International Immunopharmacology 25 (2015) 353–362

Contents lists available at ScienceDirect

International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp

Telocinobufagin enhances the Th1 immune response and protects against Salmonella typhimurium infection☆ Shuai-Cheng Wu, Ben-Dong Fu, Hai-Qing Shen, Peng-Fei Yi, Li-Yan Zhang, Shuang Lv, Xun Guo, Fang Xia, Yong-Li Wu, Xu-Bin Wei ⁎ Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, No. 5333, Xi'an Road, Changchun, Jilin 130062, PR China

a r t i c l e

i n f o

Article history: Received 11 October 2014 Received in revised form 24 January 2015 Accepted 3 February 2015 Available online 14 February 2015 Keywords: Telocinobufagin Th1 immune response IFNγ Salmonella typhimurium Ovalbumin

a b s t r a c t Ideal potential vaccine adjuvants to stimulate a Th1 immune response are urgently needed to control intracellular infections in clinical applications. Telocinobufagin (TBG), an active component of Venenum bufonis, exhibits immunomodulatory activity. Therefore, we investigated whether TBG enhances the Th1 immune response to ovalbumin (OVA) and formalin-inactivated Salmonella typhimurium (FIST) in mice. TBG augmented serum OVA- and FIST-specific IgG and IgG2a and the production of IFNγ by antigen-restimulated splenocytes. TBG also dramatically enhanced splenocyte proliferative responses to concanavalin A, lipopolysaccharide, and OVA and substantially increased T-bet mRNA levels and the CD3+/CD3+CD4+/CD3+CD8+ phenotype in splenocytes from OVA-immunized mice. In in vivo protection studies, TBG significantly decreased the bacterial burdens in the spleen and prolonged the survival time of FIST-immunized mice challenged with live S. typhimurium. In vivo neutralization of IFNγ with anti-IFNγ mAbs led to a significant reduction in FIST-specific IgG2a and IFNγ levels and in anti-Salmonella effect in TBG/FIST-immunized mice. In conclusion, these results suggest that TBG enhances a Th1 immune response to control intracellular infections. © 2015 Elsevier B.V. All rights reserved.

1. Introduction To provide effective protection against pathogens, vaccines generally require a potent adjuvant to improve their efficacy. An ideal adjuvant must enhance the ability of a vaccine to induce an appreciative immune response to a particular pathogen, as an incorrect immune response could potentially lead to increased spread of the pathogen [1,2]. A Th1 immune response is essential for controlling intracellular infections, such as those caused by Salmonella typhimurium (ST) and mycobacteria, and Th2 and Th17 immune responses are more effective against extracellular pathogens [3]. Alum, the most widely used adjuvant in human and livestock vaccines, is effective for promoting humoral immunity and a Th2 immune response. However, most currently licensed alum-adjuvanted vaccines fail to elicit a Th1 immune response [4]. The unique capacity of the adjuvant Quil A to stimulate a Th1 immune response makes it ideal for use in vaccines directed against intracellular

☆ This manuscript has been thoroughly edited by American Journal Experts. Editing Certificate will be provided upon request. ⁎ Corresponding author at: Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, No. 5333, Xi'an Road, Changchun, Jilin 130062, China. Tel.: +86 431 87835379. E-mail address: [email protected] (X.-B. Wei).

http://dx.doi.org/10.1016/j.intimp.2015.02.005 1567-5769/© 2015 Elsevier B.V. All rights reserved.

pathogens [5,6]. However, its high toxicity, low stability, and undesirable hemolytic effects limit its clinical applications [7]. Therefore, it is necessary to identify new potential adjuvants, particularly those able to stimulate a Th1 immune response. Chan Su (Venenum bufonis), the dried white secretions of auricular and skin glands of Chinese toads, has been used in China for the treatment of many ailments and diseases, such as sore throat, pain, and even cancer [8,9]. Telocinobufagin (TBG, CHEMBL463273, Fig. 1) isolated from Chan Su has been reported to possess various pharmacological properties, including immunoregulatory [10], anticancer [11], and cardiac effects [12]. Previous studies have shown that TBG has potent stimulatory effects on the lymphocyte proliferation induced by concanavalin (ConA) and lipopolysaccharide (LPS). In addition, TBG markedly enhances the phagocytic activation of peritoneal macrophages. Modulation of these systems can significantly impact both humoral and cellular immune responses. TBG also increased the production of the Th1 cytokines IFN-γ and IL-2 but suppresses the Th2 cytokine IL-4 in ConA-stimulated mouse splenocytes [10], suggesting that TBG may enhance the Th1 immune response in vivo. To determine whether TBG also enhances the Th1 immune response in vivo, the effect of TBG on the induction of specific immune responses against ovalbumin and formalin-inactivated S. typhimurium (FIST) was evaluated in mice.

354

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

b0.1 endotoxin units/ml) alone or OVA dissolved in saline containing either TBG (10, 20, and 40 μg; b0.1 endotoxin units/ml) or alum (200 μg; b0.1 endotoxin units/ml) on day 1 and day 15. As a control, a group of ICR mice was given two subcutaneous injections of saline. Two weeks after the second immunization, serum and splenocytes were collected for the measurement of OVA-specific antibody concentrations, a splenocyte proliferation assay, cytokine assays, and a CD3+ T cell subset analysis.

Fig. 1. The chemical structure of TBG.

2. Materials and methods 2.1. Primary reagents TBG (HPLC N 99% purity) was purchased from Shanghai PureOne Biotechnology (Shanghai, China). OVA, LPS, and ConA were purchased from Sigma-Aldrich (St. Louis, Missouri, United States). CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) was purchased from Promega (Madison, Wisconsin, United States). Aluminum hydroxide gel was purchased from Hayao Group Biologicals Vaccine Co. Ltd. (Harbin, China). RPMI-1640 medium and fetal calf serum (FCS) were purchased from HyClone (Logan City, Utah, United States). Goat antimouse IgG, IgG1, and IgG2a horseradish peroxidase were purchased from Southern Biotechnology Associates (Birmingham, Alabama, United States). TMB substrate solution was purchased from TIANGEN Biotech Co. Ltd. (Beijing, China). Mouse IFNγ, IL-17A, and IL-4 ELISA kits, PerCP-Cy5.5-anti-CD3, PE-anti-CD4, and FITC-anti-CD8 were purchased from eBioscience (San Diego, California, United States). The AxyPrep Multisource Total RNA Miniprep Kit was purchased from Axygen (Union City, California, United States). The BioRT cDNA First Strand Synthesis Kit was purchased from Bioer Technology (Hangzhou, China). 2.2. Experimental animals Female ICR mice (five weeks old, Grade II) weighing 18–22 g were purchased from the Experimental Animal Center of Jilin University (Changchun, China) and allowed to acclimate for one week prior to use. Rodent laboratory chow and tap water were provided ad libitum. The housing unit was maintained under controlled conditions with a temperature of 24 ± 1 °C, humidity of 50 ± 10%, and a 12/12 h light/ dark cycle. All procedures related to the animals and their care conformed to internationally accepted principles as found in the Guidelines for the Care and Use of Laboratory Animals published by Jilin University. 2.3. Effect of TBG on the induction of specific immune responses against the ovalbumin antigen in mice 2.3.1. Immunization Female ICR mice were divided into six groups, each consisting of five animals. ICR mice were immunized subcutaneously with OVA (100 μg;

2.3.2. Measurement of OVA-specific antibody concentrations OVA-specific antibody concentrations of total IgG, IgG1, and IgG2a in serum were detected by an indirect ELISA. In brief, microtiter plates were coated with 100 μl of OVA solution (50 μg/ml) in 50 mM carbonate-bicarbonate buffer (pH 9.6) for 24 h at 4 °C. The wells were washed three times with 200 μl of PBS containing 0.05% (v/v) Tween 20 (PBST) and then blocked with 150 μl of 5% FCS/PBS for 2 h. After three washes with PBST, 100 μl of diluted serum samples was added to triplicate wells. The plates were then incubated for 2 h followed by three washes with PBST. Aliquots of 100 μl of goat anti-mouse IgG, IgG1, or IgG2a horseradish peroxidase conjugate (diluted 1:5000) were added to each well. The plates were further incubated for 1 h. After three washes, 100 μl of TMB substrate solution was added to each well. The plates were incubated for 10 min, and the enzymatic reaction was terminated by adding 100 μl per well of 2 M H2SO4. The optical density (OD) of each well was measured with an ELX800 ELISA reader (Bio Tek Instruments, Winooski, Vermont, United States) at 450 nm. 2.3.3. Splenocyte isolation and proliferation assay Splenocytes from the immunized mice were prepared before being seeded into a 96-well microtiter plate at a concentration of 5.0 × 106 cells/ml in 50 μl of complete medium. In addition, ConA (5 μg/ml), LPS (10 μg/ml), OVA (10 μg/ml), or medium was added to each well, resulting in a final volume of 100 μl per well. The plates were incubated at 37 °C in 5% CO2 for 48 h. After 44 h, 20 μl of MTS solution was added to each well and incubated for 4 h. The absorbance was then evaluated in an ELX800 ELISA reader at 490 nm. The stimulation index (SI) was calculated based on the following formula: SI = ODMitogen-stimulated cultures/ODNon-stimulated cultures. 2.3.4. Cytokine measurements by ELISA Splenocytes from the immunized mice were prepared before cells were cultured at a concentration of 2.5 × 106 cells/ml with OVA (100 μg/ml) in 24-well tissue culture plates. After 72 h of incubation at 37 °C in 5% CO2, the plates were centrifuged at 1800 x g for 5 min, and culture supernatants were collected for cytokine assays. The concentrations of IFNγ, IL-4, and IL-17A were determined by capture ELISA according to the manufacturer's instructions. 2.3.5. Quantification of transcription factor gene expression by RT-PCR Splenocytes from the immunized mice were prepared before cells were cultured at a concentration of 2.5 × 106 cells/ml with OVA (100 μg/ml) in 24-well tissue culture plates. After 18 h of incubation at 37 °C in 5% CO2, the plates were centrifuged at 300 ×g for 5 min, and splenocytes were then collected for RNA extraction. For each RT-PCR reaction, 2 μg of total RNA was used to synthesize cDNA using a BioRT cDNA First Strand Synthesis Kit (Bioer Technology, Hangzhou, China). The primers used are shown in Table 1. The parameters of the PCR reactions were as follows: 94 °C for 3 min for one cycle; 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 45 s for 30 cycles; 72 °C for 5 min for one cycle. The amplified PCR products were analyzed on a 2% agarose gel and visualized with ethidium bromide staining and UV irradiation. β-Actin was used as an internal calibrator. The relative ratio of target gene/β-actin = expressiontarget gene/expressionβ-actin.

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362 Table 1 Sequences of primers used for RT-PCR. Gene

Primer sequence

Product size (bp)

Accession number

β-Actin

Forward: TGCTGTCCCTGTATGCCTCT Reverse: TTTGATGTCACGCACGATTT Forward: GTTCCCATTCCTGTCCTTCA Reverse: ATGCTGCCTTCTGCCTTTC Forward: CCAGGCAAGATGAGAAAGAGT Reverse: CATAGGGCGGATAGGTGGTA Forward: GAAGGCAAATACGGTGGTGT Reverse: GTGTAGAGGGCAATCTCATCC

224

NM_007393.3

144

NM_019507.2

150

NM_008091.3

128

AJ132394.1

T-bet GATA-3 RORγt

2.3.6. CD3+ T cell subset analysis by flow cytometry Splenocytes were prepared as previously described before being resuspended in PBS. Collected cells were stained with PerCP-Cy5.5-antiCD3, PE-anti-CD4, and FITC-anti-CD8 for 30 min at 4 °C. After being washed twice with PBS, samples were resuspended in 0.5 ml of fixing solution and then analyzed using a FACSCalibur Flow Cytometer (BD Biosciences Pharmingen, San Diego, California, United States).

355

2.4.4. Cytokine measurements by ELISA Splenocytes from the immunized mice were prepared before cells were cultured at a concentration of 2.5 × 106 cells/ml with FIST (105 CFU/ml) in 24-well tissue culture plates. After incubation for 72 h at 37 °C in 5% CO2, the plates were centrifuged at 1800 ×g for 5 min, and culture supernatants were collected for cytokine assays. The concentrations of IFN-γ, IL-4, and IL-17A were determined by capture ELISA according to the manufacturer's instructions.

2.4.5. In vivo protection studies Two weeks after the last immunization, ICR mice were intragastrically infected with either a lethal (1010 CFU) or a sublethal (107 CFU) dose of live ST that had been suspended in 200 μL of PBS. The lethal dose groups were used to observe survival rates for 2 weeks. The sublethal dose groups were used to determine spleen bacterial loads. Spleens were homogenized in 0.05% Triton X-100 for bacterial enumeration. Viable bacterial cell counts from the tissues were obtained by plating serial dilutions of bacteria on Luria broth agar plates and determining the log CFUs after overnight incubation at 37 °C.

2.5. Statistical analyses

2.4.1. Preparation of FIST ST CVCC 541 was grown in LB broth overnight at 37 °C. Viable bacterial cell counts were obtained by plating serial dilutions of bacteria on LB agar plates and determining the colony-forming units (CFUs). Cells were then harvested by centrifugation, washed with saline, and resuspended in saline. Formaldehyde was added to a final concentration of 1% (v/v), and the suspension was incubated at 4 °C for 24 h. Cells were then washed twice with saline to remove the formaldehyde and were resuspended in saline. The absence of viable colonies was confirmed by a lack of bacterial growth on LB agar plates. The prepared FIST was then stored at −70 °C.

Data were shown as the mean ± standard deviation (SD). Fisher's least significant difference (LSD) test and Student's t-test were used to evaluate significant differences between groups. P values of b 0.05 were considered statistically significant.

A

**

1.2 1

OD (450 nm)

2.4. Effect of TBG on the induction of specific immune responses against heat-killed S. typhimurium as a model vaccine in mice

**

IgG

** **

0.8 0.6 0.4 0.2

2.4.2. Immunization ICR mice were immunized subcutaneously with FIST (106 CFU/ mouse) alone or dissolved in saline containing TBG (10, 20, and 40 μg) or alum (200 μg) on day 1 and day 15. As a control, a group of ICR mice was given two subcutaneous injections of saline alone. In some experiments, ICR mice were injected intraperitoneally with 800 μg of anti-IFNγ mAb (R&D Systems) or rat IgG2a control mAb (R&D Systems) on day 1, day 8, day 15, and day 22.

0 Saline

Alum

10

20

40

TBG ( g) OVA (100 g)

B

1.6

OD (450 nm)

1.4

2.4.3. Measurement of FIST-specific antibody concentrations FIST-specific antibody concentrations of total IgG, IgG1, and IgG2a in serum were detected with an indirect ELISA. In brief, microtiter plates were coated with 100 μl of FIST (2.0 × 103 cells/ml) in 50 mM carbonate-bicarbonate buffer (pH 9.6) for 24 h at 4 °C. The wells were washed three times with 200 μl of PBS containing 0.05% (v/v) Tween 20 (PBST) and then blocked with 150 μl of 5% FCS/PBS for 2 h. After three washes with PBST, 100 μl of diluted serum samples was added to triplicate wells. The plates were then incubated for 2 h followed by three washes with PBST. Aliquots of 100 μl of goat anti-mouse horseradish peroxidase-conjugated IgG, IgG1, or IgG2a (diluted 1:5000) were added to each well. The plates were further incubated for 1 h. After three washes, 100 μl of TMB substrate solution was added to each well. The plates were incubated for 10 min, and the enzymatic reaction was terminated by adding 100 μl per well of 2 M H2SO4. The optical density (OD) of each well was measured with an ELX800 ELISA reader (Bio Tek Instruments, Winooski, Vermont, United States) at 450 nm.

OVA

1.2

**## **

IgG1

**##

IgG2a

*

1

##

##

0.8

##

0.6 0.4 0.2 0 Saline

OVA

Alum

10

20

40

TBG ( g) OVA (100 g) Fig. 2. OVA-specific serum IgG subtype profiles induced by TBG/OVA vaccination. Female ICR mice were immunized subcutaneously with OVA (100 μg) alone or OVA (100 μg) dissolved in saline containing TBG (10, 20, and 40 μg) on day 1 and day 15 (n = 5). Two weeks later, blood samples were collected to measure OVA-specific IgG and IgG subclass antibodies by ELISA. *P b 0.05, **P b 0.01 vs. OVA control group. #P b 0.05, ##P b 0.01 vs. alum/OVA group.

356

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

A

C

1600 **##

**##

1200

IL-17A (pg/ml)

IFN (pg/ml)

1400

**##

1000 800 600 400

25 20 15 10 5

200 0

0 Saline

OVA

Alum

10

20

40

Saline

OVA

Alum

IL-4 (pg/ml)

B

18 16 14 12 10 8 6 4 2 0

10

20

40

TBG ( g) OVA (100 g)

TBG ( g) OVA (100 g)

**

Saline

OVA

Alum

##

##

##

10

20

40

TBG ( g) OVA (100 g) Fig. 3. Cytokine profiles of supernatants of OVA-stimulated splenocytes from TBG/OVA-immunized mice. Splenocytes from OVA and TBG/OVA-immunized mice were prepared 2 weeks after the last immunization and were then cultured with OVA (100 μg/ml) for 72 h. Cell supernatants were collected to determine IFNγ, IL-4, and IL-17A concentrations by ELISA (n = 5). *P b 0.05, **P b 0.01 vs. OVA group. #P b 0.05, ##P b 0.01 vs. alum group.

A

Relative ratio of GATA-3/ -actin

C T-bet GATA-3 ROR t β-actin Saline OVA Alum 10

20

40

1.6

**

1.4 1.2

##

##

10

20

40

0.8 0.6 0.4 0.2 0 Saline

TBG ( g)

OVA

Alum

TBG ( g) OVA (100 g)

OVA (100 g)

D **##

1.4 1.2

**##

**##

1 0.8 0.6 0.4 0.2 0 Saline

OVA

Alum

10

20

TBG (μ μg) OVA (100 g)

40

Relative ratio of ROR t/ -actin

B Relative ratio of T-bet/ -actin

##

1

1.4 1.2 1 0.8 0.6 0.4 0.2 0 Saline

OVA

Alum

10

20

40

TBG (μ μg) OVA (100 μg)

Fig. 4. The mRNA expression levels of T-bet, GATA-3, and RORγt in OVA-stimulated splenocytes from TBG/OVA-immunized mice. Splenocytes from OVA- and TBG/OVA-immunized mice were prepared 2 weeks after the last immunization and were then cultured with OVA (100 μg/ml) for 18 h. The mRNA expression levels of T-bet, GATA-3, and RORγt in OVA-stimulated splenocytes were determined by RT-PCR (n = 5). *P b 0.05, **P b 0.01 vs. OVA control group. #P b 0.05, ##P b 0.01 vs. alum/OVA group.

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

Stimulation Index (SI)

3.5 3 2.5

LPS ConA

**## **##

*# *#

OVA

2

*

were analyzed for OVA-specific total IgG, IgG1, and IgG2a levels by ELISA. As shown in Fig. 2, the OVA-specific total serum IgG levels in mice were significantly enhanced by alum (200 μg) and TBG (10, 20 and 40 μg), compared with the OVA control group (P b 0.05). However, there were no significant differences between the total serum IgG levels in mice immunized with alum/OVA or TBG/OVA (P N 0.05). Significant increases in OVA-specific IgG2a were observed in the TBG/OVA groups compared with the OVA control group and the alum/OVA group (P b 0.05 and P b 0.01). However, there were no significant differences in OVA-specific IgG1 levels between the TBG/OVA and OVA control groups (P N 0.05). Compared to the OVA control group, alum/OVA elicited significantly higher OVA-specific IgG1 levels (P b 0.05), but not OVA-specific IgG2a levels (P N 0.05) after secondary immunization.

**##

**##

**

**

1.5 1 0.5 0 Saline

OVA

Alum

10

20

40

TBG ( g) OVA (100 g) Fig. 5. Splenocyte proliferation response to mitogens and OVA in TBG/OVA-immunized mice. Splenocytes from OVA- and TBG/OVA-immunized mice were prepared 2 weeks after the last immunization and were then cultured with LPS (10 μg/ml), ConA (5 μg/ml), or OVA (5 μg/ml) for 72 h. Splenocyte proliferation was measured by the MTS method described in the text and is shown as a stimulation index (SI, n = 5). *P b 0.05, **P b 0.01 vs. OVA control group. #P b 0.05, ##P b 0.01 vs. alum/OVA group.

3.2. Effect of TBG on Th1, Th2, and Th17 cytokine production in splenocytes isolated from OVA-immunized mice To assess the effects of TBG on Th1, Th2, and Th17 cytokine responses to OVA, the concentrations of IFNγ, IL-4, and IL-17A in splenocytes prepared from OVA-immunized mice were determined by ELISA. As shown in Fig. 3, the concentrations of IFNγ in the supernatants from cultured splenocytes isolated from mice immunized with TBG/ OVA were significantly higher than those isolated from OVA control mice (P b 0.01). However, there were no significant differences in the concentrations of IL-4 and IL-17A between the TBG/OVA and OVA control groups (P N 0.05). In contrast, the splenocytes isolated from the alum/OVA group exhibited significantly higher IL-4 (P b 0.05), but not

3. Results 3.1. Effect of TBG on OVA-specific total IgG, IgG1, and IgG2a levels in the serum of OVA-immunized mice Because the determination of relative IgG1 and IgG2a subclass levels can elucidate the polarization of Th immune responses, serum samples

Saline

OVA

Alum+OVA

19.50%

22.23%

25.73%

5.71%

5.92%

7.33%

TBG (10 g )+OVA TBG (20 g )+OVA TBG (40 g )+OVA 29.39%

37.36%

36.95%

11.97%

11.41%

CD4+

A

357

CD8+

10.07%

CD3+

+ +

+

+

+

Gated CD3 /CD3 CD4 /CD3 CD8 Population (%)

B

50 45 40 35 30 25 20 15 10 5 0

**##

CD3+

CD3+

**##

CD3+CD4+ +

CD3

CD4+

CD3+CD8+ CD3++CD8++

**##

**##

OVA

**##

**##

CD3 CD8

Saline

**##

Alum

10

**##

**##

20

40

TBG ( g) OVA (100 g) Fig. 6. The frequency rates of CD3+, CD3+CD4+, and CD3+CD8+ T cell subsets in TBG/OVA-immunized mice. Splenocytes from OVA- and TBG/OVA-immunized mice were prepared 2 weeks after the last immunization; the T cell surface markers CD3, CD4, and CD8 were detected by flow cytometry. In total, 10,000 CD3-labeled cells were gated, and the frequencies of CD4+ and CD8+ splenic T cells were detected (n = 5). *P b 0.05, **P b 0.01 vs. OVA control group. #P b 0.05, ##P b 0.01 vs. alum/OVA group.

358

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

IFNγ (P N 0.05) or IL-17A (P N 0.05), production than those from the OVA control group. These data indicated that TBG enhanced the antigenspecific Th1 immune response. 3.3. Effect of TBG on the mRNA expression of T-bet, GATA-3, and RORγt in splenocytes isolated from OVA-immunized mice The mRNA expression levels of the transcription factors T-bet (Th1), GATA-3 (Th2), and RORγt (Th17) in splenocytes isolated from OVAimmunized mice were assayed by RT-PCR. As shown in Fig. 4, TBG and alum induced differential T-bet, GATA-3, and RORγt mRNA expression levels. TBG/OVA induced significantly higher T-bet mRNA expression levels (P b 0.01), but not GATA-3 and RORγt mRNA expression levels (P N 0.05), than did OVA alone. Alum significantly increased GATA-3 (P b 0.01) but not T-bet and RORγt (P N 0.05) mRNA expression levels. 3.4. Effect of TBG on splenocyte proliferation from OVA-immunized mice Lymphocyte proliferation assays were carried out to evaluate the capacity of TBG to promote cellular immune responses. As shown in Fig. 5, splenocytes isolated from the TBG/OVA groups stimulated with ConA, LPS, and OVA showed a greater proliferative response than that observed in the OVA control group (P b 0.05 or P b 0.01). In contrast, alum, the standard adjuvant used in this test model, only enhanced the proliferative response to OVA when compared to the OVA control group (P b 0.05). 3.5. Effect of TBG on CD3+CD4+ and CD3+CD8+ T cell subsets in splenocytes isolated from OVA-immunized mice The T cell subclasses in the splenocytes isolated from OVA-immunized mice were assayed by FACS. As shown in Fig. 6, TBG significantly enhanced the proportion of CD3+ T lymphocytes in splenocytes (P b 0.01). The proportions of CD3+CD4+ and CD3+CD8+ T lymphocytes in splenocytes isolated from mice immunized with TBG/OVA were significantly higher than those isolated from the alum/OVA group (P b 0.01). 3.6. Effect of TBG on FIST-specific total IgG, IgG1, and IgG2a levels in the serum of FIST-immunized mice As shown in Fig. 7, serum FIST-specific total IgG levels in mice were significantly enhanced by alum (200 μg) and TBG (10, 20 and 40 μg) compared with the FIST control group (P b 0.01). Significant increases in FIST-specific IgG2a levels were observed in the TBG/FIST group compared with the FIST control group and the alum/FIST group (P b 0.01). Interestingly, lower FIST-specific IgG1 levels were observed in the TBG/FIST groups compared with the FIST control group and the alum/FIST group (P b 0.05).

The concentrations of IFNγ, IL-4, and IL-17A in splenocytes prepared from FIST-immunized mice were determined by ELISA. As shown in Fig. 8, the concentration of IFNγ in supernatants from cultured splenocytes isolated from mice immunized with TBG/FIST was significantly higher than that isolated from FIST control mice (P b 0.01). However, IL-4 levels in the TBG/FIST groups were significantly lower than in the FIST control groups (P b 0.05), but IL-17A was not affected (P N 0.05). In contrast, the splenocytes isolated from the Alum/FIST group exhibited significantly higher IL-4 and IL-17A (P b 0.01), but not IFNγ (P N 0.05), production than those from the FIST control group. 3.8. Effect of TBG on the bacterial load in the spleen and on the survival rate We sought to further determine whether TBG/FIST treatment facilitated host defense against ST in vivo. The ST numbers were dramatically lower in spleen tissues from mice in the TBG/FIST and alum/FIST groups compared with the FIST group 3 days post-infection (P b 0.01, Fig. 9A). Moreover, the survival time was higher in the TBG/FIST and alum/FIST groups compared with the FIST group (Fig. 9B). 3.9. Role of IFNγ in the immune response produced by TBG/FIST To clarify the role of IFNγ in augmenting the immune response induced by TBG adjuvanted FIST vaccination, mice immunized with FIST alone or FIST formulated with TBG were also treated with an intraperitoneal injection of anti-IFNγ mAb or control mAb. As shown in Figs. 10 and 11, injection of an anti-IFNγ mAb notably altered the immunoglobulin subtype and cytokine profile, with marked increases in IgG1 and IL-4 and decreases in IgG2a and IFNγ. The enhancement of IgG2a and IFNγ production by TBG was abrogated by treatment with an anti-IFNγ mAb (P b 0.01, Figs. 10A and 11A). As shown in Fig. 12, the enhancement of the anti-ST effect by TBG plus FIST was also prevented by injection of anti-IFNγ mAb. The bacterial counts measured in the TBG/ FIST group treated with anti-IFNγ mAb were significantly higher than those observed in the TBG/FIST group treated with a rat IgG2a control mAb (P b 0.01, Fig. 12A). In addition, the survival time of TBG/FISTimmunized mice treated with anti-IFNγ mAb were less than those of TBG/FIST-immunized mice injected with rat IgG2a control mAb (Fig. 12B). However,the bacterial burdens in the spleens from TBGtreated mice injected with anti-IFNγ mAb or rat IgG2a control mAb were not significantly lower than those of saline-treated mice injected with anti-IFNγ mAb or rat IgG2a control mAb (P N 0.05, Fig. 12A). In addition, the survival time of TBG-treated mice injected with anti-IFNγ mAb or rat IgG2a control mAb were not longer than those of salinetreated mice injected with anti-IFNγ mAb or rat IgG2a control mAb (Fig. 12B).

B 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

**# IgG

Saline FIST

**

Alum

**#

**

10

20

TBG (μg) FIST (106 CFU)

40

OD (450 nm)

OD (450 nm)

A

3.7. Effect of TBG on Th1, Th2, and Th17 cytokine production in splenocytes isolated from FIST-immunized mice

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

** IgG1 IgG2a

**## *##

Saline FIST

Alum

**##

*##

**## *##

10

20 40 TBG (μg) FIST (106 CFU)

Fig. 7. FIST-specific total IgG, IgG1, and IgG2a levels in the sera of TBG/FIST-immunized mice. ICR mice were immunized subcutaneously with FIST (106 CFU/mouse) alone or FIST (106 CFU/ mouse) dissolved in saline containing TBG (10, 20, and 40 μg) on day 1 and day 15 (n = 5). Two weeks later, blood samples were collected to measure FIST-specific IgG and IgG subclass antibodies by ELISA. *P b 0.05, **P b 0.01 vs. FIST control group. #P b 0.05, ##P b 0.01 vs. Alum/FIST group.

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

A

7

**##

**##

**##

C IL-17A (pg/ml)

5

IFN (ng/ml)

40

4 3 2

30 25

5

20

Saline

40

FIST

Alum

IL-4 (pg/ml)

50 45 40 35 30 25 20 15 10 5 0

10

20

40

TBG ( g) FIST (106 CFU)

TBG ( g) FIST (106 CFU)

B

##

10

0

10

##

15

0 Alum

##

20

1 FIST

**

35

6

Saline

359

**

Saline

FIST

Alum

*##

*##

*##

10

20

40

TBG ( g) FIST (106 CFU) Fig. 8. Cytokine profiles of supernatants of FIST-stimulated splenocytes from TBG/FIST-immunized mice. Splenocytes of FIST- or TBG/FIST-immunized mice were prepared 2 weeks after the last immunization and were then stimulated with FIST (1 × 105 CFU/ml) for 72 h. IFNγ, IL-4 and IL-17A in the supernatants were detected by ELISA (n = 5). *P b 0.05, **P b 0.01 vs. FIST control group. #P b 0.05, ##P b 0.01 vs. alum/FIST group.

Chan Su is perhaps one of the most widely used traditional Chinese medicines because of its anti-cancer and immunoregulatory effects. We undertook the present study to evaluate the immunomodulatory effects of TBG on the immune response induced by OVA and FIST. The present study has demonstrated that TBG enhanced the Th1 immune response and protected against ST. TBG augmented the production of serum OVA- and FIST-specific total IgG and IgG2a and the production

A

1 day post-infection 3 days post-infection 7 days post-infection

6 **

5 log10 CFU/g Spleen

**

**##

4

**##

**##

**##

**## **##

3 2 1

Ud

0 S aline

FIS T

Ud Alum

Ud

Ud 10

Ud 20

TBG ( g) FIST (106 CFU)

40

of IFNγ by antigen-restimulated splenocytes. TBG significantly decreased bacterial burden in the spleen and enhanced the survival time of FIST-immunized mice challenged with live ST. The enhancement of anti-ST activity by TBG was inhibited by the in vivo injection of antiIFNγ mAb. These results suggest that TBG may be used as a novel adjuvant to enhance the Th1 immune response to intracellular infections. The different Th1, Th2, and Th17 immune response profiles correspond to the activation of three distinct major subsets of T cells, characterized by their pattern of cytokine production [13]. A previous study

B Survival Rate (%)

4. Discussion

100 90 80 70 60 50 40 30 20 10 0 1

2

3

4

5

6

7

8

9

10 11 12 13 14

Days post-infection Saline

FIST

Alum

10

20

40

TBG ( g) FIST (106 CFU) Fig. 9. Bacterial burdens in the spleens and the host survival rate of TBG/FIST-immunized mice. (A) FIST-, alum/FIST-, and TBG/FIST-immunized mice were intragastrically infected with a sublethal dose of ST (1 × 107 CFU/mouse) 2 weeks after the last immunization. Spleen from these mice were harvested 1, 3, or 7 days post-infection, and bacterial counts were detected through the spread plate method (n = 5). (B) FIST-, Alum/FIST-, and TBG/FIST-immunized mice were intragastrically infected with a lethal dose of ST (1 × 1010 CFU/mouse, n = 10) 2 weeks after the last immunization, and the survival rate was observed for 14 days. *P b 0.05, **P b 0.01 vs. FIST control group. #P b 0.05, ##P b 0.01 vs. Alum/FIST group.

360

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

A

** **

B

** **

**

1.6 1.4

IgG2a (OD 450 nm)

IgG1 (OD 450 nm)

1.6 1.4

**

1.2 1 0.8 0.6 0.4 0.2 0

1.2 1 0.8 0.6 0.4 0.2 0

Saline

TBG Rat IgG2a

FIST+TBG

FIST

Saline

TBG

Rat IgG2a

Anti-IFN

FIST+TBG

FIST

Anti-IFN

Fig. 10. Effect of anti-IFNγ treatment on serum FIST-specific IgG1 and IgG2a produced by TBG/FIST-immunized mice. FIST- and TBG (20 μg)/FIST-immunized mice were treated with antiIFNγ or rat IgG2a control mAb intraperitoneally on day 1, day 8, day 15, and day 22. (A and B) Blood was harvested 14 days after the last immunization, and FIST-specific IgG1 and IgG2a levels in the serum were detected by ELISA (n = 5). *P b 0.05, **P b 0.01.

observed that TBG elevated the production of the Th1 cytokine IFNγ but inhibited production of the Th2 cytokine IL-4 in ConA-stimulated splenocytes [10]. An adjuvant can directly affect the type of humoral immune response that generates different antibodies to a selected antigen through the regulation of Th cells and their cytokines. IgG2a responses are dependent on Th1 cell-derived IFNγ, but IgG1 responses are dependent on Th2 cell-derived IL-4 [14]. We observed that TBG/OVAimmunized mice had higher levels of OVA-specific IgG2a and IFN-γ compared to OVA-immunized mice (Figs. 2 and 3). This finding suggested that TBG preferentially induced a Th1 shift in vaccinated mice by enhancing Th1 cytokine synthesis and controlling Th2 and Th17 cytokine production. Cytokines exert effects on Th1, Th2, and Th17 differentiation by controlling the expression of their respective transcription factors. T-bet, GATA3, and RORγt can induce Th0 cells to polarize

A

** **

**

7

into Th1, Th2, and Th17 cells, respectively [15–17]. In the present study, TBG enhanced mRNA expression of the transcription factor T-bet but did not affect mRNA expression of the transcription factors GATA3 or RORγt in splenocytes isolated from OVA-immunized mice (Fig. 4). Effective cellular immunity also can be shown by the stimulation of lymphocyte proliferation [18]. The ex vivo proliferation assay showed that TBG significantly promoted splenocyte proliferation in response to mitogens and OVA (Fig. 5), suggesting that TBG increased the activation potential of T and B cells. TBG also increased the proportion of CD3+CD4+ and CD3+CD8+ T cells in splenocytes from OVAimmunized mice (Fig. 6), thereby confirming its general effect on cellmediated immune responses. These data suggest that TBG enhanced Th1 immune responses to OVA, possibly by activating the Th1 transcription factor T-bet.

C

5 4 3 2

20 15 10 5

1

0

0 Saline

TBG Rat IgG2a

FIST+TBG

FIST

Anti-IFN

**

Saline

TBG Rat IgG2a

**

B

30 25

IL-17A (pg/ml)

IFN (ng/ml)

6

FIST+TBG

FIST

Anti-IFN

**

50

IL-4 (pg/ml)

40 30 20 10 0 Saline

TBG Rat IgG2a

FIST+TBG

FIST

Anti-IFN

Fig. 11. Effect of anti-IFNγ treatment on cytokine profiles of supernatants of FIST-stimulated splenocytes from TBG/FIST-immunized mice. FIST- and TBG (20 μg)/FIST-immunized mice were treated with anti-IFNγ or rat IgG2a control mAb intraperitoneally on day 1, day 8, day 15, and day 22. (A and B) Blood was harvested 14 days after the last immunization, and FIST-specific IgG1 and IgG2a levels in the serum were detected by ELISA (n = 5). (A, B, and C) Splenocytes were harvested 2 weeks after the last immunization and were then stimulated with FIST (1 × 105 CFU/ml) for 72 h. IFNγ, IL-4, and IL-17A levels in the supernatants were detected by ELISA (n = 5). *P b 0.05, **P b 0.01.

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

A

** **

**

Saline

TBG

**

**

B Survival Rate (%)

log10 CFU/g Spleen

7 6 5 4 3 2 1

100 90 80 70 60 50 40 30 20 10 0

0

1

Rat IgG2a

FIST+TBG

2

3

4

FIST

Anti-IFN

361

5

6

7

8

9

10

11

Days post-infection

Saline

+

+

+

+

+

+

+

+

FIST

_

_

_

_

+

+

+

+

TBG (20 g) _

_

+

+

_

_

+

+

Anti-IFN

_

+

_

+

_

+

_

+

Rat IgG2a

+

_

+

_

+

_

+

_

Fig. 12. Effect of anti-IFNγ treatment on bacterial burden in the spleens and the host survival rate of TBG/FIST-immunized mice. TBG (20 μg)-treated, FIST-, and TBG (20 μg)/FISTimmunized mice were treated with anti-IFNγ or rat IgG2a control mAb intraperitoneally on day 1, day 8, day 15, and day 22. (A) Mice were intragastrically infected with a sublethal dose of ST (1 × 107 CFU/mouse) 2 weeks after the last immunization. Spleens were harvested 3 days post-infection, and bacterial counts were detected through the spread plate method (n = 5). (B) Mice were intragastrically infected with a lethal dose of ST (1 × 1010 CFU/mouse, n = 10) 2 weeks after the last immunization, and the survival rate was observed for 14 days. *P b 0.05, **P b 0.01.

Th1 immune responses are characterized by the induction of IFNγ and IgG2a and are essential for clearing intracellular infections, such as those caused by Salmonella [19,20]. In the present study, TBG also induced a further increase in the production of the Th1 cytokine IFNγ and FIST-specific IgG2a in FIST-immunized mice (Figs. 7B and 8A), which suggests an enhanced Th1 immune response. IFNγ is required for host control of the growth of intracellular pathogens [21,22], and IFNγdeficient mice are more susceptible to ST than are wild-type mice [23]. Treatment with IFNγ protects mice against lethal ST infection, further confirming the importance of IFNγ for bacterial control [24]. We observed that TBG/FIST-immunized mice had lower bacterial burden and longer survival time compared with FIST-immunized mice (Fig. 9). To determine whether IFNγ was required for the effects attributed to TBG, we treated FIST-immunized mice with anti-IFNγ mAb. We found that the enhancements in IFNγ, IgG2a, and the anti-Salmonella effect caused by TBG were inhibited by treatment with anti-IFNγ mAb (Figs. 10B, 11A, and 12). It has been reported that protective IFNγ during S. typhimurium infection is also provided by natural killer cells [25] and that TBG has antimicrobial activity in vitro[26]. However, we observed that the administration of TBG alone did not decrease the bacteria burdens in the spleens and enhanced the survival time of mice treated with rat IgG2a or anti-IFNγ mAb, suggesting that TBG at the dose of 20 μg/mouse alone did not exert anti-ST effect by modulating components of the innate immune response, such as NK cells, and antimicrobial activity. Taken together, these observations suggest that positive modulation of IFNγ production may be the mechanism by which TBG/FIST mediates resistance to infections. Interestingly, we found that alum/FISTimmunized mice had lower bacterial burdens and higher IL-4 and IL-17A levels compared with FIST-immunized mice (Figs. 8 and 9). A Th2 immune response is not essential for protective immunity against Salmonella and may lead to the spread of the pathogen. ST is preferentially found in M2 macrophages activated by Th2 cytokines [27,28], and susceptibility to a Salmonella carrier state is associated with a Th2 bias [29,30], suggesting that the enhancement of anti-ST effects by alum may not be due to the enhancement of a Th2 immune response. It has now become increasingly clear that the production of IL-17A is important but not sufficient for protection against ST [31,32], and the results reported here also support this idea. Furthermore, we will evaluate the adjuvant activity of the mixture of alum and TBG. In conclusion, our results demonstrate that TBG enhances Th1 immunity, as evidenced by increased secretion of IFNγ and IgG2a along

with increased protection against ST. The results also indicate that TBG may have useful activity against intracellular pathogens if used as a vaccine adjuvant. Acknowledgments The research was supported by the National Natural Science Foundation of China (grant no. 31372470). The authors declare no conflict of interest. References [1] Pascual DM, Morales RD, Gil ED, Munoz LM, Lopez JE, Casanueva OL. Adjuvants: present regulatory challenges. Vaccine 2006;24(Suppl. 2) (S2-88-9). [2] Hung CY, Gonzalez A, Wuthrich M, Klein BS, Cole GT. Vaccine immunity to coccidioidomycosis occurs by early activation of three signal pathways of T helper cell response (Th1, Th2, and Th17). Infect Immun 2011;79:4511–22. [3] Shima F, Uto T, Akagi T, Akashi M. Synergistic stimulation of antigen presenting cells via TLR by combining CpG ODN and poly(gamma-glutamic acid)-based nanoparticles as vaccine adjuvants. Bioconjug Chem 2013;24:926–33. [4] Petrovsky N, Aguilar JC. Vaccine adjuvants: current state and future trends. Immunol Cell Biol 2004;82:488–96. [5] Liu G, Anderson C, Scaltreto H, Barbon J, Kensil CR. QS-21 structure/function studies: effect of acylation on adjuvant activity. Vaccine 2002;20:2808–15. [6] Kensil CR, Kammer R. QS-21: a water-soluble triterpene glycoside adjuvant. Expert Opin Investig Drugs 1998;7:1475–82. [7] Cleland JL, Kensil CR, Lim A, Jacobsen NE, Basa L, Spellman M, et al. Isomerization and formulation stability of the vaccine adjuvant QS-21. J Pharm Sci 1996;85:22–8. [8] Li C, Hashimi SM, Cao S, Mellick AS, Duan W, Good D, et al. The mechanisms of chansu in inducing efficient apoptosis in colon cancer cells. Evid Based Complement Alternat Med 2013;2013:849054. [9] Wang XL, Zhao GH, Zhang J, Shi QY, Guo WX, Tian XL, et al. Immunomodulatory effects of cinobufagin isolated from Chan Su on activation and cytokines secretion of immunocyte in vitro. J Asian Nat Prod Res 2011;13:383–92. [10] Cao Y, Song Y, An N, Zeng S, Wang D, Yu L, et al. The effects of telocinobufagin isolated from Chan Su on the activation and cytokine secretion of immunocytes in vitro. Fundam Clin Pharmacol 2009;23:457–64. [11] Qi F, Li A, Inagaki Y, Kokudo N, Tamura S, Nakata M, et al. Antitumor activity of extracts and compounds from the skin of the toad Bufo bufo gargarizans Cantor. Int Immunopharmacol 2011;11:342–9. [12] Touza NA, Pocas ES, Quintas LE, Cunha-Filho G, Santos ML, Noel F. Inhibitory effect of combinations of digoxin and endogenous cardiotonic steroids on Na+/K + -ATPase activity in human kidney membrane preparation. Life Sci 2011;88:39–42. [13] Vernal R, Garcia-Sanz JA. Th17 and Treg cells, two new lymphocyte subpopulations with a key role in the immune response against infection. Infect Disord Drug Targets 2008;8:207–20. [14] Montgomery CP, Daniels M, Zhao F, Alegre ML, Chong AS, Daum RS. Protective immunity against recurrent Staphylococcus aureus skin infection requires antibody and interleukin-17A. Infect Immun 2014;82:2125–34.

362

S.-C. Wu et al. / International Immunopharmacology 25 (2015) 353–362

[15] Chakir H, Wang H, Lefebvre DE, Webb J, Scott FW. T-bet/GATA-3 ratio as a measure of the Th1/Th2 cytokine profile in mixed cell populations: predominant role of GATA-3. J Immunol Methods 2003;278:157–69. [16] Mullen AC, High FA, Hutchins AS, Lee HW, Villarino AV, Livingston DM, et al. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science 2001; 292:1907–10. [17] Ruan Q, Kameswaran V, Zhang Y, Zheng S, Sun J, Wang J, et al. The Th17 immune response is controlled by the Rel-RORgamma-RORgamma T transcriptional axis. J Exp Med 2011;208:2321–33. [18] Marciani DJ, Press JB, Reynolds RC, Pathak AK, Pathak V, Gundy LE, et al. Development of semisynthetic triterpenoid saponin derivatives with immune stimulating activity. Vaccine 2000;18:3141–51. [19] Mizuno Y, Takada H, Nomura A, Jin CH, Hattori H, Ihara K, et al. Th1 and Th1inducing cytokines in Salmonella infection. Clin Exp Immunol 2003;131:111–7. [20] Flores-Langarica A, Marshall JL, Bobat S, Mohr E, Hitchcock J, Ross EA, et al. T-zone localized monocyte-derived dendritic cells promote Th1 priming to Salmonella. Eur J Immunol 2011;41:2654–65. [21] Nairz M, Fritsche G, Brunner P, Talasz H, Hantke K, Weiss G. Interferon-gamma limits the availability of iron for intramacrophage Salmonella typhimurium. Eur J Immunol 2008;38:1923–36. [22] Kirby AC, Yrlid U, Wick MJ. The innate immune response differs in primary and secondary Salmonella infection. J Immunol 2002;169:4450–9. [23] Hess J, Ladel C, Miko D, Kaufmann SH. Salmonella typhimurium aroA- infection in gene-targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. J Immunol 1996;156:3321–6.

[24] Bao S, Beagley KW, France MP, Shen J, Husband AJ. Interferon-gamma plays a critical role in intestinal immunity against Salmonella typhimurium infection. Immunology 2000;99:464–72. [25] Kupz A, Scott TA, Belz GT, Andrews DM, Greyer M, Lew AM, et al. Contribution of Thy1 + NK cells to protective IFN-gamma production during Salmonella typhimurium infections. Proc Natl Acad Sci U S A 2013;110:2252–7. [26] Cunha Filho GA, Schwartz CA, Resck IS, Murta MM, Lemos SS, Castro MS, et al. Antimicrobial activity of the bufadienolides marinobufagin and telocinobufagin isolated as major components from skin secretion of the toad Bufo rubescens. Toxicon 2005;45:777–82. [27] Eisele NA, Ruby T, Jacobson A, Manzanillo PS, Cox JS, Lam L, et al. Salmonella require the fatty acid regulator PPARdelta for the establishment of a metabolic environment essential for long-term persistence. Cell Host Microbe 2013;14:171–82. [28] Bishop JL, Sly LM, Krystal G, Finlay BB. The inositol phosphatase SHIP controls Salmonella enterica serovar Typhimurium infection in vivo. Infect Immun 2008;76:2913–22. [29] Chausse AM, Grepinet O, Bottreau E, Robert V, Hennequet-Antier C, Lalmanach AC, et al. Susceptibility to Salmonella carrier-state: a possible Th2 response in susceptible chicks. Vet Immunol Immunopathol 2014;159:16–28. [30] Chappell L, Kaiser P, Barrow P, Jones MA, Johnston C, Wigley P. The immunobiology of avian systemic salmonellosis. Vet Immunol Immunopathol 2009;128:53–9. [31] Mayuzumi H, Inagaki-Ohara K, Uyttenhove C, Okamoto Y, Matsuzaki G. Interleukin17A is required to suppress invasion of Salmonella enterica serovar Typhimurium to enteric mucosa. Immunology 2010;131:377–85. [32] Raffatellu M, Santos RL, Verhoeven DE, George MD, Wilson RP, Winter SE, et al. Simian immunodeficiency virus-induced mucosal interleukin-17 deficiency promotes Salmonella dissemination from the gut. Nat Med 2008;14:421–8.