity at normal growth temperature and high activity after heat shock. HSF can thus restrain the activity of the heterologous VP16 transcriptional activation domain. To determine what is required for repression of activity at low temperature, we deleted portions of HSF from this HSF-VP16 fusion to map the regulatory domain. We also isolated point mutations that convert the HSF-VP16 fusion into a constitutive transcriptional activator. We conclude that the central, evolutionarily conserved domain of HSF, encompassing the DNA-binding and multimerization domains, contains a major determinant of temperature-dependent regulation.

example, reference 6) or of transcription factor activity (18, 26, 33, 36) by phosphorylation. In most of these cases, it is either known or speculated that the effect of phosphorylation is to stabilize a conformation of the protein that exhibits higher (or lower) activity. It is relatively easy to imagine that HSF, whether from humans, flies, or yeasts, undergoes a conformational change upon phosphorylation and that the new conformation exhibits higher activity in DNA binding, transcriptional activation, or both (17, 38). Existing data suggest that yeast HSF almost certainly undergoes a conformational change upon temperature upshift. First, the mobility of DNA-protein complexes in native gels decreases (30, 32) despite the fact that phosphorylation should render the complex more acidic. Second, yeast HSF has been shown to contain several transcriptional activation domains that, when fused to another DNA-binding domain, do not exhibit temperature-dependent activity (19, 29). Either these domains do not function in native HSF as transcriptional activation regions or, more likely, the conformation of HSF is such that at low temperature these domains are sequestered away from the transcriptional machinery. At high temperature, the conformation of HSF would be such that one or more of these domains is exposed and able to function. By this model, phosphorylation could be an important step in inducing the conformational change in HSF that reveals the transcriptional activation function. The experiments described herein are aimed at exploring the nature of this phenomenon of low-temperature impairment of transcriptional activation by HSF. Specifically, we wished to know whether this impairment reflected a specific interaction of a masking domain with the transcriptional activation domain or whether some other, more general process might be involved. By examining the activities of HSF-VP16 fusions in yeast cells, we demonstrate that even a strong, heterologous transcriptional activator can be downregulated by HSF in a temperature-dependent fashion.

Stress proteins, or heat shock proteins, are highly regulated, exhibiting low-level expression at low growth temperatures, intermediate levels at intermediate temperatures, and high levels at high temperatures. For Escherichia coli and the yeast Saccharomyces cerevisiae, the response to a temperature upshift is similar: a rapid increase in expression well above the original basal level, followed by adaptation to a new basal level that is only fewfold above the original. In eukaryotes, the major regulatory protein involved in heat shock protein expression is the transcriptional activator heat shock transcription factor (HSF). Indeed, the addition of a synthetic oligonucleotide bearing the HSF-binding site (a heat shock element) suffices to bring a heterologous gene under the control of the heat shock system (19, 29; this report). Therefore, to understand the regulation of heat shock protein expression, it is necessary to know how the activity of HSF is modulated such that it stimulates different levels of transcription at different temperatures. In Drosophila (30, 39) and human (14, 38) cells, HSF appears to be regulated at the level of DNA binding; HSF from normal cells cannot bind DNA effectively, while that isolated from cells that have been heat shocked binds well. By contrast, in yeast cells, HSF appears to be able to bind DNA at all temperatures (12, 30) and exhibits regulation of its ability to stimulate transcription. Despite this difference, in both yeast (32) and human (15) cells, HSF is phosphorylated upon temperature upshift. Thus, it is likely that there is a common mechanism of activation of HSF and that the apparent differences in regulation reflect conformational differences in nonconserved regions of otherwise similar proteins. Phosphorylation represents an attractive model for the regulation of HSF activity, in part because there are many precedents for regulation of enzymatic activity (see, for *

Corresponding author. 1021

1022

MOL. CELL. BIOL.

BONNER ET AL. TABLE 1. Strains used Genotype

Strain

YJJ135

YJJ159

MATat trpl-289 ura3-52 ade2-101 his3-200 leu2-3,112 gall-102 MATa trpl-289 ura3-52 met2 his3-1

Source

J. Jaehning J. Jaehning

YJJ159a

leu2-3,112 This study MATa segregant of YJJ159 diploidized by transformation with an HO plasmid

BWG1.7a

MATa adel-100 his4-519 ura3-52

leu2-3,112 YJB97

AHSFQ AHSFa

YJB165

YJB166

Diploid of YJJ135 carrying YIpHSElacZ integrated into trpl289 and YJJ159 carrying YIpHSElacZ integrated into trpl289 YJJ159a carrying deletion of HSFI and YEpHSF-URA3 plasmid Segregant of AHSFa crossed to BWG1.7a; MATa adel-100 trpl289 ura3-52 his4-519 leu2-3,112

gal' hsflA [YEpHSF-URA3] Diploid of AHSFa carrying YIpHSElacZ integrated into trpl289 and AHSFa carrying YIpHSElacZ integrated into trpl289 YJB97 into which HSE-HIS3 had been integrated adjacent to the LYS2 gene

L. Guarente This study

J. Kopczynski

This study

This study

This study

MATERIALS AND METHODS The yeast strains used in these experiments are described in Table 1. All growth conditions and manipulations were performed according to standard procedures (27). Restriction enzymes, polymerases, ligases, and other reagents were from United States Biochemical or Bethesda Research Laboratories. Molecular cloning procedures were carried out according to standard procedures (23). Construction of a lacZ reporter. Into the XhoI site of plasmid A178 (10) was inserted, after fill-in of the XhoI ends, the oligonucleotide AGAAGCTTCTAGAAGCTTCT, which was verified by sequencing. The StuI-PstI fragment carrying the lacZ gene was then transferred to plasmid YIplac204 (9) to generate YIpHSElacZ. Cells were transformed with plasmid linearized by partial digestion with EcoRV to direct integration to the TRPI locus. Transformants were analyzed by 5-bromo-4-chloro-3-indolyl-,-D-galactopyranoside (XGal) assay to identify those in which the HSE-lacZ reporter had integrated properly, retaining its heat shock-inducible P-galactosidase activity. Integrated copies of the HSE-lacZ reporter were used to avoid potential saturation of the cells' capacity to synthesize P-galactosidase when driven by strong transcriptional activators, even though it necessitated more care in assaying the basal levels of expression. It should be noted that transformation often induces chromosomal mutations and that many mutations elevate the level of expression of the heat shock system (stress mutations [2a]). Therefore, a moderate number of transformants must be examined to ascertain that one has identified the true phenotype of the transformants and has not inadvertently chosen a stress mutant for analysis. Because most stress mutations in S. cerevisiae are recessive (2a), diploid strains (YJB97, YJB165, and YJB166) were used for the studies reported here.

Construction of a HIS3 reporter. Into the BamHI site of plasmid pBM1501 (8) was inserted, after fill-in of the BamHI ends, the oligonucleotide CTTCTAGAAGCTTCTAGAAG. Cells of strain YJB97 were transformed with plasmid linearized with PvuII to direct integration to the L YS2 gene. Those that retained good heat shock-inducible P-galactosidase activity and low expression at 24°C, as identified by X-Gal assay, were chosen for further use. Construction of HSF derivatives. pRS2.7 (encoding HSF1-583) was constructed by subcloning the EcoRI-Stul fragment from the HSFJ gene into EcoRI- and SmaI-restricted YEplacl81 (9). pRM2.1 was constructed similarly, using the EcoRI-MscI fragment of HSF. pGBX (encoding HSF65833) was constructed by transferring a BamHI fragment from an HSFJ clone in pUC18 to the BglII site of YCpGAL3 (2). YCpGAL is a vector derived from YCplaclll of Gietz and Sugino (9) containing the GALJ-GALJO regulatory region from pBM272 (from M. Johnston), with the remaining multiple cloning site replaced with an oligonucleotide of sequence AATAATGTCTCCAAGCTTCCCGGG GAATTCAGATCT, which provides an initiation codon and several convenient restriction sites. HSF-VP16 derivatives were constructed in the vectors YCpGAL3, pDBD31, and pDBD33 (2). Plasmids pDBD31 and pDBD33 are derivatives of YCpGAL3 containing, inserted into the BglII site, the VP16 segment of plasmids pCRF1 and pCRF3, respectively (received from S. Triezenberg). Plasmids pGBM (encoding HSF65-381) and pBM16 (encoding HSF65-381 VP16) were constructed by transferring the BamHI fragment from pRM2.1 to YCpGAL and pDBD31, respectively. Plasmids pGBS (encoding HSF 583) and pBS16 (encoding HSF65-583 VP16) were generated by transferring the BamHI fragments from pRS2.7 to YCp GAL3 and pDBD33 to make pGBS and pBS16, respectively. Plasmids pGBN (encoding HSF65-481) and pBN16 (encoding HSF65"81 * VP16) were constructed by transferring the EcoRI-NheI fragment of HSF to the EcoRI-XbaI sites of pUC18 and subsequently transferring the BamHI fragment from this plasmid to YCpGAL3 to make pGBN and to pDBD31 to make pBN16. Plasmid pVS16 (encoding HSF165-583 VP16) was constructed from pBS16 by partial digestion with EcoRV and gel purification of the linear plasmid, followed by ligation of a 10-bp EcoRI linker, digestion with EcoRI, and gel purification of the 7.1-kb fragment, which was circularized by ligation. Plasmid pBS16B was constructed by linearizing pBS16 with MscI and religating in the presence of the oligonucleotide, AGAAGCTTCTAGAAG, annealed to its complement. This provided an XbaI site in codon 381. ,I-Galactosidase assays. o-Nitrophenyl-f3-D-galactopyranoside (ONPG) assays were carried out essentially according to Ellwood and Craig (7). Fresh overnight cultures, taken from plates no older than 2 days, were inoculated into liquid culture and grown at 26 or 28°C to an A6. of 0.7. Cells were then shocked (or not) in a 37°C shaking water bath for the appropriate times. Cells (5 to 50 ml, depending on the activity) were centrifuged, washed, resuspended in 2 ml of Z buffer, and aliquoted, 0.2 ml per tube; the A6. of this suspension was measured for calculation of unit activity. Tubes were frozen in dry ice-ethanol, thawed, and vortexed after addition of 0.6 ml of Z buffer, 30 ,ul of 0.1% sodium dodecyl sulfate (SDS), and 30 RI of CHCl3. After addition of 160 ,ul of 4-mg/ml ONPG, tubes were incubated at 30°C; at 10-min intervals, 400 ,ul of 1 M Na2CO3 was added to stop the reaction. After a brief spin, the A420 of the aqueous layer

VOL. 12, 1992

REGULATION OF HSF ACTIVITY

was measured. Units of activity were calculated from assays that were clearly linear, using the equation u = -A420(t)A420(0)] x 1,0001(t x v x A6.), where t is time of assay in minutes and v is the volume of cell suspension used (0.2 ml). X-Gal assays were carried out essentially as described by Breeden and Nasmyth (3). Briefly, cells were replica lifted onto Whatman 50 filters, which were frozen by incubation on dry ice. After thawing, the filters were placed on Whatman 3 filters saturated with 2.5 ml of Z buffer containing 0.032% X-Gal and incubated at 30°C for 2 to 8 h, depending on activity levels. The reaction was stopped by addition of 1 ml of 1 M Na2CO3, and the filters were air dried. Immunoblot analysis. Protein extracts were prepared according to Sadler et al. (21). SDS-gel electrophoresis and immunodetection were performed as described by Harlow and Lane (11), using as markers the MW. SDS 200 kit from Sigma Chemical Co. To detect the HSF antigen, we used the High Sensitivity Enzygraphic Web (VWR) as described in the manual. HSF antiserum was generated in rabbits against a protein produced from a BamHl-Mscl fragment of HSF (amino acids [aa] 65 to 381) fused in frame to glutathione S-transferase (28); Antiserum obtained was affinity purified against this fusion protein to reduce contaminating cross-reactivity. PCR mutagenesis. pBM16 DNA was linearized with EcoRI and amplified by using Promega Taq DNA polymerase in a buffer (10 mM Tris [pH 8.7], 50 mM KCl, 2 mM MgCI2, 0.01% gelatin) designed to give low-fidelity replication (5). Primers used were 5'-AATAGGGAGGAATTTGTGCACC, spanning codons 205 to 212 of HSF, and 5'-CGCCATCGC CACGTCCTCGCCCGTCT, complementary to a portion of VP16. The polymerase chain reaction (PCR) product was cotransformed with XbaI-linearized pBS16B into YJB166. Recombinational repair (16), of the linearized plasmid proved more efficient in cells grown in glucose; therefore, the transformants were plated initially on leucine-deficient glucose plates to select transformants in which the PCR product had repaired the linearized fragment. Colonies were washed from the plates and replated on leucine- and histidine-deficient galactose plates containing 20 mM 3-aminotriazole. From approximately 105 initial transformants screened, 40 3-aminotriazole-resistant colonies were recovered. These were counterscreened by X-Gal analysis, after growth on glucose and on galactose, to determine which mutants induced the HSE-lacZ reporter in a galactosedependent fashion. Twenty strains passed this test; from these, plasmid was reisolated and retransformed into YJB165 and into YJB166. For six strains, the ability to induce the HSE-lacZ reporter was linked to the plasmid. The YJB165 strains were cured of endogenous YEpHSF plasmid by growth on 5-fluoro-orotic acid (1, 25). -

RESULTS HSF can utilize endogenous transcriptional activation domains located at either terminus. Sorger (29) and NietoSotelo et al. (19) have shown that yeast HSF contains at least two domains that are capable of functioning as transcriptional activators when fused to heterologous DNA-binding domains. Under such conditions, both the N-terminal domain and the C-terminal domain can provide constitutive, unregulated activity. Figure 1 presents evidence that these two domains also function in the HSF protein itself. Removal of the N terminus (HSF 833) or of the C terminus (HSF1-583) results in an HSF derivative that exhibits essentially normal regulation: low activity at 26°C and high

0

U*

1023

5

0

4 ~*

3

2

0HSF 1-833 YJB97

HSF 65-833

HSF 65-583

HSF 1-583

HSF 1-833 YJB1 65

HSF Derivative

FIG. 1. ,B-Galactosidase activities of yeast strains carrying truncated HSF proteins. The endogenous HSF1 gene was replaced with HSF derivatives containing the amino acids indicated. Those beginning at aa 1 used the HSFJ promoter; those beginning at aa 65 used the GALI promoter. The left-most strain is a normal diploid strain (YJB97) shown for comparison; the remaining strains are in a common genetic background of YJB165. In this latter background, HSF1-583 and HSF133 are expressed from YEplacl81. HSF65"33 and HSF65-583 are expressed from YCpGAL3. Cells were grown at 28°C and then assayed for ,B-galactosidase activity directly or after 1 h at 37°C.

activity after heat shock, as assayed by the ability of these HSF proteins to drive expression of an HSE-lacZ reporter gene. By contrast, removal of both domains (HSF6,583) results in an HSF derivative that cannot drive high-level expression after heat shock. It apparently does retain some activity as a transcriptional activator, presumably dependent on a third region that is not deleted in this HSF derivative. Comparison of HSF1-583 with HSF65583 indicates that the former must utilize the N-terminal transcriptional activator, while comparison of HSF65-33 with HSF61583 indicates that HSF65-33 must utilize the C-terminal activator. As neither of these transcriptional activators exhibits temperature-dependent regulation when fused to heterologous DNA-binding domains, it follows that their regulation in the context of HSF depends on the ability of the central portion of HSF (between aa 65 and 583) to repress their activity at low temperature. HSF can down-regulate a heterologous transcriptional activator. To investigate the mechanism whereby HSF represses its own transcriptional activation domains at low growth temperatures, we sought to determine whether it would be possible for HSF to block the activity of a heterologous transcriptional activator. For this purpose, we chose the VP16 transcriptional activation domain, which has been shown to be a highly effective transcriptional activator, even in yeast cells (22, 34). We constructed several HSF-VP16 fusions in an appropriate plasmid for the regulated expression of these fusion proteins in yeast cells (see Materials and Methods). The relevant portions of these constructions are illustrated in Fig. 2. These HSF derivatives, expressed under different conditions, give rise to a very large number of possible pairwise comparisons; because of limitations of space, we will discuss only those that we consider most significant. To give the reader full access to the data, we

MOL. CELL. BIOL.

BONNER ET AL.

1024

R I

I

B

V

M

DBD I I ~ i DBD ,

N

R

S

~~ILR , ~~~~~~~~~~I .- lI

N ) _'l

CX q

I

I

I

t

Le)

HSF1 -33 HSF 65-833 HSF 1-583 HSF 65-583

HSF65 VP16 HSF65482 HSF - VP16 HSF 65-381 HSF 6-381 VP16 HSF 1583VP16

......

.

FIG. 2. HSF derivatives used in this study. The upper map represents the HSF protein: shown are the locations of the DNA-binding domain (DBD), as defined by Wiederrecht et al. (35), the isoleucine repeat (ILR) that is involved in oligomerization (31), and the restriction sites used in the constructions. Below are representations of the HSF derivatives constructed for this study. The solid line represents HSF sequences; the boxes represent VP16 sequences. Relevant restriction enzyme sites: R, EcoRI; B. BamHI; V. EcoRV; M, MscI; N, NheI; S, StuI. Each number indicates the amino acid residue at that point in the map.

present the results of these and other analyses both as histograms and as tables. A series of strains was constructed in which the endogenous HSFJ gene was replaced by the HSF-VP16 plasmids. The resultant strains were analyzed for their abilities to express 3-galactosidase at normal growth temperature and after heat shock. First, consider the addition of the VP16 transcriptional activator to the HSF derivative, HSF65-583. As already shown, this portion of HSF alone was unable to support high-level transcriptional activation after heat shock. Addition of the VP16 domain (HSF65-583 VP16) restored temperature-dependent transcription (Fig. 3A and Table 2). This finding indicates that (i) the VP16 transcriptional activation domain appears to function in the context of the HSF protein, as expected, (ii) the dysfunction of HSF65-583 is a result of the loss of a transcriptional activator,

A * 28°

8-

I 'ico

Ea

37'

T

B

* 28°

100 0

°

a

6-

as suggested above, and (iii) HSF can repress not only its own transcriptional activators but also that of VP16. The ability of HSF to repress the VP16 transcriptional activator as well as its own transcriptional activators, coupled with its ability to repress both N-terminal and C-terminal activation domains, suggests that the low-temperature repression function is likely contained within the central portion of HSF. In an effort to map this function, we removed additional portions of HSF in the VP16 fusions (Fig. 2). First, consider the effects of removal of material on the C-terminal side of the HSF portion of the fusion. As shown in Fig. 3B and Table 2, the less HSF material is present in the fusion protein, the less good is the downregulation of the VP16 transcriptional activator. HSF65482 VP16 exhibits considerably greater activity than does HSF65-583 VP16, at both 28 and 37°C, and

T

2 37°

80

0

0o 'as

caCT

4-

20con 40-

'a

-T

2-

200 HSF 65-583

HSF 6!i5-583 VP1 6

V IH PT-F -6 HSF 65-583 VP1 6

HSF

65-482

VP1 6

HSF 65.381 VPI 6

1

6558 VP16 HSF 165-583 VP1 6

HSF derivative HSF derivative FIG. 3. P-Galactosidase activities of strains with HSF derivatives. The endogenous HSF1 gene of strain YJB165 was replaced with plasmids expressing the indicated proteins. Cells were grown at 28'C and then assayed for P-galactosidase activity directly or after 1 h at 37°C. (A) Effect of adding the VP16 transcriptional activator to HSF65583: (B) comparison of various HSF-VP16 fusions. Complete data are presented in Table 2.

VOL. 12, 1992

REGULATION OF HSF ACTIVITY

1025

TABLE 2. Activities of HSF-VP16 fusions with no wild-type HSF presenta >

H v-Galactosidase activity (U) HSF derivative 2°37C 280C 370C

HSF1833 HSF65-583 HSF6381 . VP16 HSF64822 VP16 HSF65583. VP16 HSF16 583. VP16

37°C/28°C 37C2C

0.36 ± 0.04 38.25 ± 4.2 7.23 ± 0.99

0.22 + 0.14 27.24 ± 3.5

1.67 + 1.0 0.56 ± 41.76 ± 27.04 ± 6.87 ± 82.48 ±

0.21

6.8 6.1 2.2 24.8

>

LO

(D

L

0.35 ± 0.24

>

Ratio, 4.8 1.5 1.1 3.7 31.2 3.0

cn

LL

uz

L

Co

LL

u)

L

CC

Xn

U

C

LL

co

LL

uz

a Plasmids encoding the indicated HSF-VP16 fusions, and relevant controls, were used to replace the endogenous HSF gene in strain YJB165, containing HSE-lacZ integrated into the genome. Integration of the reporter results in lower levels of activity than does use of an episomal reporter but offers stability of copy number and prevents saturation of the cells' capacity for ,3-galactosidase synthesis. Cultures were grown at 28°C and shifted to 37°C for 1 h; 3-galactaosidase activity was then determined. Each entry represents the average of three independent cultures.

HSF115-381 VP16 exhibits even more activity. This finding suggests that the ability to down-regulate the VP16 domain is not a simple function of a single regulatory domain of HSF but instead depends on the integrity of the protein overall. If we now consider not the absolute values of I-galactosidase activity in these strains but rather the ratio of activities before and after heat shock, we can gain some information about the ability of HSF to respond to a temperature shift. In this particular strain, full-length HSF (HSF1133) responds to the 28-*37°C shift by elevating its activity 4.8-fold (Table 2). While not particularly dramatic, this increase nonetheless represents the magnitude of the effect in this strain. By contrast, the HSF65-583 * VP16 fusion protein exhibits a 31-fold change in activity under the same conditions. This greater temperature response probably reflects the high inherent activity of the VP16 transcriptional activator; this idea is supported by the observation that most of the difference is in the level of activity at 37°C. The HSF65482 . VP16 fusion shows a much reduced temperature response, more similar to that of the full-length HSF protein itself. This finding indicates that although down-regulation of the VP16 domain is impaired in this fusion, there is nonetheless some residual ability to respond to temperature upshift. That is, if there is a regulatory domain in the HSF protein, that domain has not been completely destroyed by deleting the material between aa 482 and 583. Such a regulatory region apparently is destroyed, however, in the HSF63811 VP16 fusion, which exhibits high activity at 28°C and virtually no increase in activity upon shift to 37°C. Removal of HSF sequences on the N-terminal side of the fusion has an effect similar to that of removal of C-terminal material. HSF165-583 * VP16 shows highly elevated activity at both 28 and 37°C but nonetheless retains some ability to respond to temperature upshift. We interpret these data to indicate that there is a region in the central part of the HSF protein, between aa 165 and 482, that is important for temperature responsiveness. We will elaborate on this idea in Discussion. It is important for these studies to rule out, as far as possible, the mimicking of temperature-dependent regulation of HSF by trivial means. Given that the activity of these HSF derivatives can replace the essential HSFJ gene at all temperatures thus far tested, it is apparent that they are capable of functioning as transcription factors and that they

FIG. 4. Immunoblot analysis of HSF-VP16 fusions. Extracts were prepared from cells of strain YJB165, carrying the indicated HSF derivatives as their sole source of HSF activity. Cells were grown at 28°C (left lane of each pair) or shifted to 37°C for 16 h (right lane). VP16 derivatives show similar activities at 1 and 16 h after temperature shift (not shown); therefore, the longer time was chosen to maximize our ability to detect changes in protein levels. Amounts of extracts from equal numbers of cells were run on a 10% SDS-polyacrylamide gel, blotted onto nitrocellulose, and probed with antibody raised against an HSF-glutathione S-transferase fusion. The low-molecular-weight bands are either degradation products of the fusion proteins or cross-reacting material; multiple bands of HSF derivative proteins are likely the result of phosphorylation-induced electrophoretic variation.

must drive expression of endogenous heat shock protein genes. The fusion proteins must, therefore, be able to enter the nucleus and bind DNA at all temperatures, just like wild-type HSF. The unlikely possibility that their concentrations increase dramatically with temperature is ruled out by immunoblot analysis performed with cells grown under conditions that should maximize what differences there might be (Fig. 4). There are clearly differences among strains; in particular, HSF6,5X2 VP16 is less abundant than the others. Nonetheless, all of the HSF derivatives are more abundant than wild-type HSF in standard strains (not shown) and may well be in sufficient excess that DNA binding is not the rate-limiting step in our assays. Unfortunately, HSF16 583. VP16 was not immunoreactive, possibly because the major epitopes of our antiserum are N terminal to aa 165. We conclude that the 3-galactosidase activities we have measured likely reflect the activities of these proteins as transcriptional activators, not protein concentration or localization. The ,-galactosidase activities of the strains containing the VP16 derivatives are generally higher than those from cells carrying normal, wild-type HSF. This result suggested that the VP16 derivatives might be functionally dominant. To determine whether this might be so, and to determine whether the behaviors of the HSF-VP16 fusions might be strain dependent, we transformed the various HSF plasmids into YJB97, a strain that retains its HSFJ genes. YJB97 has a genetic history different from that of YJB165 and should provide a good test of strain dependence. Furthermore, it exhibits a lower basal level of HSE-lacZ expression than does YJB165, which we interpret to be an indication of fewer stress mutations in its genetic background.

MOL. CELL. BIOL.

BONNER ET AL.

1026

TABLE 3. Activities of HSF-VP16 fusions in the presence of wild-type HSF"

S-Galactosidase activity (U)

HSF1-833

HSF65-381t VP16 HSF65482 VP16 HSF65-583 VP16 HSF165-583 VP16

HSF65-381 HSF65-482 HSF65-583

Ratio,

37°C/28°C 3C2~

2°37C 37'C 280C

HSF derivative

0.049 7.86 0.84 0.06 4.04 0.06 0.11 0.06

± ± ± ± ± ± ± ±

5.40 10.2 6.58 2.39 30.0 2.82 0.34 1.11

0.04 0.02 0.35 0.02 1.38 0.04 0.07 0.03

+ ± + ± ± ± ± ±

0.74 1.07 1.07 0.14 6.41 0.21 0.11 0.3

110.2 1.3 7.8 39.8 7.4 47.0 3.1 18.5

a Plasmids encoding the indicated HSF derivatives were transformed into strain YJB97 and assayed as indicated for Table 2. Use of YJB97 facilitated determination of functional dominance of the HSF derivatives.

The complete data set is presented in Table 3. To facilitate comparison with the data previously discussed, we present in Fig. 5 the data from the VP16 fusions in the same format as in Fig. 3B. Except for the absolute values of 3-galactosidase activities, which reflect the genetic background, the behaviors of the strains carrying the VP16 fusions are similar to those of the previously analyzed strains. This result indicates that the VP16 fusions are functionally dominant. This finding is not overly surprising, since the VP16 fusions are expressed from the GAL] promoter and are present at levels considerably higher than that of the endogenous HSF (confirmed by immunoblot analysis as in Fig. 3 [data not shown]). HSF6538'. VP16 shows the highest activity at 28°C and almost no response to temperature shift. HSF65182 VP16 and HSF165-583 VP16 show significantly elevated levels of activity, with diminished, but not abolished, temperature response. HSF65-583 VP16 shows the lowest level of activity of all of the VP16 fusions. It is difficult to ascertain whether it is functionally dominant, however, because the 3-galactosidase activities of the strain carrying this fusion

are not significantly different from those of the parent strain itself. These results indicate that the regulatory properties of the VP16 fusions are not highly strain dependent and that the fusion proteins can outcompete the normal HSF protein. One HSF derivative has a dominant negative phenotype. The presence of wild-type HSF also allowed us to analyze, to some extent, the functions of the HSF derivatives lacking the VP16 transcriptional activation domain. Whereas HSF65-583 retains sufficient activity for viability at 24°C, HSF65482 and HSF65-381 do not. These latter two proteins, therefore, could not be analyzed in the HSFJ deletion strain. Of course, in the presence of wild-type HSF, it is possible to examine for these proteins only those aspects of function that might be dominant. As is evident from Table 3, neither of these HSF derivatives improves the expression of the f3-galactosidase reporter gene. Surprisingly, cells expressing HSF65-482 showed lower heat shock-induced ,-galactosidase activities than did cells expressing only wild-type HSF, suggesting that this HSF derivative actually interferes with the ability of the normal protein to function. Conceivably, this finding reflects competition by a protein that can bind DNA but that lacks any transcriptional activation function. Isolation of point mutations that impair low-temperature repression. The results reported above suggest that a central region of HSF, from aa 165 to 482, is essential for temperature responsiveness. This finding is consistent with the results of Nieto-Sotelo et al. (19), who concluded that aa 208 to 394 mediated low-temperature repression. However, Jakobsen and Pelham (13) proposed that a short stretch of amino acids conserved between Saccharomyces and Kluyveromyces HSF proteins, which they called CE2 (aa 536 to 551), played a significant role in this function. CE2 is present in our most highly regulated VP16 fusion, HSF65-583 VP16, and is absent from HSF65-481 VP16, which shows some elevation of activity at low temperatures. This finding suggests that both CE2 and the central domain of HSF contribute to the overall regulation of the transcriptional activation domain of VP16.

40

*

28-

i

37°

I

30 0 a 0 co -

20 0 0

10 -

O-~

HSF 1-833

HSF 65-583 VP16

HSF 65-482 VP16

HSF 65-381 VP16

HSF 165-583 VP16

HSF derivative FIG. 5. ,B-Galactosidase activities of strains with HSF derivatives. Plasmids expressing the indicated HSF derivatives (or vector alone, indicated by HSF1-833) were transformed into YJB97. diploid for the endogenous HSFJ gene. The HSF derivatives are those shown in Fig. 3B and exhibit the same relative activities, indicating that the VP16 fusions can be functionally dominant. Complete data are presented in Table 3.

VOL. 12, 1992

REGULATION OF HSF ACTIVITY

1027

TABLE 4. Activities of HSF65583 VP16 mutants with no wild-type HSF presenta

HSF6s583. VP16 derivative

Nonmutant control Blb B2b C3b A8b Ala A2a

P-Galactosidase activity (U) 260C

± ± ± ± ± ± ± 583

0.10 1.31 26.6 1.45 2.09 20.3 20.5

37°C

0.05 1.0 7.1 0.09 1.9 0.5 1.6

9.7 29.1 88.0 31.6 35.0 68.7 57.0

± 1.3 ± 5.6 ± 14.9

+ 7.8 ± 7.3 ± 19.9 ± 18.1

Ratio, mutant/control

Ratio, 370C/260C

26°C

370C

97.0 22.2 3.3 21.8 16.8 3.4 2.8

1.0 13.1 266.0 14.5 20.9 203.0 205.0

1.0 3.0 9.1 3.2 3.6 7.1 5.9

3-galactosidase

a Plasmids encoding the six mutant HSF6 VP16 fusions were used to replace the endogenous HSF gene in strain YJB165; activity was measured for cultures grown at 26°C or shifted to 37'C for 16 h, the time at which 3-galactosidase activities were maximal for cells carrying either YEpHSF1 or the VP16 fusions.

To ascertain whether the central domain or CE2 might be functionally more important in the regulation of HSF activity, we performed a simple mutagenesis experiment. We reasoned that point mutations that increase the transcriptional activation activity of HSF at 240C (that is, mutations that impair low-temperature repression) would identify those amino acids that are most important in this function. To facilitate the isolation of such mutants, we took advantage of the fact that the unmasked VP16 derivatives are dominant to wild-type HSF and drive expression of the reporter gene at high levels. We mutagenized the HSF"583 VP16 gene by PCR amplification under conditions of relatively low fidelity (5), using primers spanning aa 212 to 583. This region encompasses CE2, most of the DNA-binding domain, and the region implicated by our VP16 fusions and by Nieto-Sotelo et al. (19) as the temperature-responsive domain. The PCR product was reincorporated into the plasmid by recombinational repair in yeast cells (16) upon transformation into YJB166. Mutants were selected by the ability of the HSF derivatives to drive high-level expression of a HSE-HIS3 reporter gene; mutants formed colonies at 24°C on plates lacking histidine and containing 20 mM 3-aminotriazole. Six mutant HSF-VP16 fusions were recovered. Their abilities to drive expression of the ,-galactosidase reporter gene were assayed first in the absence of wild-type HSF (Table 4). The mutants fell into two classes. Three weak mutants were partially deregulated, exhibiting a 10-fold increase in activity at 26°C and retaining a moderate temperature response. The remaining three strong mutants were highly deregulated, exhibiting a greater than 200-fold increase in activity at 26°C and reduced temperature responsiveness. Assays of the mutants in the presence of wild-type HSF (Table 5) showed that although all were semidominant

wild-type HSF, the strong mutants were less effective P-galactosidase expression under these conditions. This finding suggests that the mutant defect in this class of mutations impairs some function required for activity as well as the ability of the protein to down-regulate the VP16 transcriptional activation domain. The DNA sequences of the mutant plasmids were determined. All mutations that were recovered are listed in Table 6. For three mutants, Blb, Ala, and A2a, there was only a single missense mutation (the other base changes were silent). For mutant C3b, the two mutations were separated by subcloning; the phenotypically relevant mutation was at codon 538. For B2b, the mutations were partially separated; the phenotype mapped to the pair of mutations valine 232-alanine 404. Although we did not separate these last two mutations, we suspect that the alanine 404 mutation is phenotypically silent, as the valine 232 mutation alone is found in mutants Ala and A2a, which exhibit the same phenotype. The three strong mutants thus all share a single base change, converting methionine 232 to valine, yet each contains a different array of silent mutations, indicating that the three are not repeat isolates of the same clone. Thus, it is probable that methionine 232 is fundamental to the mechanism of low-temperature repression. This amino acid is within the DNA-binding domain of HSF and within the central region to which we map the function essential for temperature responsiveness. The three weak mutations represent two separate isolates of leucine 539-*proline and one of leucine 538--serine. These are within region CE2. The point mutations are consistent with the deletion analysis and suggest that CE2 contributes somewhat to low-temperature repression of HSF, while the central doover

at elevating

TABLE 5. Activities of HSF65583 VP16 mutants in the presence of wild-type HSF'

HSF,6513 . VP16 derivative

Nonmutant control Blb B2b C3b A8b Ala A2a

3-Galactosidase activity (U) 26°C

0.03 0.15 0.25 0.18 0.21 0.10 0.14

± 0.03 ± 0.02 t 0.06 t 0.07 ± 0.11 ± 0.03 ± 0.04

37°C

2.8 4.3 3.5 2.9 3.8 2.0 2.1

t

0.21

± 0.66

0.85 0.10 0.33 0.59 + 0.64

+ ± ± ±

Ratio, mutant/control

Ratio, 37OC/26°C

26°C

37°C

93.3 28.7 14.0 16.1 18.1 20.0 15.0

1.0 5.0 8.3 6.0 7.0 3.3 4.7

1.0 1.5 1.2 1.0 1.3 0.7 0.8

a Plasmids encoding the six mutant HSF"583 VP16 fusions were transformed into strain YJB97 to assess functional dominance; measured as indicated for Table 4.

3-galactosidase activity was

1028

MOL. CELL. BIOL.

BONNER ET AL. TABLE 6. Locations of mutations"

Mutant

Weak Blb A8b

C3b Strong B2b

Mutation responsible for phenotype Base aa change change

T-*C T-*C

Leu-539--Ser Leu-538-*Pro

T-*C

Leu-538--*Pro

Phenotypically silent mutation Base

change

aa change

A-*G T- C A--+G A- T

None (Glu-576-*Glu) Ser-286--*Ser

Lys-490--*Arg Arg-385-*Ser

Val-404--Ala Ile-442--+Arg Asn-558-*Asp None (Thr-439--3Thr) Met-232-*Val A-*G Ala A-+G Met-232--*Val None (Leu-336--+Leu) A2a a All base changes found in the mutant fusion genes are noted. The assessment of whether a missense mutation was phenotypically silent was from physical separation of the mutations (for C3b and, at least in part, for B2b) and from recognition that the same mutation alone exhibits the same phenotype (A8b versus C3b after separation of mutations; Ala and A2a versus B2b after separation of mutations). A- G

Met-232--+Val

main is likely to contain the major determinants of temperature responsiveness.

DISCUSSION Previous reports (19, 29) have demonstrated that HSF contains several domains that can function as constitutive transcriptional activators when fused to heterologous DNAbinding domains. These results suggest that the normal mode of action of HSF is to hinder the effectiveness of these domains at low temperature, with relief of this hindrance occurring upon temperature upshift. Thus, the central question of HSF regulation is how low-temperature repression is achieved and how it is relieved. The location of the low-temperature repression, or masking, domain has been sought in a number of different studies. Perhaps most fundamental to the current models of masking is Sorger's observation (29) that deletion of the N-terminal 146 aa resulted in constitutive activity. He proposed, therefore, that an N-terminal masking domain interacted with the C-terminal transcriptional activator to block its function. This model suggests that an HSF monomer may be essentially folded in half, such that its N and C termini are in proximity. This is a useful model in that it implies that the accessibility of the C-terminal transcriptional activator may be impaired by the presence of another protein domain. The model further implies that relief of low-temperature repression on heat shock would occur through a conformational change that moves the transcriptional activator away from the masking domain. The data of Jakobsen and Pelham (13), demonstrating that deletion of CE2 resulted in constitutive activity, suggested a mechanism for maintaining a folded HSF structure. They proposed that CE2 formed a specific contact with another region of HSF, thereby stabilizing the folded state. The notion that at low temperature, HSF is folded such that one portion of it interferes with the ability of its transcriptional activators to function is largely consistent with our findings. HSF65-583 VP16 is fully repressed at low temperature and retains both CE2 and most of its N-terminal region. It could well be repressed by the mechanism proposed by Jakobsen and Pelham (13). HSF65 82. VP16 has a higher level of activity overall and is less well repressed at low temperature. This is consistent with the idea that deletion of CE2 in this fusion decreases the stability of the folded

T- C T-*G A--G A- G A-*G

structure, consequently decreasing the ability of HSF to restrain the activity of the VP16 domain. HSF65-583. VP16 has a higher level of activity as well and, although it retains CE2, lacks the masking domain at the N terminus. This truncated domain just may not be big enough to restrain VP16 completely. It is somewhat surprising that the VP16 domain of these fusions can be restrained at all by HSF. The sequence of VP16 is quite unlike that of HSF's C-terminal domain. Furthermore, there is a great difference in the overall size of the two polypeptide segments, VP16 being roughly one-third the size of the HSF segment that it replaces. It therefore seems unlikely that a masking domain of HSF would be able to make specific contacts with the heterologous VP16 domain. This suggests to us the more general model that the folded structure of HSF5583 VP16 is determined by a central regulatory domain of HSF, with the consequence that the transcriptional activation domain is brought into proximity to another domain of the protein, rendering the VP16 domain relatively inaccessible to the transcriptional apparatus. Upon temperature upshift and, presumably, phosphorylation, the regulatory domain would undergo a conformational change, moving the VP16 domain to a position of increased accessibility. Thus, low-temperature repression of HSF65583. VP16 breaks down into two components. First, the protein must adopt its characteristic, folded structure. It is this structure that is altered by the heat shock-induced conformational change. Second, another portion of the protein must physically interfere with the accessibility of the VP16 domain while it is in its low-temperature conformation. We suggest that HSF65-583. VP16 affects the latter process, while HSF65-381 VP16 affects the former. This suggestion is based on the retention by HSF165583 VP16, but not by HSF115-381 VP16, of residual temperature responsiveness. The observation that the fusions that utilize the smaller portions of HSF exhibit generally elevated activities also indicates that the VP16 domain of HSF65-583 VP16 is not fully activated even at 37°C. Perhaps this results from a poor orientation relative to the transcriptional apparatus in this particular fusion, but it is interesting to speculate that it may be a direct consequence of the repression function of HSF itself. Perhaps the VP16 domain is so well repressed in this protein because the N-terminal masking domain, normally intended to function with a larger C-terminal transcriptional -

REGULATION OF HSF ACTIVITY

VOL. 12, 1992

activator, cannot be moved sufficiently far from VP16 to unmask it completely. Where, then, is the domain responsible for the formation of the low-temperature conformation? On the basis of the temperature responsiveness of our VP16 fusions, we suggest that it lies between aa 165 and 482. On the basis of the AP1 fusions of Nieto-Sotelo et al. (19), we can narrow this region to aa 208 to 394. We suggest that this central domain itself adopts a folded conformation whose structure is altered upon heat shock. We envision that the role of the N-terminal masking domain (29) is to help interfere with the transcriptional activators but not to maintain the folded structure per se. Similarly, the role of CE2 (13) appears to be to help stabilize the folded structure once it has formed. The idea that the central region of HSF is itself capable of temperature-dependent regulation is supported by several arguments. First, the mapping studies of Nieto-Sotelo et al. (19), as well as those reported here, indicate the importance of this region. Second, our strongest point mutations that impair low-temperature repression lie within this region. Third, temperature-dependent regulation is a common property of HSF proteins in general and is thus likely to depend on a conserved structure. Alignment of the amino acid sequences of HSF proteins from S. cerevisiae (32, 35), Kluyveromyces lactis (13), Drosophila melanogaster (4), and Lycopersicon esculentum (24) reveals only a short stretch of conserved sequence, including the DNA-binding and multimerization domains (aa 172 to 406 of S. cerevisiae). This region fully encompasses the part of the molecule in which we map the temperature-dependent regulation function. We have thus far studied low-temperature repression only in the VP16 fusions reported here. However, it is reasonable to suggest that the structural model proposed here is relevant to normal HSF proteins. Consider, for example, that the N-terminal deletion derivative, HSF55833, is in many ways equivalent to our most highly regulated fusion, HSF,65-583 -VP16. It is likely that the mechanisms of regulation in these two proteins are similar. Second, consider the observation that HSF1583 (discussed above) exhibits normal temperature regulation. As with the C-terminal transcriptional activator, the mechanism of regulation in this HSF derivative is achieved by repression of activity at low temperature. The regulatory properties of these different proteins are so similar that it seems likely that they rely on similar mechanisms. As all retain the same, evolutionarily conserved region that is important for regulation of the VP16 fusions, we suggest that the model that we have proposed above is appropriate for the normal HSF protein itself. Given the evolutionary conservation, it is likely to be a common regulatory mechanism for HSF proteins in general. If the central region of HSF is the major determinant of temperature-dependent regulation, it is striking that it affects transcriptional activators on both its N- and C-terminal sides. Comparison of HSF1-583, HSF65-833, and HSF65583 suggests that this is the case. It is also striking that for down-regulation of the N-terminal transcriptional activator, the CE2 domain is unnecessary. Numerous C-terminal deletions have been analyzed (13, 19, 29), among them those that lack both CE2 and the C-terminal transcriptional activators, yet these HSF derivatives are perfectly capable of apparently normal temperature-dependent regulation. We suggest that in such proteins, as in normal HSF, the transcriptional activation domain is restrained in the inactive conformation by being relatively inaccessible in the DNAbound hexamer. When the conformation of the regulatory region changes during heat shock, and the overall conforma-

1029

tion of the DNA-protein complex changes in consequence, the N-terminal transcriptional activation domain becomes more accessible. Our point mutations help to give us some insights into the regulatory mechanism. First, they indicate that structural integrity of region CE2 is important for full low-temperature repression, at least of C-terminal transcriptional activators, but that single-point mutations in this region do not eliminate regulation. It is possible that a more dramatic structural alteration, such as that introduced into HSF by Jakobsen and Pelham (13), would give full activation of HSF when examined in our strains (with a low-copy HSE-lacZ reporter), but this possibility remains to be tested. We currently envision that such mutations primarily alter the alignment of the downstream transcriptional activation domain relative to upstream structures such that the transcriptional activator cannot be fully sequestered. In contrast, conversion of methionine 232 to valine has a very dramatic effect, releasing low-temperature repression almost completely. This would suggest that methionine 232 is intimately involved in the maintenance of the repressed state of HSF, although the exact role of this residue is not yet apparent. The location of methionine 232 within the DNA-binding domain suggests that this domain may have a dual function: protein-DNA interaction and protein-protein interaction. There are now three different amino acids known at position 232 in functional HSF proteins. Methionine is found in Saccharomyces (32, 35), Kluyveromyces (13), and Drosophila (4) cells. Threonine is found in Lycopersicon (24) cells. In our mutants, valine is found at this position. Valine differs from these other two amino acids in lacking the polarity of the sulfur/oxygen atom, which may be important for formation of the repressed state of HSF. It is interesting to speculate that this residue may even participate in a specific interaction, such as a hydrogen bond, with another conserved residue and that this interaction may be broken by

phosphorylation.

The location of methionine 232 within the DNA-binding domain also offers, perhaps, a partial explanation of the finding that HSF proteins other than that of S. cerevisiae are unable to bind DNA when in their inactive conformation. If the DNA-binding domain is tied up in an interaction with a nearby portion of the protein, then it would be easy to see that the DNA-binding domain itself could be masked in the inactive form of HSF. Only after the conformational change that occurs on heat shock, and the breaking of the possible contact with methionine 232, would the DNA-binding domain become exposed. In this sense, it is surprising that the yeast protein remains capable of binding DNA at low temperature. In summary, we have shown that a portion of HSF is capable of regulating the activity of a heterologous transcriptional activation domain and have determined some of the characteristics of the regulatory mechanism. The isolation of point mutations has begun to focus our attention on a specific region of the HSF protein and moves our understanding of the mechanism to a somewhat higher level of resolution. If, as we suspect, methionine 232 is involved in a contact with another nearby residue in the central, conserved region of HSF, then additional mutations may prove to

identify this contact.

ACKNOWLEDGMENTS This work was supported by grants PHS RO1 GM26693 and BRSG RR7031-25 from the National Institutes of Health. S.H. was

1030

BONNER ET AL.

supported by a grant from the Howard Hughes Medical Institute Undergraduate Initiative. We are particularly grateful to Tom Fox for advice on PCR mutagenesis. REFERENCES 1. Boeke, J. D., F. Lacroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-347. 2. Bonner, J. 1991. Vectors for the expression and analysis of DNA binding domains in yeast. Gene 104:113-117. 2a.Bonner, J. J. Unpublished data. 3. Breeden, L., and K. Nasmyth. 1985. Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol. 50:643-650. 4. Clos, J., J. T. Westwood, P. B. Becker, S. Wilson, K. Lambert, and C. Wu. 1990. Molecular cloning and expression of a hexameric Drosophila heat shock factor subject to negative regulation. Cell 63:1085-1097. 5. Eckert, K. A., and T. A. Kunkel. 1990. High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase. Nucleic Acids Res. 18:3739-3744. 6. Edelman, A. M., D. K. Blumenthal, and E. G. Krebs. 1987. Protein serine-threonine kinases Annu. Rev. Biochem. 56:567614. 7. Ellwood, M. S., and E. A. Craig. 1984. Differential regulation of the 70K heat shock gene and related genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 4:1454-1459. 8. Flick, J. S., and M. Johnston. 1990. Two systems of glucose repression of the GAL] promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:4757-4769. 9. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534. 10. Guarente, L., and T. Mason. 1983. Heme regulates transcription of the CYCl gene of S. cerevisiae via an upstream activation site. Cell 32:1279-1286. 11. Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 12. Jakobsen, B. K., and H. R. B. Pelham. 1988. Constitutive binding of yeast heat shock factor to DNA in vivo. Mol. Cell.

Biol. 8:5040-5042. 13. Jakobsen, B. K., and H. R. B. Pelham. 1991. A conserved heptapeptide restrains the activity of the yeast heat shock transcription factor. EMBO J. 10:369-375. 14. Kingston, R. E., T. J. Schuetz, and Z. Larin. 1987. Heatinducible human factor that binds to a human hsp70 promoter. Mol. Cell. Biol. 7:1530-1534. 15. Larson, J., T. Schuetz, and R. Kingston. 1988. Activation in vitro of sequence specific DNA binding by a human regulatory factor. Nature (London) 335:372-375. 16. Ma, H., S. Kunes, P. J. Schatz, and D. Botstein. 1987. Plasmid construction by homologous recombination in yeast. Gene 58:201-216. 17. Mosser, D. D., P. T. Kotzbauer, K. D. Sarge, and R. I. Morimoto. 1990. In vitro activation of heat shock transcription factor DNA-binding by calcium and biochemical conditions that affect protein conformation. Proc. Natl. Acad. Sci. USA 87: 3748-3752. 18. Mylin, L. M., J. P. Bhat, and H. E. Hopper. 1989. Regulated phosphorylation and dephosphorylation of GAL4, a transcriptional activator. Genes Dev. 3:1157-1165. 19. Nieto-Sotelo, J., G. Wiederrecht, A. Okuda, and C. S. Parker. 1990. The yeast heat shock transcription factor contains a transcriptional activation domain whose activity is repressed under nonshock conditions. Cell 62:907-817.

MOL. CELL. BIOL. 20. Oettinger, M. A., K. Struhl. 1985. Suppressors of Saccharomyces cerevisiae his3 promoter mutations lacking the upstream element. Mol. Cell. Biol. 5:1901-1909. 21. Sadler, I., A. Chiang, T. Kurihara, J. Rothblatt, J. Way, and P. Silver. 1989. A yeast gene important for protein assembly into the endoplasmic reticulum and the nucleus has homology to DnaJ, an Escherichia coli heat shock protein. J. Cell Biol. 109:2665-2675. 22. Sadowski, I., J. Ma, S. J. Triezenberg, and M. Ptashne. 1988. GAL4-VP16 is an unusually potent transcriptional activator. Nature (London) 335:563-564. 23. Sambrook, J., T., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 24. Scharf, K.-D., S. Rose, W. Zott, F. Schoff, and L. Nover. 1990. Three tomato genes code for heat stress transcription factors with a region of remarkable homology to the DNA-binding domain of the yeast HSF. EMBO J. 9:4495-4501. 25. Schatz, P. J., F. Solomon, and D. Botstein. 1988. Isolation and characterization of conditional-lethal mutations in the TUB] a-tubulin gene of the yeast Saccharomyces cerevisiae. Genetics 120:681-695. 26. Selleck, S. B., and J. E. Majors. 1987. In vivo DNA-binding properties of a yeast transcription activator protein. Mol. Cell. Biol. 7:3260-3267. 27. Sherman, F., G. Fink, and J. Hicks. 1979. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 28. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione-S-transferase. Gene 67:31-40. 29. Sorger, P. K. 1990. Yeast heat shock factor contains separable transient and sustained response transcriptional activators. Cell 62:793-805. 30. Sorger, P. K., M. J. Lewis, and H. R. B. Pelham. 1987. Heat shock factor is regulated differently in yeast and HeLa cells. Nature (London) 329:81-84. 31. Sorger, P. K., and H. C. M. Nelson. 1989. Trimerization of a yeast transcriptional activator via a coiled-coil motif. Cell

59:807-813. 32. Sorger, P. K., and H. R. B. Pelham. 1988. Yeast heat shock factor is an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell 54:855-864. 33. Taylor, W. E., and E. T. Young. 1990. cAMP-dependent phosphorylation and inactivation of yeast transcription factor ADR1 does not affect DNA binding. Proc. Natl. Acad. Sci. USA 87:4098-4102. 34. Triezenberg, S. J., R. C. Kingsbury, and S. L. McKnight. 1988. Functional dissection of VP16, the trans-actovator of herpes simplex virus immediate early gene expression. Genes Dev. 2:718-729. 35. Wiederrecht, G., D. Seto, and C. S. Parker. 1988. Isolation of the gene encoding the S. cerevisiae heat shock transcription factor. Cell 54:841-853. 36. Yamamoto, K. K., G. A. Gonzalez, W. H. Biggs III, and M. R. Montminy. 1988. Phosphorylation-induced binding and transcriptional efficacy of nuclear factor CREB. Nature (London) 334:494-499. 37. Zimarino, V., C. Tsai, and C. Wu. 1990. Complex modes of heat shock factor activation. Mol. Cell. Biol. 10:752-759. 38. Zimarino, V., S. Wilson, and C. Wu. 1990. Antibody-mediated activation of Drosophila heat shock factor in vitro. Science 249:546-549. 39. Zimarino, V., and C. Wu. 1987. Induction of sequence specific binding of Drosophila heat shock activator protein without protein synthesis. Nature (London) 327:727-730.