crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 44, pp. 23188 –23198, October 28, 2016 © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

Targeting Liver Fibrosis with a Cell-penetrating Protease-activated Receptor-2 (PAR2) Pepducin*□ S

Received for publication, April 14, 2016, and in revised form, September 8, 2016 Published, JBC Papers in Press, September 9, 2016, DOI 10.1074/jbc.M116.732743

Andrew M. Shearer‡§1, Rajashree Rana‡2, Karyn Austin‡§, James D. Baleja§, Nga Nguyen‡, Andrew Bohm§, Lidija Covic‡§, and Athan Kuliopulos‡§3 From the ‡Center for Hemostasis and Thrombosis Research, Molecular Oncology Research Institute, Tufts Medical Center and § Tufts University School of Graduate Biomedical Sciences, Biochemistry/Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, Massachusetts 02111 Chronic liver inflammation and fibrosis in nonalcoholic steatohepatitis can lead to cirrhosis and liver failure for which there are currently no approved treatments. Protease-activated receptor-2 (PAR2) is an emerging new target expressed on liver stellate cells and hepatocytes that regulates the response to liver injury and inflammation. Here, we identified a pepducin to block the deleterious actions of PAR2 in promoting liver fibrosis. Non-alcoholic fatty liver disease and early fibrosis were induced by the methionine-choline-deficient diet in mice. Fibrotic liver disease was induced by administering carbon tetrachloride for 8 weeks. Mice were treated with the pepducin PZ-235 either from onset of the experiment or after fibrosis was established. Hepatic fibrosis, collagen content, inflammatory cytokines, steatosis, triglycerides, and NAFLD activity score were assessed as primary outcome parameters depending on the model. The activity of the PAR2 pepducin on cultured stellate cell activation and hepatocyte reactive oxygen species production was evaluated. PZ-235 significantly suppressed liver fibrosis, collagen deposition, inflammatory cytokines, NAFLD activity score, steatosis, triglycerides, aspartate transaminase, alanine transaminase, and stellate cell proliferation by up to 50 –100%. The PAR2 inhibitor afforded significant protective effects against hepatocellular necrosis and attenuated PAR2mediated reactive oxygen species production in hepatocytes. PZ-235 was distributed to liver and other mouse tissues and was found to form a well structured ␣-helix that closely resembles the juxtamembrane helical region of the analogous TM6 and third intracellular region of the intact receptor that is critical for coupling to internal G proteins. The ability of PZ-235 to effectively suppress fibrosis, hepatocellular necrosis, reactive oxygen species production, steatosis, and inflammation indicates the potential for PAR2 pepducin inhibitors to be broadly efficacious in the treatment of liver fibrosis.

* This work was supported in part by NIDDK, National Institutes of Health Grant DK101240 (to A. K. and L. C.). Dr. Kuliopulos and Dr. Covic report serving as Scientific Founders of Oasis Pharmaceuticals. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. □ S This article contains supplemental Figs. 1– 4. 1 Supported by NHLBI, National Institutes of Health Ruth L. Kirschstein National Research Service Award Predoctoral Fellowship F31HL132419. 2 Supported by an American Heart Association postdoctoral fellowship. 3 To whom correspondence should be addressed: Tufts Medical Center, Box 7510, 800 Washington St., Boston, MA 02111. E-mail: athan. [email protected].

23188 JOURNAL OF BIOLOGICAL CHEMISTRY

Nonalcoholic steatohepatitis (NASH)4 is a progressive fibrotic disease of the liver with a rising incidence in both obese adults and children (1–3). Typically, individuals are clinically asymptomatic until the disease has progressed over several years, which has led NASH to be considered a “silent” liver disease. NASH has become one of the most common causes of chronic liver disease in the industrialized world; however, the underlying etiology is largely unknown. NASH is often associated with central obesity, metabolic syndrome, and type II diabetes mellitus, thus reflecting a relationship with disorders of systemic metabolism and inflammation (2). A number of experimental therapeutic strategies to potentially treat NASH are in phase 1–3 clinical trials, including antioxidants, farnesoid X or peroxisome proliferator-activated receptor ligands, and antifibrotic agents (4). Despite these efforts, there are no therapeutics yet approved for the treatment of NASH and related fibrotic liver diseases (4, 5). A critical trigger of NASH fibrosis is the activation of hepatic stellate cells by any one of multiple pathways associated with recurrent tissue damage, inflammation, and remodeling (6, 7). Stellate cells normally exist as quiescent vitamin A-enriched cells located in the space of Disse between luminal endothelial cells and hepatocytes (8). Upon activation, stellate cells convert to a myofibroblastic phenotype that up-regulates matrix and collagen deposition pathways, leading to the development of liver fibrosis and eventually cirrhosis (9). Activated stellate cells also secrete a number of inflammatory cytokines to create a proinflammatory environment and stimulate recruitment and activation of white blood cells (10, 11). Stellate cells can persist in an activated state until the cessation of insult or tissue damage whereupon they either undergo apoptosis or re-enter an inactive state that is similar to their initial state (12). In cases of recurrent liver injury, stellate cells remain in an activated form and prolong the exposure of the liver to heightened inflammatory signals and collagen matrix deposition, leading to the development of overt liver pathology. The central importance of stellate cells in the development of fibrotic liver disease has led to a concerted effort by many groups to target and inhibit their activation (4). 4

The abbreviations used are: NASH, non-alcoholic steatohepatitis; s.c., subcutaneous; NAFLD, non-alcoholic fatty liver disease; MCD, methioninecholine-deficient; NAS, NAFLD activity score; ROS, reactive oxygen species; AST, aspartate transaminase; ALT, alanine transaminase; PAR, proteaseactivated receptor; GPCR, G protein-coupled receptor; i3, third intracellular; MCP-1, monocyte chemoattractant protein-1; PI, propidium iodide.

VOLUME 291 • NUMBER 44 • OCTOBER 28, 2016

Targeting Liver Fibrosis with a PAR2 Pepducin An emerging new target for the potential treatment of fibrotic diseases of the liver and other tissues is protease-activated receptor-2 (PAR2), a G protein-coupled receptor that has been shown to play an important role in mesenchymal cell activation and inflammatory signaling (13–17). PAR family receptors are activated by proteolytic cleavage of their extracellular N-terminal domain by certain serine or metalloproteases, creating a tethered ligand that activates the receptor in an unusual intramolecular mode (18 –20). PAR2 is activated by trypsin-like proteases such as tryptase (13) and matriptase (21) and by coagulation factors VIIa and Xa (22–25) when tissue factor expression levels are up-regulated as occurs in subjects with fibrotic liver disease (26). The confluence of these PAR2 proteases during tissue injury and remodeling leads to a microenvironment that may trigger prolonged pathological activation of PAR2 signaling pathways. These include activation of mitogen-activated protein kinases (ERK, p38, and JNK) involved in proliferation, inflammation, and differentiation of mesenchymal cells via TGF-␤, TNF-␣, IL-1␤, and NF-␬B pathways during tissue fibrosis (14 –16, 27, 28). Here, we determined whether pepducin technology could be exploited as a potential treatment of liver fibrosis by blocking the profibrotic actions of PAR2 in liver. Pepducins (29 –31) comprise a short peptide derived from a GPCR intracellular loop tethered to a hydrophobic moiety such as palmitate. This structure allows the lipopeptide to anchor in the cell membrane lipid bilayer, rapidly flip across to the inner leaflet in a reversible manner (32–35), and target the GPCR/G protein interface via an intracellular allosteric mechanism (30, 36, 37). We describe a PAR2 pepducin that is able to effectively suppress PAR2-driven fibrosis, inflammation, steatosis, and hepatocellular necrosis, suggesting a novel multipronged approach to treat severe liver disease.

Results The Cell-penetrating Pepducin PZ-235 Reduces Steatosis and Inflammation in the Methionine-Choline-deficient (MCD) Diet-induced Model of NAFLD in Mice—To identify an effective PAR2 antagonist that might be potentially useful as an agent to treat NASH, we screened several hundred pepducins with mutations of critical third intracellular (i3) loop pharmacophores (13). In a primary screen, the i3 loop pepducin, PZ-235 (P2pal-18S), was identified as a full antagonist of PAR2 with complete blockade of SLIGRL-induced calcium signaling (IC50 of 2.4 ␮M) in PAR2-expressing SW620 adenocarcinoma cells and inhibited the PAR2 calcium response of HUH7 hepatocytes, similar to knockdown of PAR2 with siRNA (supplemental Fig. 1). To determine whether pharmacologic inhibition of PAR2 could potentially impact NAFLD in vivo, mice were fed an MCD diet for 3 weeks. MCD diets cause pronounced liver steatosis and inflammation and eventual progression to NASH. Animals were given daily subcutaneous (s.c.) injections of either vehicle or 5 mg/kg PZ-235 for 21 days. There was a striking reduction in hepatocyte vesicular fat and inflammation in the PZ-235 treatment group (Fig. 1A). The NAFLD activity score (NAS) is a histological assessment used to grade and diagnose NASH in patients with a score of ⱖ5 as the defining threshold for NASH. The three histologic features include steOCTOBER 28, 2016 • VOLUME 291 • NUMBER 44

atosis, lobular inflammation, and hepatocyte ballooning. The NAS values were lower in the PZ-235-treated livers (Fig. 1B) with the largest reductions in both steatosis and lobular inflammation. PZ-235 treatment significantly reduced the overall NAS by 50%. Liver triglycerides were also significantly reduced by 66% in the PZ-235-treated animals (Fig. 1C). Likewise, PZ-235 afforded significant protective effects on plasma alanine transaminase (ALT) and aspartate transaminase (AST) (Fig. 1, D and E). PAR2 expression in the liver increased by 7.4-fold in the MCD mice, and this was significantly suppressed by PZ-235 treatment. These data suggest that PAR2 antagonism with PZ-235 protects against liver steatosis, triglycerides, and inflammation in the MCD model. To assess whether the pepducin could potentially impact early liver fibrosis, we extended the MCD model out to 8 weeks, a time point at which liver fibrosis becomes evident in this NASH model. Although not significant due to the variance in the percentage of fibrosis in the untreated group (0.1–1.4%), the PZ-235 treatment gave an apparent 30% mean protective effect on liver fibrosis at the 8-week end point in the MCD mice (supplemental Fig. 2, A and B). Suppression of CCl4-induced Liver Fibrosis and Inflammatory Cytokines with Delayed PZ-235 Treatment—The efficacy of PZ-235 in suppressing more severe liver fibrosis was then tested using 8-week treatment with carbon tetrachloride (CCl4) to induce extensive liver injury. We delayed administration of PZ-235 until 4 weeks after initiation of CCl4-induced liver fibrosis. Liver fibrosis was quantified after an additional 4 weeks of daily injections of PZ-235 (5 mg/kg) or vehicle control at the 8-week end point (Fig. 2A). In vehicle animals, liver sections revealed a 6-fold increase in liver fibrosis from both sinusoidal collagen deposition and septal fibrosis that was significantly reduced by 75% by delayed PZ-235 treatment (Fig. 2, B and C). A negative control PAR2 pepducin, PZ-234, which has no observed inhibitory effects on PAR2-G protein signaling (P2pal-14GF (13, 38)) or PAR2 calcium responses in either SW620 cells or HUH7 hepatocytes (supplemental Fig. 1, B and C) gave no antifibrotic effects in the 8-week liver fibrosis model (Fig. 2, B and C). As hepatocytes are very sensitive to proinflammatory stimuli, we examined the expression of markers associated with inflammation and stellate cell activation in the livers of mice treated with and without PZ-235. There were pronounced 3.5– 6.5-fold elevations in gene transcripts associated with liver inflammation, including IL-8, IL-6, TNF␣, and monocyte chemoattractant protein-1 (MCP-1) in vehicle control animals treated for 8 weeks with CCl4 as compared with normal mice (Fig. 3). There was also a significant increase in type IV collagen a1 (collagen IV) in the untreated CCl4 livers. Delayed PZ-235 treatment completely suppressed the increases in expression of IL-8, IL-6, and TNF␣ to baseline or below (Fig. 3). PZ-235 treatment also suppressed the increases in MCP-1 and collagen IV by 36 – 60%, which is notable as type IV collagen is considered to be the major collagen type involved in early stage septal fibrosis (39). PZ-235 Inhibits PAR2-dependent Stellate Cell Activation— To directly determine the activity and specificity of the PAR2 antagonist on stellate cells, we showed that PZ-235 blocked PAR2 calcium signaling without inhibiting the thrombin JOURNAL OF BIOLOGICAL CHEMISTRY

23189

Targeting Liver Fibrosis with a PAR2 Pepducin

A

B

H&E

NAFLD Score (NAS)

3 weeks MCD

6 5 4 3 2 1 0

C

D

Hepatic TG (mg/gm)

120

****

90

****

60 30

0 Normal Chow MCD Chow Veh PZ-235

+ + -

+ +

+ + -

E 40 20 0

Normal Chow MCD Chow Veh PZ-235

+ + -

+ +

+ + -

+ +

+ + -

+ +

+ + -

+ +

****

60

****

40 20 0

Normal Chow MCD Chow Veh PZ-235

F

****

****

60

+ +

Hepatic PAR2 (ΔΔCt)

Plasma AST (U/L)

Normal Chow MCD Chow Veh PZ-235

PZ-235

Plasma ALT (U/L)

Vehicle

+ + -

12

+ +

+ + -

+ +

***

9

**

6 3 0

Normal Chow MCD Chow Veh PZ-235

+ + -

+ + -

+ +

FIGURE 1. The PAR2 pepducin PZ-235 reduces hepatic steatosis and inflammation in the experimental MCD model in mice. C57BL/6 male mice were fed normal chow or an MCD diet for 3 weeks and treated daily with PZ-235 (5 mg/kg/day) or vehicle (Veh). A and B, representative 200⫻ photomicrographs of H&E-stained liver sections from vehicle- and PZ-235-treated MCD mice. Liver histology was scored according to the NASH Clinical Research Network criteria to determine the NAS. Liver triglycerides (C), plasma ALT (D), and plasma ALT (E) were measured at the 3-week end point in the MCD mice. F, quantitative PCR of SYBR Green (mean ⫾ S.E., n ⫽ 4 – 6) was determined by the ⌬⌬CT method where PAR2 mRNA was normalized to GAPDH and the lowest adjusted value in the control group. ****, p ⬍ 0.0001; ***, p ⬍ 0.001; **, p ⬍ 0.01 using the Holm-Sidak correction for multiple comparisons. Error bars represent S.E. gm, gram.

response in the LX-2 stellate cell line (Fig. 4A). The pepducin completely prevented activation of phospho-ERK induced by the PAR2 agonists SLIGRL and trypsin (Fig. 4B). Accordingly, stimulation of the stellate cells with 10 nM trypsin significantly increased cell viability over a 4-day period. This increase in stellate cell viability was inhibited by 75% with 1 ␮M PZ-235 (Fig. 4C). As stellate cells have been implicated in the recruitment of inflammatory cells via MCP-1 during active fibrogenesis in liver (40), we tested whether PAR2 activation could induce secretion of MCP-1. LX-2 stellate cells gave an increase in MCP-1 secretion in response to both SLIGRL and trypsin treatment that was blocked by PZ-235 (Fig. 4D). PZ-235 Protects against Hepatocellular Necrosis and PAR2-driven Mitochondrial Reactive Oxygen Species (ROS) Production—We noted a pronounced difference in liver morphology when comparing the hematoxylin and eosin (H&E) staining of liver sections from PZ-235 versus vehicle-treated animals after 8 weeks of CCl4 (Fig. 2B). In particular, the hepa-

23190 JOURNAL OF BIOLOGICAL CHEMISTRY

tocytes of animals not receiving PZ-235 showed enlarged cellular volumes and clear cytosols, consistent with hepatocellular necrosis. These results raised the possibility that the PAR2 inhibitor PZ-235 may not only protect against the activation of stellate cells and fibrosis but may also promote hepatocellular viability. To address the possibility that the PAR2 pepducin could meaningfully impact the development of liver necrosis, we repeated our study with concurrent treatment with PZ-235 and CCl4 over the entire 8-week period of the experiment (Fig. 5A). Concurrent PZ-235 treatment afforded significant suppression of liver fibrosis compared with vehicle animals (Fig. 5, B and C). In addition to improvements in overall tissue morphology, there was a striking 66% protection of the number of viable hepatocytes retained per field in the PZ-235-treated animals (Fig. 5, B and D). As expected, there was a very minor increase in sporadic TUNEL staining in the livers of CCl4treated animals versus normal controls, consistent with CCl4 causing liver necrosis independently of a caspase-driven mechVOLUME 291 • NUMBER 44 • OCTOBER 28, 2016

Targeting Liver Fibrosis with a PAR2 Pepducin

A

A Begin CCl4

B

Begin treatment (Veh or pepducin)

Week1 Week2 Week3 Week4 Week5 Week6 Week7 Week8

B

8 weeks CCl4 +Vehicle

+PZ-235

+PZ-234

Sirius Red

+Vehicle

D

H&E

C

C Hepatic Fibrosis (%Sirius)

** 2.0

**

**

1.5 1.0 0.5 0

+ -

CCl4 Vehicle PZ-235 PZ-234

+ + -

+ +

+ + -

FIGURE 2. Suppression of CCl4-induced liver fibrosis with delayed PZ-235 treatment. A, timeline of treatment. C57BL/6 mice were treated twice weekly for 8 weeks with 1 ␮l of CCl4/g of body weight and PZ-235 (5 mg/kg/day), vehicle (Veh), or inactive control PAR2 pepducin PZ-234 (5 mg/kg/day) started at week 4. B, photomicrographs (200⫻) of Sirius red and H&E staining of liver sections from mice in the different treatment groups at the 8-week end point. C, quantification of percentage of Sirius red staining per 10 fields (mean ⫾ S.E.). Vehicle (no CCl4), n ⫽ 5; CCl4 ⫹ vehicle, n ⫽ 8l CCl4 ⫹ PZ-235, n ⫽ 8; CCl4 ⫹ PZ-234, n ⫽ 3. **, p ⬍ 0.01. Error bars represent S.E. Veh CCl4+Veh CCl4+PZ-235

6

Expression (ΔΔCT)

5

IL-8

6

IL-6

6

4

5

5

4

4

*

3

3

2

2

2

*

* 2.5

7 6 5

3

Collagen IV

MCP-1

8

*

*

TNFα

2.0

4 3

1.5

#

2 1

1

0

1 *

* 0

0

1

1.0

0

0.8

FIGURE 3. PZ-235 suppresses liver expression of inflammatory cytokines in CCl4-treated mice receiving delayed pepducin treatment initiated at week 4. Livers were isolated from mice in Fig. 2 at week 8, and quantitative PCR by SYBR Green (mean ⫾ S.E., n ⫽ 4 – 6) was determined by the ⌬⌬CT method where mRNA expression was normalized to GAPDH and the lowest adjusted value in the control group. #, p ⫽ 0.06; *, p ⬍ 0.05 using the HolmSidak correction for multiple comparisons. Error bars represent S.E. Veh, vehicle.

anism (supplemental Fig. 2, C and D). These data indicate that PZ-235 may prevent hepatocellular death by protecting cells against a necroptotic rather than an apoptotic mechanism in the fibrotic mouse livers. To determine whether PAR2 could induce mitochondrial ROS production in hepatocytes that can trigger necroptotic processes, liver-derived THLE2 cells were OCTOBER 28, 2016 • VOLUME 291 • NUMBER 44

FIGURE 4. PZ-235 blocks PAR2-calcium signaling and activation of LX-2 stellate cells. A, stellate cell (LX-2) calcium mobilization in response to the PAR2 agonist SLIGRL (100 ␮M) is inhibited by PZ-235 (30 ␮M) but does not inhibit the PAR1 agonist thrombin (Thromb) (10 nM). B, ERK phosphorylation (pERK) induced by 30 ␮M SLIGRL or 1 nM trypsin in LX-2 cells is inhibited by 3 ␮M PZ-235. C, PZ-235 (1 ␮M) inhibits LX-2 cell viability induced by 10 nM trypsin (Tryp). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide activity was determined after 96-h stimulation with 10 nM trypsin. D, secretion of MCP-1 into LX-2 medium in response to PAR2 stimulation by the agonists in A is inhibited by 3 ␮M PZ-235. *, p ⬍ 0.05; #, p ⫽ 0.06 based on analysis of variance. Error bars represent S.E. RFU, relative fluorescence units.

stimulated with PAR2 agonists and the kinetics of mitochondrial ROS production were measured. As shown in Fig. 6, A and B, there was a significant increase in the ROS production following PAR2 stimulation by either trypsin or the PAR2-activating peptide LIGRLO as compared with vehicle control. Mitochondrial ROS production induced by either PAR2 stimulus was completely inhibited by PZ-235 to slightly below baseline rates of production (Fig. 6, A and B), consistent with PAR2 exhibiting constitutive activity as we described previously (13). Stimulation of PAR2 in HepG2 cells by trypsin in the presence of exogenous H2O2 gave a significant enhancement in propidium iodide (PI) staining that was inhibited by PZ-235 (Fig. 6C). These data indicate that PAR2 contributes to both ROS production and decreases in hepatocellular viability; therefore, PAR2 signaling may be generally increased in the livers of the mice treated with CCl4. Indeed, as shown in Fig. 6D, treatment of the HepG2 cells with CCl4 gave significant increases in PI staining that was significantly protected by treatment with the PAR2 pepducin. We also documented an increase in the surface expression of PAR2 in response to CCl4 in cultured hepatocytes and in PAR2 mRNA from the livers of animals treated with CCl4 for 8 weeks (supplemental Fig. 3). Together, these data indicate that PAR2 contributes to enhanced hepatocellular necrosis by stimulating excessive ROS production in fibrosis models in mice and that the PAR2 pepducin PZ-235 can afford significant protective effects both in hepatocytes and in vivo. Biodistribution of PZ-235 to Liver and Other Tissues—To quantify the relative propensity of the PAR2 pepducin to be distributed to liver and other organs in vivo, PZ-235 was radioactively labeled at the bridging C1 carbon joining the palmitate JOURNAL OF BIOLOGICAL CHEMISTRY

23191

Targeting Liver Fibrosis with a PAR2 Pepducin

C

Begin CCl4 and treatment (Veh or PZ-235)

Week1 Week2 Week3 Week4 Week5 Week6 Week7 Week8

+Vehicle

+PZ-235

Sirius Red

B

+8 weeks CCl4

Hepatic Fibrosis (%Sirius Red Per Field)

A

*

3 2 1 0

CCl4 Vehicle PZ-235

**

Nuclei

Hepatocellular Nuclei per field

H&E

D

- + + - + - - +

200

**

150

100

CCl4 Vehicle PZ-235

- + + - + - - +

FIGURE 5. Suppression of CCl4-induced liver necrosis and fibrosis with concurrent PZ-235 treatment. A, timeline of treatment. C57BL/6 mice (n ⫽ 10) were treated twice weekly with 1 ␮l of CCl4/g of body weight and with PZ-235 (10 mg/kg/day) or vehicle (Veh) for the entire 8 weeks of the study. B, representative 200⫻ photomicrographs of H&E and Picosirius red staining from the livers of the different treatment groups. C, quantification of nuclei number per 200⫻ field (mean ⫾ S.D. of 10 fields). D, quantification of percentage of Picosirius staining per 200⫻ field (mean ⫾ S.D. of 10 fields). **, p ⬍ 0.01; *, p ⬍ 0.05 using the Holm-Sidak correction for multiple comparisons. Error bars represent S.E.

lipid tag to the i3 loop peptide and injected into mice. As shown in Fig. 7A, PZ-235 exhibited rapid and sustained delivery to liver that accounted for more than 50% of total drug over 1–24 h in the panel of whole organs examined. PZ-235 was also distributed 20% to kidney and 5–10% to lung and in lesser percentages to other organs. On a per gram of tissue basis, however, PZ-235 was fairly evenly distributed to most tissues (supplemental Fig. 4A) with the highest levels in lung, kidney, pancreas, liver, bone marrow, skin, small intestine, spleen, and colon with low levels in muscle and fat and very low levels in brain. PZ-235 also attained rapid, high levels in plasma by either bolus intravenous (i.v.) or s.c. administration. The Cmax levels of PZ-235 reached 6 –10 ␮M following 10 (s.c.) or 3 mg/kg (i.v.) within the first 4 h (Fig. 7B), demonstrating quantitative recovery of PZ-235 for both i.v. and s.c. routes in the blood compartment given a mouse blood volume of 8 –10% of body weight. Drug was still detectable in plasma at 16 h and ranged from 8 (0.3 mg/kg s.c.) to 170 nM (3 mg/kg i.v.). The terminal plasma elimination half-life of 3.1 ⫾ 1.1 h was independent of drug dose or route of administration. Structural Determination of a Cell-penetrating PAR2 Pepducin—The structure of PZ-235 was determined by NMR methods and the details of the structural calculations are summarized in Table 1. A total of 294 distance and 49 dihedral angle constraints were used to generate the structure of the lipidated i3 loop pepducin. PZ-235 adopted a highly structured single ␣-helix with a root mean square deviation of 0.78 ⫾ 0.23 Å (Fig. 7C). The first three N-terminal amino acid residues serve as a flexible linker to the covalently attached palmitate lipid. The tertiary structure of intact PAR2 was then modeled using the structure of the highly analogous human PAR1 and bovine rhodopsin x-ray structures as templates using I-TASSER (Iterative

23192 JOURNAL OF BIOLOGICAL CHEMISTRY

Threading ASSEmbly Refinement). PZ-235 was found to align most closely with the analogous i3-TM6 juxtamembrane region of PAR2 (Fig. 7D) and bovine and squid rhodopsins (supplemental Fig. 4B). It is this critical i3-TM6 domain that undergoes the largest movements (⬃14 Å) within the GPCR structure as the receptors convert from the off-state to the on-state to induce coupling with intracellular G proteins (41), thus providing a model of how PZ-235 may interfere with PAR2-G protein coupling.

Discussion NASH is a growing worldwide epidemic, rising in incidence with obesity, diabetes, and metabolic syndrome, and is becoming the most prevalent cause of liver failure (1, 2). There are no effective therapies yet available to treat the potentially lifethreatening complications resulting from liver fibrosis (5), pointing to an urgent need to more deeply understand the pathophysiology of NASH and identify new points of therapeutic intervention. Emerging evidence points to a novel mechanism linking the development of NASH fibrosis with PAR2, a cell surface protease-activated receptor highly expressed in liver stellate cells, hepatocytes, inflammatory cells, and other mesenchymal cells that regulates the response to tissue injury (13, 14, 42, 43). Here, we demonstrate that the PAR2 pepducin PZ-235 suppresses collagen production, fibrosis, steatosis, triglycerides, and lobular inflammation in mouse models of NASH. PZ-235 blocked PAR2-driven activation, proliferation, and viability of stellate cells and reduced the deposition of collagen and production of inflammatory cytokines as depicted schematically in Fig. 8. The ability of PAR2 to promote progression/ differentiation of the phenotype of mesenchymal cells has been observed in multiple organ systems used in different models of VOLUME 291 • NUMBER 44 • OCTOBER 28, 2016

Targeting Liver Fibrosis with a PAR2 Pepducin Mitochondrial ROS Production 140

Veh PZ-235 LIGRLO LIGRLO+PZ-235

120 100

ROS (%)

B

140

**

***

80 60 40

100

***

* ***

80 60 **

40

20 0

Veh PZ-235 Trypsin Trypsin+PZ-235

120

ROS (%)

A

20 *

0

2

4

6

0

8

0

2

4

C

6

8

Time (h)

Time (h)

D 10 ***

% Increase in PI

% Increase in PI

15

5

0

-5 PZ-235 Trypsin

- + - + - + - + - - ++ - - ++

10

* **

5

0 PZ-235 CCl4 (%)

*

- + - + - + 0

0.001 0.01

250 μM H2O2

FIGURE 6. PZ-235 inhibits mitochondrial ROS production and enhances viability of hepatocytes. THLE2 hepatocytes were treated with vehicle (Veh) or 5 ␮M PZ-235 and then stimulated with LIGRLO (A) or trypsin (B) for the times indicated. Individual points represent the mean ⫾ S.E. for that condition at a particular time point; n ⫽ 7–10 wells per point. C, serum-starved HepG2 cells were pretreated with 5 ␮M PZ-235 or vehicle before being stimulated with 10 nM trypsin for 2 h followed by 6-h treatment with 250 ␮M H2O2. Values shown are mean ⫾ S.E. of the increase in PI from untreated controls; n ⫽ 4 for each condition. Comparisons between conditions and baseline were made by direct two-tailed t tests. D, serum-starved HepG2 cells were treated with 5 ␮M PZ-235 or vehicle, then exposed to CCl4 for 4 h, and analyzed as in C. Significance was determined using the Holm-Sidak correction for multiple comparison. ***, p ⬍ 0.001; **, p ⬍ 0.01; *, p ⬍ 0.05; #, p ⬍ 0.06. Error bars represent S.E.

fibrosis (16, 28) and vascular stenosis (14). PAR2 can activate the expansion of fibroblasts, smooth muscle cells, and/or myofibroblasts to the stage where they have the capacity to induce pathological levels of collagen deposition in liver, kidney, lung, and blood vessels. Interestingly, the PAR2 inhibitor also had significant protective effects against hepatocellular necrosis and attenuated PAR2-driven ROS production in hepatocytes. The increased PAR2 expression in hepatocytes and liver that we documented here may further promote prodeath pathways within the fibrotic livers. Necrosis or necroptotic induction of cell death can be triggered by excessive production of ROS from lipid peroxidative processes originating in the mitochondria (3, 44). Mitochondrial dysfunction and generation of ROS have been shown to play a key role in the pathophysiology of NAFLD and NASH (45). For instance, despite similar mitochondrial content, obese patients with or without non-alcoholic fatty liver disease had 5-fold higher maximal respiration rates in isolated mitochondria than lean subjects (46). NASH patients featured higher mitochondrial mass but 31– 40% lower maximal respiration, which was associated with greater hepatic insulin resistance, mitochondrial uncoupling, and leaking activity (46). In NASH, augmented hepatic oxidative stress was paralleled by OCTOBER 28, 2016 • VOLUME 291 • NUMBER 44

reduced antioxidant defense capacity and increased inflammatory response. These data suggest adaptation of the liver at early stages of obesity-related insulin resistance and NAFLD that is subsequently lost during NASH fibrosis/progression. Our study made the surprising observation that activation of PAR2 significantly stimulated ROS production in hepatocytes, which may contribute to the development of liver necrosis, and that pharmacological inactivation of PAR2 is a potential means to mitigate the necrotic damage associated with enhanced ROS in fibrotic liver disease. The hepatocellular necrosis observed in the fibrotic livers may also be caused by the release of inflammatory cytokines from activated stellate cells. TNF␣ generally acts to reduce hepatocellular viability when cells are under stress (47– 49) and aids in the promotion of IL-8, IL-6, and MCP-1 expression (11). IL-8 and MCP-1 are critically important in the recruitment of inflammatory cells to the nidus of activated stellate cells, which can propagate local fibrosis and cause additional liver damage. The role of stellate cells in controlling the development of fibrosis is complicated by the fact that they appear to operate directly to drive cell death and tissue remodeling (6) as well as being active in liver regeneration (50) and repairing tissue functionality. Hepatocytes are very sensitive to low TNF␣ levels with signaling in certain contexts promoting hepatocellular cell survival, proliferation, and regeneration (51, 52), whereas chronic exposure to TNF␣ promotes hepatocellular cell death and necrosis (49, 53). A similar pattern is also seen with the cytokine IL-6, which in acute doses can cause anti-inflammatory responses (54) but with long term exposure promotes inflammation and lowered rates of hepatocellular proliferation and tissue regeneration (55, 56). The chronic suppression of both of these cytokines by the PZ-235 pepducin is likely to be an additional explanation for our observed net increase in hepatocellular viability and reduced fibrosis and may help to maintain organ functionality in the setting of chronic disease. We show for the first time that pharmacologic inhibition of PAR2 in the 3-week MCD model in mice significantly reduces the NAS. We then extended the MCD diet-induced NASH model out to 8 weeks to induce early fibrosis, which was also apparently suppressed by the PAR2 pepducin. Thus, in addition to reducing the liver histological features of fibrosis, lobular inflammation, and hepatocyte ballooning, the PAR2 pepducin also significantly reduced steatosis as validated biochemically by the ⬎50% drop in liver triglycerides. The mechanistic reason(s) for the PAR2-promoting effects on liver steatosis in the MCD model is not known at this point but is likely quite complex and could reflect changes in lipid and/or sugar metabolism or other biochemical pathways. Unlike obese mouse models of NASH in which mice accumulate abundant visceral fat, mice in the MCD model are lean and actually lose weight. Thus, the effects of the PAR2 pepducin on suppressing liver steatosis reported here are likely due to direct effects on liver metabolism rather than indirect effects on PAR2 in inflammatory cells located in visceral adipose tissue (24). We found that the PAR2 pepducin is rapidly distributed to liver and other tissues with prolonged kinetics, which may account for its high efficacy in the 8-week liver fibrosis models. PZ-235 has a C16 palmitate tail, which may confer preferred JOURNAL OF BIOLOGICAL CHEMISTRY

23193

Targeting Liver Fibrosis with a PAR2 Pepducin

B μ

A

C

NMR Structure

D

palmitate

peptide

Stellate cell activation, proliferation and Inflammatory signaling

FIGURE 7. Liver residence and NMR structural determination of PZ-235. A, biodistribution of [1-14C]palmitate-PZ-235 to individual organs (50,000 cpm injected per mouse (n ⫽ 2) for each time point). Radioactive PZ-235 was mixed 1:2 with unlabeled PZ-235 (10 mg/kg final; 100 ␮l per injection). B, pharmacokinetics of s.c. and i.v. PZ-235 in CF-1 mice determined by LC-MS/MS from plasma samples withdrawn at 5-min–16-h time points (five to seven mice used for each dose). C, ensemble of 30 individual energy-minimized NMR-generated structures (green) of PZ-235 with the average structure (root mean square deviation, 0.78 ⫾ 0.23 Å) shown in red. D, proposed mechanism of membrane insertion and flipping of the PAR2 pepducin and alignment with analogous i3 loop and TM6 regions of the off-state of PAR2. Error bars represent S.E. Hrt, heart; Kid, kidney; Spl, spleen; Panc, pancreas; Sm intest, small intestine.

residency in tissues with higher fat content such as liver and/or in highly vascularized tissues such as kidney and lung. The peptidic portion of the PZ-235 pepducin formed a remarkably well structured ␣-helix that closely resembled the juxtamembrane helical region of the analogous TM6 and i3 loop of PAR2 and squid rhodopsin (57). Notably, squid rhodopsin has a hyperextended TM6-i3 helix as compared with higher eukaryotic GPCRs in the rhodopsin family such as the ␤2-adrenergic receptor. Unlike other opsin GPCRs that signal through a Go(i) signaling pathway, squid rhodopsin instead signals through a Gq pathway (58). PAR2 efficiently couples to both Gq and Gi pathways (59). Likewise, we found that PZ-235 inhibits both PAR2-Gq (calcium mobilization) and PAR2-Gi (ERK) signaling. As PZ-235 does not have agonist activity, we speculate that PZ-235 replaces/inserts into this most mobile portion (analogous cytoplasmic TM6-i3 loop segment) of its cognate receptor to block the ability of PAR2 to directly couple with intracellular G proteins or induces a PAR2 conformation that is not conducive for PAR2-G protein signaling. The ability of PZ-235 to provide substantial effects in suppressing liver fibrosis and necro-

23194 JOURNAL OF BIOLOGICAL CHEMISTRY

sis, in addition to blocking PAR2-ROS production and induction of inflammatory cytokines, indicates the potential for PAR2 inhibitors to be efficacious in the treatment of liver fibrosis.

Experimental Procedures NMR Structural Determination of PZ-235—PZ-235 (P2pal18S; palmitate-RSSAMDENSEKKRKSAIK-NH2) antagonist and negative control pepducin PZ-234 (P2pal-14GF; palmitateGDENSEKKRKSAIF-NH2) were synthesized as before (13) by standard Fmoc (N-(9-fluorenyl)methoxycarbonyl) solid-phase methods and purified to 99.1% purity by reverse phase high performance liquid chromatography (HPLC). The methionine residue in PZ-235 was replaced with an isoleucine to reduce oxidation during NMR data acquisition. The lyophilized pepducin was dissolved in a buffer comprising 270 mM dodecylphosphocholine-d38, 10 mM acetate-d4, 0.02% NaN3, and 0.016 mM 4,4-dimethyl-4-silapentane-1-sulfonic acid at pH 5.66. The final concentration of the pepducin was 1 mM. NMR spectra included total correlation spectroscopy with a mixing time of 40 ms and nuclear Overhauser effect spectroscopy (NOESY) VOLUME 291 • NUMBER 44 • OCTOBER 28, 2016

Targeting Liver Fibrosis with a PAR2 Pepducin TABLE 1 NMR structural parameters of the PZ-235 PAR2 i3 loop pepducin NMR spectra of PZ-235 were recorded using total correlation spectroscopy with a mixing time of 40 ms, NOESY with a mixing time of 200 ms, and natural abundance 13 C heteronuclear single quantum coherence spectroscopy. Data were collected at 600 MHz at 20 °C. r.m.s., root mean square. Experimental restraints Distance restraints from NOEs Dihedral angle restraints Hydrogen bond restraints Total no. of experimental restraints

294 49 0 343

r.m.s. deviations from experimental data Average distance restraint violation (Å) Dihedral restraint violations ⬎5°

0.011 ⫾ 0.037 0

r.m.s. deviations from ideal stereochemistry Bonds (Å) Angles (°) Impropers (°)

0.0008 ⫾ 0.0001 0.240 ⫾ 0.008 0.092 ⫾ 0.008

Ramachandran analysis of the structures (%) Residues in favored regions Residues in additionally allowed regions Residues in generously allowed regions Residues in disallowed regions

82.4 11.8 5.9 0

Lennard-Jones potential energies Ensemble average (kcal/mol)

8.8 ⫾ 1.5

Coordinate precision of peptide (Å) Backbone All heavy atoms

0.78 ⫾ 0.23 1.81 ⫾ 0.29

with a mixing time of 200 ms. Data were collected on a Bruker Avance 600-MHz spectrometer at 20 °C. Resonances were assigned and distance restraints were obtained by standard methods. Proton chemical shifts, dihedral restraints obtained using PREDITOR, and distance restraints were used as input to generate 29 structures through simulated annealing, energy minimization, and refinement using CNSSolve version 1.3. Mouse Experiments—C57BL/6 male mice (10 –12 weeks) were purchased from Charles River Laboratories and maintained in climate-controlled rooms in the certified and accredited Division of Laboratory Animal Medicine at Tufts University. All experiments were performed in accordance with the guidelines of the National Institutes of Health and approved by the Tufts Medical Center Institutional Animal Care and Use Committee. At the end of each experiment, animals were weighed, and blood and liver samples were collected. Animals were euthanized with CO2 following anesthesia. Pharmacokinetics and Biodistribution of PZ-235—C57BL/6 mice were injected either intravenously or subcutaneously with various doses of PZ-235. Blood was collected at 5-min– 48-h time points, and pepducin concentrations in plasma were measured by quantitative LC-MS/MS methods (Novabioassays, Woburn MA). To determine the biodistribution of PZ-235, 14 C-labeled and unlabeled pepducins were mixed at a ratio of 1:2 and injected at 5000 cpm/animal; selected animal tissues were harvested and dissolved in 4 M NaOH with 1% Triton X-100 and 1% SDS overnight. Subsequently, 7.5 ml of scintillation fluid (PerkinElmer Life Sciences) was added, and radioactivity was measured using a scintillation counter. MCD-induced Mouse NAFLD Model—C57BL/6 male mice were fed an MCD diet or a normal chow diet for 3- (experimental model for hepatic steatosis and inflammation) and 8-week (experimental model for early hepatic fibrosis) time periods. MCD mice were treated with subcutaneous injections of the cell-penetrating PAR2 inhibitory pepducin PZ-235 (5 mg/kg/ OCTOBER 28, 2016 • VOLUME 291 • NUMBER 44

day) or vehicle. All mice were permitted food and water consumption ad libitum. Body weight and food consumption were monitored weekly. At completion of the experiment, whole blood and livers were collected from each animal. Liver tissue was snap frozen at ⫺80 °C for subsequent biochemical analyses. Plasma ALT and AST and hepatic triglycerides were measured using commercially available kits (Cayman Chemical and Sigma). CCl4-induced Mouse Fibrosis Model and Treatment Protocols—Intraperitoneal injections of CCl4 (Sigma-Aldrich) at 1 ␮l/g of body weight (dissolved 1:10 in olive oil) twice a week for a period of 8 weeks were used to generate liver fibrosis in the C57BL/6 mice. PZ-235 or PZ-234 was dissolved in 5% dimethyl sulfoxide (DMSO). Treatment groups received s.c. injections of 5 mg/kg PZ-235 or PZ-234 six times a week either starting at week 4 (delayed treatment) or at week 0 (concurrent treatment), whereas control groups received vehicle (5% DMSO). Animals were sacrificed 3 days following the last CCl4 injection, and blood samples were collected in tubes containing heparin. Plasma was then separated by centrifugation at 3000 rpm for 10 min. Liver samples were harvested and weighed. A segment of each harvested liver was fixed with 10% neutral buffered formalin for histological analysis, and the remaining tissue was snap frozen and stored at ⫺80 °C for subsequent biochemical and gene expression analyses. Histopathological Analysis—Liver tissues were sectioned (5 ␮m) and stained with either Sirius red or H&E and observed with a Nikon Eclipse 80i microscope connected to a Spot 7.4 Slider camera. Slides were assigned a number, and 10 randomly chosen 200⫻ fields were visualized. The assigned fields were analyzed using ImageJ (National Institutes of Health, Bethesda, MD). Sirius red staining values were obtained by adjusting the threshold setting of the green channel from the original image; values are displayed as a percentage of the total pixels. Hepatocellular nuclei were identified by morphology and tabulated using the counter function. mRNA Isolation and Quantitative RT-PCR—Total mRNA was extracted from the harvested liver samples using the RNeasy Mini kit (Qiagen). mRNA was reversed transcribed, and real time quantitative PCR was conducted using SYBR Green Master Mix (Roche Applied Science) and a 40-cycle thermocycling protocol. The data are represented as relative -fold changes in mRNA normalized to GAPDH. The following primers were used: IL-8 forward primer, ATCTTCGTCCGTCCCTGTGA; IL-8 reverse primer, CTGTTGCAGTAAATGGTCTCGAA; IL-6 forward primer, ACAACCACGGCCTTCCCTACTT; IL-6 reverse primer, GTGTAATTAAGCCTCCGACT; TNF␣ forward primer, CGTGCTCCTCACCCACAC; TNF␣ reverse primer, GGGTTCATACCAGGGTTTGA; MCP-1 forward primer, AGGTCCCTGTCATGCTTCTG; MCP-1 reverse primer, ATTTGGTTCCGATCCAGGTT; collagen IVa1 forward primer, GATGTTCAAGAAGCCCACGC; collagen IVa1 reverse primer, GCAGAGGCGAGCATCATAGT; PAR2 forward primer, CTTGCACCGGGACGCA; PAR2 reverse primer, AAAGCCTGGTTCTACCGGAAC. Cell Culture—The LX-2 human hepatic stellate cell line was a generous gift from Dr. Scott Friedman (Mt. Sinai School of Medicine, New York, NY). The LX-2 cells and SW620 adenoJOURNAL OF BIOLOGICAL CHEMISTRY

23195

Targeting Liver Fibrosis with a PAR2 Pepducin

PAR2

PAR2

Activated PAR2

FIGURE 8. Proposed mechanism of action of PAR2 in promoting liver fibrosis, necrosis, and steatosis in NASH. Procoagulant proteases such as factors VIIa and Xa are up-regulated in liver during the prothrombotic state that occurs during NASH progression. PAR2 is cleaved on the surface of stellate cells by these proteases to cause activation to a proliferative myofibroblast and enhanced secretion of collagen matrix and inflammatory cytokines, leading to liver fibrosis. Proteolytic cleavage of PAR2 on hepatocytes leads to steatosis, ROS production, and hepatocellular necrosis.

carcinoma cells (ATCC) were grown in DMEM (Corning CellGro) supplemented with 10% FBS (Invitrogen) and 1% penicillin/streptomycin (Invitrogen). The THLE-2 cells (ATCC) were propagated following the manufacturer’s recommendations using the BEGM Bullet kit (Lonza) with the addition of phosphoethanolamine (70 ng/ml) and 10% FBS but without gentamycin and epinephrine. Ca2⫹ Flux Assays—The SW620 and LX-2 cells were resuspended in Krebs-Ringer bicarbonate buffer and labeled with 2.5 ␮M Fura-2/AM (Molecular Probes) by incubating for 30 min at 37 °C with gentle shaking. The fluorescence emission was recorded at 510 nm with dual excitation at 340 and 380 nm at 25 °C using a PerkinElmer Life Sciences LS 50B spectrofluorometer. Immunoblotting—LX-2 cells were propagated till confluent and treated with either the agonist SLIGRL (30 ␮M) or trypsin (1 nM). The PAR2 antagonist pepducin PZ-235 (3 ␮M) was added to the cells 15 min prior to agonist treatment. Cells were lysed with 300 ␮l of Tissue Protein Extraction Reagent (T-PER; Fisher Scientific) at 4 °C, and protein was quantified using a Bradford assay. Equal amounts of proteins were loaded for SDS-PAGE, and gel bands were transferred to a PVDF membrane (Millipore, Billerica, MA) as described (60) with horseradish peroxidase (HRP)-conjugated secondary antibodies used at a dilution of 1:5000. The immunoblots were probed for phospho-ERK1/2 (Cell Signaling Technology catalog number 4370S; 1:1000), total ERK antibody (Cell Signaling Technology catalog number 9102S; 1:1000) and ␤-tubulin (Cell Signaling Technology catalog number 2146S; 1:5000) and visualized using ECL reagent (Pierce). Enzyme-linked Immunosorbent Assay (ELISA) for MCP-1— LX-2 cells were treated with either the agonist SLIGRL (100 ␮M) or trypsin ( 1 nM) with and without PZ-235 (1 ␮M) treatment for 24 h. The conditioned medium was collected and assayed for MCP-1 by sandwich ELISA using a commercially available kit (Quantikine, Minneapolis, MN) according to the manufacturer’s instructions.

23196 JOURNAL OF BIOLOGICAL CHEMISTRY

ROS Production Assay—THLE2 cells were harvested using 5 mM EDTA, PBS and replated in 96-well plates. Cells were allowed to settle overnight, and medium was removed and replaced with Hanks’ balanced salt solution (with calcium and magnesium) and 1% FBS. Cells were preincubated with either PZ-235 (3 ␮M) or vehicle (0.2% DMSO) for 45 min and pretreated with MitoSOX (Life Technologies) for 10 min according to the manufacturer’s instructions. Following incubation, cells were washed with PBS and fresh Hanks’ balanced salt solution with 1% FBS with additional PZ-235 in addition to 1 ␮M LIGRLO or 10 nM trypsin. Fluorescence was measured (excitation, 510 nm; emission, 580 nm) using a FlexStation 3 multimode microplate reader at times 0, 2, 4, and 8 h post-treatment. Baseline signal at time 0 was subtracted from all readings and compared with the average increase in signal recorded in untreated condition. Statistical Analyses—All of the values in the figures are expressed as means ⫾ S.E. Comparisons between experimental and control cohorts were performed by one-way analysis of variance, and the means of the different groups were compared using the Holm-Sidak post hoc correction. Analysis was performed using GraphPad Prism 6.0 (San Diego, CA). Statistical significance was defined as p ⬍ 0.05 (*), p ⬍ 0.01 (**), or p ⬍ 0.001 (***). Author Contributions—A. M. S., R. R., K. A., N. N., A. B., and J. D. B. performed experiments, analyzed the data, and wrote the manuscript. L. C. contributed to writing the manuscript and experimental design. A. K. conceived the study, analyzed the data, and wrote the manuscript.

References 1. LaBrecque, D., Abbas, A., Anania, F., Ferenci, P., Ghafoor-Khan, A., Goh K.-L., Hamid, S. S., Isakov, V., Lizarzabal, M., Mojica-Pernaranda, M., Rivera-Ramos, J. F., Sarin, S., Stimac, D., Thomson, A. B., Umar, M., et al. (2012) Nonalcoholic fatty liver disease and nonalcoholic steatohepatitis, in World Gastroenterology Organisation Global Guidelines (World Gastroenterology Organisation, ed) World Gastroenterology Organisation, Milwaukee, WI

VOLUME 291 • NUMBER 44 • OCTOBER 28, 2016

Targeting Liver Fibrosis with a PAR2 Pepducin 2. Fujii, H., and Kawada, N. (2012) Inflammation and fibrogenesis in steatohepatitis. J Gastroenterol. 47, 215–225 3. Machado, M. V., and Diehl, A. M. (2016) Pathogenesis of nonalcoholic steatohepatitis. Gastroenterology 150, 1769 –1777 4. Schuppan, D., and Kim, Y. O. (2013) Evolving therapies for liver fibrosis. J. Clin. Investig. 123, 1887–1901 5. Wieser, V., Adolph, T. E., Enrich, B., Kuliopulos, A., Kaser, A., Tilg, H., and Kaneider, N. C. (2016) Reversal of murine alcoholic steatohepatitis by pepducin-based functional blockade of interleukin-8 receptors. Gut 10.1136/gutjnl-2015-310344 6. Novo, E., Cannito, S., Morello, E., Paternostro, C., Bocca, C., Miglietta, A., and Parola, M. (2015) Hepatic myofibroblasts and fibrogenic progression of chronic liver diseases. Histol. Histopathol. 30, 1011–1032 7. Rockey, D. C., Bell, P. D., and Hill, J. A. (2015) Fibrosis—a common pathway to organ injury and failure. N. Engl. J. Med. 372, 1138 –1149 8. Sauvant, P., Cansell, M., and Atgié, C. (2011) Vitamin A and lipid metabolism: relationship between hepatic stellate cells (HSCs) and adipocytes. J. Physiol. Biochem. 67, 487– 496 9. Mederacke, I., Hsu, C. C., Troeger, J. S., Huebener, P., Mu, X., Dapito, D. H., Pradere, J. P., and Schwabe, R. F. (2013) Fate tracing reveals hepatic stellate cells as dominant contributors to liver fibrosis independent of its aetiology. Nat. Commun. 4, 2823 10. Thirunavukkarasu, C., Watkins, S. C., and Gandhi, C. R. (2006) Mechanisms of endotoxin-induced NO, IL-6, and TNF-␣ production in activated rat hepatic stellate cells: role of p38 MAPK. Hepatology 44, 389 –398 11. Pellicoro, A., Ramachandran, P., Iredale, J. P., and Fallowfield, J. A. (2014) Liver fibrosis and repair: immune regulation of wound healing in a solid organ. Nat. Rev. Immunol. 14, 181–194 12. Kisseleva, T., Cong, M., Paik, Y., Scholten, D., Jiang, C., Benner, C., Iwaisako, K., Moore-Morris, T., Scott, B., Tsukamoto, H., Evans, S. M., Dillmann, W., Glass, C. K., and Brenner, D. A. (2012) Myofibroblasts revert to an inactive phenotype during regression of liver fibrosis. Proc. Natl. Acad. Sci. U.S.A. 109, 9448 –9453 13. Sevigny, L. M., Zhang, P., Bohm, A., Lazarides, K., Perides, G., Covic, L., and Kuliopulos, A. (2011) Interdicting protease-activated receptor-2driven inflammation with cell-penetrating pepducins. Proc. Natl. Acad. Sci. U.S.A. 108, 8491– 8496 14. Sevigny, L. M., Austin, K. M., Zhang, P., Kasuda, S., Koukos, G., Sharifi, S., Covic, L., and Kuliopulos, A. (2011) Protease-activated receptor-2 modulates protease-activated receptor-1-driven neointimal hyperplasia. Arterioscler. Thromb. Vasc. Biol. 31, e100 –106 15. Knight, V., Tchongue, J., Lourensz, D., Tipping, P., and Sievert, W. (2012) Protease-activated receptor 2 promotes experimental liver fibrosis in mice and activates human hepatic stellate cells. Hepatology 55, 879 – 887 16. Chung, H., Ramachandran, R., Hollenberg, M. D., and Muruve, D. A. (2013) Proteinase-activated receptor-2 transactivation of epidermal growth factor receptor and transforming growth factor-␤ receptor signaling pathways contributes to renal fibrosis. J. Biol. Chem. 288, 37319 –37331 17. Borensztajn, K., Bresser, P., van der Loos, C., Bot, I., van den Blink, B., den Bakker, M. A., Daalhuisen, J., Groot, A. P., Peppelenbosch, M. P., von der Thüsen, J. H., and Spek, C. A. (2010) Protease-activated receptor-2 induces myofibroblast differentiation and tissue factor up-regulation during bleomycin-induced lung injury: potential role in pulmonary fibrosis. Am. J. Pathol. 177, 2753–2764 18. Seeley, S., Covic, L., Jacques, S. L., Sudmeier, J., Baleja, J. D., and Kuliopulos, A. (2003) Structural basis for thrombin activation of a protease-activated receptor: inhibition of intramolecular liganding. Chem. Biol. 10, 1033–1041 19. Trivedi, V., Boire, A., Tchernychev, B., Kaneider, N. C., Leger, A. J., O’Callaghan, K., Covic, L., and Kuliopulos, A. (2009) Platelet matrix metalloprotease-1 mediates thrombogenesis by activating PAR1 at a cryptic ligand site. Cell 137, 332–343 20. Hollenberg, M. D., Mihara, K., Polley, D., Suen, J. Y., Han, A., Fairlie, D. P., and Ramachandran, R. (2014) Biased signalling and proteinase-activated receptors (PARs): targeting inflammatory disease. Br. J. Pharmacol. 171, 1180 –1194

OCTOBER 28, 2016 • VOLUME 291 • NUMBER 44

21. Seitz, I., Hess, S., Schulz, H., Eckl, R., Busch, G., Montens, H. P., Brandl, R., Seidl, S., Schömig, A., and Ott, I. (2007) Membrane-type serine protease1/matriptase induces interleukin-6 and -8 in endothelial cells by activation of protease-activated receptor-2: potential implications in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 27, 769 –775 22. Camerer, E., Huang, W., and Coughlin, S. R. (2000) Tissue factor- and factor X-dependent activation of protease-activated receptor 2 by factor VIIa. Proc. Natl. Acad. Sci. U.S.A. 97, 5255–5260 23. Riewald, M., and Ruf, W. (2001) Mechanistic coupling of protease signaling and initiation of coagulation by tissue factor. Proc. Natl. Acad. Sci. U.S.A. 98, 7742–7747 24. Badeanlou, L., Furlan-Freguia, C., Yang, G., Ruf, W., and Samad, F. (2011) Tissue factor-protease-activated receptor 2 signaling promotes diet-induced obesity and adipose inflammation. Nat. Med. 17, 1490 –1497 25. Sullivan, B. P., Kopec, A. K., Joshi, N., Cline, H., Brown, J. A., Bishop, S. C., Kassel, K. M., Rockwell, C., Mackman, N., and Luyendyk, J. P. (2013) Hepatocyte tissue factor activates the coagulation cascade in mice. Blood 121, 1868 –1874 26. Rautou, P. E., Vion, A. C., Luyendyk, J. P., and Mackman, N. (2014) Circulating microparticle tissue factor activity is increased in patients with cirrhosis. Hepatology 60, 1793–1795 27. Nystedt, S., Ramakrishnan, V., and Sundelin, J. (1996) The proteinaseactivated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J. Biol. Chem. 271, 14910 –14915 28. Wygrecka, M., Kwapiszewska, G., Jablonska, E., von Gerlach, S., Henneke, I., Zakrzewicz, D., Guenther, A., Preissner, K. T., and Markart, P. (2011) Role of protease-activated receptor-2 in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 183, 1703–1714 29. Kuliopulos, A., and Covic, L. (2003) Blocking receptors on the inside: pepducin-based intervention of PAR signaling and thrombosis. Life Sci. 74, 255–262 30. O’Callaghan, K., Kuliopulos, A., and Covic, L. (2012) Turning receptors on and off with intracellular pepducins: new insights into G-protein-coupled receptor drug development. J. Biol. Chem. 287, 12787–12796 31. Gurbel, P. A., Bliden, K. P., Turner, S. E., Tantry, U. S., Gesheff, M. G., Barr, T. P., Covic, L., and Kuliopulos, A. (2016) Cell-penetrating pepducin therapy targeting PAR1 in subjects with coronary artery disease. Arterioscler. Thromb. Vasc. Biol. 36, 189 –197 32. Covic, L., Gresser, A. L., Talavera, J., Swift, S., and Kuliopulos, A. (2002) Activation and inhibition of G protein-coupled receptors by cell-penetrating membrane-tethered peptides. Proc. Natl. Acad. Sci. U.S.A. 99, 643– 648 33. Wielders, S. J., Bennaghmouch, A., Reutelingsperger, C. P., Bevers, E. M., and Lindhout, T. (2007) Anticoagulant and antithrombotic properties of intracellular protease-activated receptor antagonists. J. Thromb. Haemost. 5, 571–576 34. Tsuji, M., Ueda, S., Hirayama, T., Okuda, K., Sakaguchi, Y., Isono, A., and Nagasawa, H. (2013) FRET-based imaging of transbilayer movement of pepducin in living cells by novel intracellular bioreductively activatable fluorescent probes. Org. Biomol. Chem. 11, 3030 –3037 35. Zhang, P., Gruber, A., Kasuda, S., Kimmelstiel, C., O’Callaghan, K., Cox, D. H., Bohm, A., Baleja, J. D., Covic, L., and Kuliopulos, A. (2012) Suppression of arterial thrombosis without affecting hemostatic parameters with a cell-penetrating PAR1 pepducin. Circulation 126, 83–91 36. Zhang, P., Leger, A. J., Baleja, J. D., Rana, R., Corlin, T., Nguyen, N., Koukos, G., Bohm, A., Covic, L., and Kuliopulos, A. (2015) Allosteric activation of a G protein-coupled receptor with cell-penetrating receptor mimetics. J. Biol. Chem. 290, 15785–15798 37. Quoyer, J., Janz, J. M., Luo, J., Ren, Y., Armando, S., Lukashova, V., Benovic, J. L., Carlson, K. E., Hunt, S. W., 3rd, and Bouvier, M. (2013) Pepducin targeting the C-X-C chemokine receptor type 4 acts as a biased agonist favoring activation of the inhibitory G protein. Proc. Natl. Acad. Sci. U.S.A. 110, E5088 –E5097 38. Michael, E. S., Kuliopulos, A., Covic, L., Steer, M. L., and Perides, G. (2013) Pharmacological inhibition of PAR2 with the pepducin P2pal-18S protects mice against acute experimental biliary pancreatitis. Am. J. Physiol. Gastrointest. Liver Physiol. 304, G516 –G526

JOURNAL OF BIOLOGICAL CHEMISTRY

23197

Targeting Liver Fibrosis with a PAR2 Pepducin 39. Mak, K. M., Chen, L. L., and Lee, T. F. (2013) Codistribution of collagen type IV and laminin in liver fibrosis of elderly cadavers: immunohistochemical marker of perisinusoidal basement membrane formation. Anat. Rec. 296, 953–964 40. Marra, F., DeFranco, R., Grappone, C., Milani, S., Pastacaldi, S., Pinzani, M., Romanelli, R. G., Laffi, G., and Gentilini, P. (1998) Increased expression of monocyte chemotactic protein-1 during active hepatic fibrogenesis: correlation with monocyte infiltration. Am. J. Pathol 152, 423– 430 41. Rasmussen, S. G., DeVree, B. T., Zou, Y., Kruse, A. C., Chung, K. Y., Kobilka, T. S., Thian, F. S., Chae, P. S., Pardon, E., Calinski, D., Mathiesen, J. M., Shah, S. T., Lyons, J. A., Caffrey, M., Gellman, et al. (2011) Crystal structure of the ␤2 adrenergic receptor-Gs protein complex. Nature 477, 549 –555 42. Borensztajn, K., von der Thüsen, J. H., Peppelenbosch, M. P., and Spek, C. A. (2010) The coagulation factor Xa/protease activated receptor-2 axis in the progression of liver fibrosis: a multifaceted paradigm. J. Cell. Mol. Med. 14, 143–153 43. Ruf, W., and Samad, F. (2015) Tissue factor pathways linking obesity and inflammation. Hamostaseologie 35, 279 –283 44. Su, Z., Yang, Z., Xie, L., DeWitt, J. P., and Chen, Y. (2016) Cancer therapy in the necroptosis era. Cell Death Differ. 23, 748 –756 45. Begriche, K., Massart, J., Robin, M. A., Bonnet, F., and Fromenty, B. (2013) Mitochondrial adaptations and dysfunctions in nonalcoholic fatty liver disease. Hepatology 58, 1497–1507 46. Koliaki, C., Szendroedi, J., Kaul, K., Jelenik, T., Nowotny, P., Jankowiak, F., Herder, C., Carstensen, M., Krausch, M., Knoefel, W. T., Schlensak, M., and Roden, M. (2015) Adaptation of hepatic mitochondrial function in humans with non-alcoholic fatty liver is lost in steatohepatitis. Cell Metab. 21, 739 –746 47. Pfeffer, K., Matsuyama, T., Kündig, T. M., Wakeham, A., Kishihara, K., Shahinian, A., Wiegmann, K., Ohashi, P. S., Krönke, M., and Mak, T. W. (1993) Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73, 457– 467 48. Rothe, J., Lesslauer, W., Lötscher, H., Lang, Y., Koebel, P., Köntgen, F., Althage, A., Zinkernagel, R., Steinmetz, M., and Bluethmann, H. (1993) Mice lacking the tumour necrosis factor receptor 1 are resistant to TNFmediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364, 798 – 802

23198 JOURNAL OF BIOLOGICAL CHEMISTRY

49. Kaufmann, T., Jost, P. J., Pellegrini, M., Puthalakath, H., Gugasyan, R., Gerondakis, S., Cretney, E., Smyth, M. J., Silke, J., Hakem, R., Bouillet, P., Mak, T. W., Dixit, V. M., and Strasser, A. (2009) Fatal hepatitis mediated by tumor necrosis factor TNF␣ requires caspase-8 and involves the BH3only proteins Bid and Bim. Immunity 30, 56 – 66 50. Michelotti, G. A., Xie, G., Swiderska, M., Choi, S. S., Karaca, G., Krüger, L., Premont, R., Yang, L., Syn, W. K., Metzger, D., and Diehl, A. M. (2013) Smoothened is a master regulator of adult liver repair. J. Clin. Investig. 123, 2380 –2394 51. Micheau, O., and Tschopp, J. (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114, 181–190 52. Schwabe, R. F., and Brenner, D. A. (2006) Mechanisms of liver injury. I. TNF-␣-induced liver injury: role of IKK, JNK, and ROS pathways. Am. J. Physiol. Gastrointest. Liver Physiol. 290, G583–G589 53. Jones, B. E., Lo, C. R., Liu, H., Srinivasan, A., Streetz, K., Valentino, K. L., and Czaja, M. J. (2000) Hepatocytes sensitized to tumor necrosis factor-␣ cytotoxicity undergo apoptosis through caspase-dependent and caspaseindependent pathways. J. Biol. Chem. 275, 705–712 54. Streetz, K. L., Luedde, T., Manns, M. P., and Trautwein, C. (2000) Interleukin 6 and liver regeneration. Gut 47, 309 –312 55. Klausen, P., Pedersen, L., Jurlander, J., and Baumann, H. (2000) Oncostatin M and interleukin 6 inhibit cell cycle progression by prevention of p27kip1 degradation in HepG2 cells. Oncogene 19, 3675–3683 56. Jin, X., Zimmers, T. A., Perez, E. A., Pierce, R. H., Zhang, Z., and Koniaris, L. G. (2006) Paradoxical effects of short- and long-term interleukin-6 exposure on liver injury and repair. Hepatology 43, 474 – 484 57. Shimamura, T., Hiraki, K., Takahashi, N., Hori, T., Ago, H., Masuda, K., Takio, K., Ishiguro, M., and Miyano, M. (2008) Crystal structure of squid rhodopsin with intracellularly extended cytoplasmic region. J. Biol. Chem. 283, 17753–17756 58. Murakami, M., and Kouyama, T. (2011) Crystallographic analysis of the primary photochemical reaction of squid rhodopsin. J. Mol. Biol. 413, 615– 627 59. Kaneider, N. C., Leger, A. J., Agarwal, A., Nguyen, N., Perides, G., Derian, C., Covic, L., and Kuliopulos, A. (2007) ’Role reversal’ for the receptor PAR1 in sepsis-induced vascular damage. Nat. Immunol. 8, 1303–1312 60. Kuliopulos, A., Nelson, N. P., Yamada, M., Walsh, C. T., Furie, B., Furie, B. C., and Roth, D. A. (1994) Localization of the affinity peptide-substrate inactivator site on recombinant vitamin K-dependent carboxylase. J. Biol. Chem. 269, 21364 –21370

VOLUME 291 • NUMBER 44 • OCTOBER 28, 2016