Targeting Cdk11 in Osteosarcoma Cells Using the CRISPR-cas9 System Yong Feng,1,2 Slim Sassi,3 Jacson K. Shen,1 Xiaoqian Yang,1 Yan Gao,1 Eiji Osaka,1 Jianming Zhang,4 Shuhua Yang,2 Cao Yang,2 Henry J. Mankin,1 Francis J. Hornicek,1 Zhenfeng Duan1 1

Department of Orthopaedic Surgery, Sarcoma Biology Laboratory, Massachusetts General Hospital and Harvard Medical School, 55 Fruit Street, Jackson 1115 02114, Boston, Massachusetts, 2Department of Orthopaedic Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jie Fang Avenue 430022, Wuhan, China, 3Center for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, 02114, Boston, Massachusetts, 4Cutaneous Biology Research Center, Massachusetts General Hospital, Harvard Medical School, 02114, Boston, Massachusetts

Received 9 June 2014; accepted 2 September 2014 Published online in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jor.22745

ABSTRACT: Osteosarcoma is the most common type primary malignant tumor of bone. Patients with regional osteosarcoma are routinely treated with surgery and chemotherapy. In addition, many patients with metastatic or recurrent osteosarcoma show poor prognosis with current chemotherapy agents. Therefore, it is important to improve the general condition and the overall survival rate of patients with osteosarcoma by identifying novel therapeutic strategies. Recent studies have revealed that CDK11 is essential in osteosarcoma cell growth and survival by inhibiting CDK11 mRNA expression with RNAi. Here, we apply the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 system, a robust and highly efficient novel genome editing tool, to determine the effect of targeting endogenous CDK11 gene at the DNA level in osteosarcoma cell lines. We show that CDK11 can be efficiently silenced by CRISPR-Cas9. Inhibition of CDK11 is associated with decreased cell proliferation and viability, and induces cell death in osteosarcoma cell lines KHOS and U-2OS. Furthermore, the migration and invasion activities are also markedly reduced by CDK11 knockout. These results demonstrate that CRISPR-Cas9 system is a useful tool for the modification of endogenous CDK11 gene expression, and CRISPR-Cas9 targeted CDK11 knockout may be a promising therapeutic regimen for the treatment of osteosarcoma. ß 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: osteosarcoma; CRISPR-Cas9; CDK11

Osteosarcoma is the most common type of primary malignant bone tumor. Traditional treatments of osteosarcoma involve surgery with adjuvant systemic chemotherapy with several chemotherapeutic agents, such as doxorubicin, cisplatin, ifosfamide, and methotrexate.1,2 However, if these agents fail to show favorable tumor response, further chemotherapeutic options are very limited. In addition, despite aggressive chemotherapy, many patients with metastatic or recurrent osteosarcoma show poor prognosis and poor response to current chemotherapy agents. Most of these relapsed patients will eventually develop multidrug resistance in the late stages of osteosarcoma; the average survival period after metastases is less than one year. Therefore, to improve the survival rate of osteosarcoma patients and their overall well-being, novel therapeutic strategies are urgently needed. The discovery of oncogenic kinases and target-specific small-molecule inhibitors has revolutionized the treatment of a select group of cancers, including chronic myeloid leukemia (CML) with BCR-ABL, gastrointestinal stromal tumors (GIST) with c-KIT, and non-small cell lung cancer with EGFR. However, the therapeutic value of targeting kinases in osteosarcoma

Conflict of interest: None. Grant sponsor: Gattegno and Wechsler; Grant sponsor: Kenneth Stanton; Grant sponsor: Sarcoma Foundation of America; Grant sponsor: National Cancer Institute/National Institutes of Health; Grant number: UO1 CA 151452-01; Grant sponsor: Sarcoma SPORE/NIH; Grant sponsor: Academic Enrichment MGH Orthopaedics; Grant sponsor: National Science Foundation China; Grant number: 81101375. Correspondence to: Zhenfeng Duan (T: þ1-617-724-3144; F: þ1617-726-3883; E-mail: [email protected]) # 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

is still unknown. Protein kinases play important roles in regulating cellular functions and are critical for tumorigenesis, proliferation/survival, cell metabolism, apoptosis, DNA damage repair, cell motility, and drug resistance. In an effort to identify new therapeutic targets in osteosarcoma, we found that knockdown of CDK11 (cyclin-dependent kinase 11, also known as CDC2L for cell division cycle 2-like or PITSLRE) by short hairpin RNA (shRNA) or short interfering RNA (siRNA) inhibited tumor cell growth and induced apoptosis.3 Importantly, nuclear CDK11 expression levels correlated with clinical prognosis in osteosarcoma patients. Systemic in vivo administration of in vivo ready CDK11 siRNA reduced tumor growth in an osteosarcoma xenograft model. These observations demonstrate that CDK11 signaling is essential in osteosarcoma cell growth and survival, and that CDK11 may be a promising therapeutic target in the management of osteosarcoma. Thus far, siRNA and shRNA have been used to target CDK11 at the post-transcriptional mRNA level. Despite their high transfection efficiency, siRNA and viral based shRNA approaches face serious challenges. Naked siRNA is unstable in circulation due to serum RNase A-type nucleases and rapid renal clearance, resulting in degradation and a short half-life.4 High costs for producing large amounts of synthetic siRNA stocks for clinical use and limited quantities of nucleic acids that can be packaged for shRNA therapy also limit the applications of viral delivery systems.5 In addition, several gene therapy trials based on viral delivery systems have produced adverse effects, bringing their safety into question.6,7 It is, therefore, important to develop safe and effective CDK11 targeting systems. JOURNAL OF ORTHOPAEDIC RESEARCH MONTH 2014

1

2

FENG ET AL.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas9 protein is a genome editing tool, which allows for specific genome disruption and replacement in a flexible and simple system.8,9 The system uses a nuclease, Cas9, that complexes with single guide RNA (sgRNA) to cleave DNA and generate double-strand breaks in a sequence-specific manner upstream of the protospacer-adjacent-motif (PAM - the sequence NGG) in any genomic locus.10–16 Subsequent cellular DNA repair processes lead to desired insertions, deletions, or substitutions at target sites through homologous recombination (HR) or non-homologous end joining (NHEJ). Compared with RNAi technology, CRISPR possesses a number of advantages.12,15,16 First, CRISPR is an exogenous system that does not compete with endogenous processes, such as microRNA expression or function. Furthermore, CRISPR functions at the DNA level targeting transcripts, such as noncoding RNAs, microRNAs, antisense transcripts, nuclearlocalized RNAs, and polymerase III transcripts, which results in knockout or complete elimination of gene function. Finally, CRISPR provides a much larger targetable sequence space, including promoters and, in theory, exons may also be targeted. CRISPR-Cas9 provides a robust and highly efficient novel genome editing tool, which enables precise manipulation of specific genomic loci, and facilitates elucidation of target gene functions or diseases. This tool has previously been applied to induce manipulation of pluripotent stem (iPS) cells, genome editing, and gene therapy studies.17–20 CRISPR-Cas9 mediated gene knockout has also been utilized in human glioblastoma cell lines.21 A

genome-scale CRISPR-Cas9 knockout library has been generated to identify genes essential for cell viability in cancer cells.22 CRISPR-Cas9 has demonstrated that it is feasible for gene disruption and powerful in in situ genetic screens in the chemoresistant lymphomas model.23 In addition, dimeric RNA-guided CRISPR-Cas9 can recognize extended sequences and edit endogenous genes with high efficiency in human cancer cells.24 CRISPR-Cas9 is an easy and reliable genome editing tool that can rapidly extend to a wide array of biological systems and diseases. In this study, we apply a CRISPR-Cas9 system specifically inhibiting CDK11 at the DNA level in osteosarcoma cells, and further determine the effects of CDK11 knockout on osteosarcoma cell growth, proliferation, migration, and invasion.

MATERIALS AND METHODS Cell Lines and Cell Culture The human osteosarcoma cell line KHOS was kindly provided by Dr. Efstathios Gonos (Institute of Biological Research & Biotechnology, Athens, Greece). The human osteosarcoma cell line U-2OS was obtained from the American Type Culture Collection (Rockville, MD). Both cell lines were cultured in RPMI 1640 from Invitrogen (Carlsbad, CA) supplemented with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen, NY). Cells were incubated in a humidified atmosphere containing 5% CO2 and 95% air at 37˚C. CRISPR-Cas9 Plasmid Design and Purification The CRISPR-Cas9 and green fluorescent protein (GFP) fusion protein expression vector U6gRNA-Cas9–2A-GFP guide by CDK11 sgRNA (abbreviated as CDK11-Cas9-GFP)

Figure 1. (A) Schematic of U6 gRNA-CMV Cas9-GFP expression cassette in the singleplasmid system. GFP is co-expressed from the same mRNA as the Cas9 protein via a 2 A peptide linkage, which enable tracking of transfection efficiency. Guide RNA sequence is: TCCGAGACATTT GCTGGGGTGG. Exon of CDK11 selected for guide RNA design is located on the fourth coding exon. The human U6 promoter is used to drive gRNA expression, while CMV promoter drives expression of Cas9 and GFP proteins. (B) Position of the frameshift that CRISPR-Cas9 knockout is located at exon 4 within the CDK11B gene (NM_033486.1-CDK11B). (C) Schematic structure of CRISPR-Cas9 system functions on targeting CDK11 gene. CRISPR-Cas9 system utilizes a fusion between a crRNA and part of the tracrRNA sequence. This single singleguide RNA (sgRNA) complexes with Cas9 to mediate cleavage of target DNA sites that are complementary to the 50 - 19 nt of the gRNA and that lie next to a Protospacer Adjacent Motif (PAM) sequence. Target sequence (including PAM) is: TCCGAGACATTTGCTGGGG TGG. Complementary sequence is: CCACCCCAGCAAATGTCTCGGA.

JOURNAL OF ORTHOPAEDIC RESEARCH MONTH 2014

CDK11 AND OSTEOSARCOMA

was purchased from Sigma–Aldrich (St. Louis, MO) (Fig. 1A). GFP is co-expressed from the same mRNA as the Cas9 protein via a 2 A peptide linkage, which enables tracking of transfection efficiency. The exon of CDK11 selected for guide RNA design is located at the fourth coding exon (Fig. 1B); CDK11 guide RNA sequence is as follows: TCCGAGACATTTGCTGGGGTGG (Fig. 1C). The pEGFP-N3 plasmid was purchased from Clontech (Mountain View, CA). Plasmids were purified using QIAGEN Plasmid Mega Kits (Hilden, Germany). Plasmid purification protocols were followed according to the plasmid purification QIAGEN Plasmid Purification Handbook. To determine the yield of plasmid, DNA concentrations were determined by both UV spectrophotometry at 260 nm and quantitative analysis on an agarose gel. Optimization Electroporation Transfection Transfections were performed with NeonTM Transfection System (Grand Island, NY) following the manufacturer’s instructions and Optimization Protocol. In brief, osteosarcoma cells were cultured to 80–90% confluence, then harvested and washed in phosphate buffered saline (PBS) without Ca2þ and Mg2þ. Twenty four-well plates were prepared by filling the wells with the 0.5 ml of culture medium containing serum and supplements without antibiotics and pre-incubated at 37˚C in a humidified 5% CO2 incubator. Cell pellets were resuspended in the appropriate resuspension buffer (included with NeonTM Kits) at a final density of 5.0  106 cells/ml. Each electroporation sample used the 10 ml NeonTM Tip in 24-well format. One NeonTM Tube was set up with 4 ml electrolytic buffer into the NeonTM Pipette Station containing the cell-DNA (0.5 mg DNA/ well) mixture. The optimization protocols were loaded to begin electroporation using the 24 diverse parameters with different pulse voltage, pulse width, and pulse number. After electroporation, cells were seeded into the prepared plates. Fluorescence Microscope To observe the viability of CRISPR in osteosarcoma, KHOS, and U-2OS cells were transfected with CDK11-Cas9-GFP or pEGFP-N3. Then, 5  104 cells/well were plated in 24-well plates, and incubated for 96 h. Detection was performed under fluorescence. Osteosarcoma cells were then visualized on a Nikon Eclipse Ti-U fluorescence microscope (Nikon Instruments, Inc., NY) equipped with a SPOTRT digital camera from Diagnostic Instruments, Inc. (Sterling Heights, MI). MTT Assay Briefly, after electroporation with CDK11-Cas9-GFP or pEGFP-N3, KHOS and U-2OS cells were seeded in 96-well plates with 2  103 cells per well for MTT assay. Each 96well plate received complete growth medium without antibiotics per well in a volume of 100 ml in triplicate. Cell growth and proliferation was determined using the MTT assay. After incubation, 20 ml of MTT (5 mg/ml, Sigma, MO) was added, followed by incubation for another 4 h at 37˚C. The MTT formazan products were dissolved in acid-isopropanol. The absorbance was measured at a wavelength of 490 nm on a SPECTRAmax Microplate Spectrophotometer from Molecular Devices (Sunnyvale, CA). All procedures were repeated for five consecutive days. Experiments were performed in triplicate. All data were analyzed using GraphPad Prism 5 software from GraphPad Software, Inc. (San Diego, CA).

3

Western Blotting Expression of CDK11 protein was evaluated by Western Blot. Protein lysates from osteosarcoma cells were extracted using 1 Cell Lysis Buffer (Cell Signaling Technology, MA). The protein concentrations were determined by Protein Assay Reagents (Bio-Rad, CA) and a SPECTRAmax Microplate Spectrophotometer from Molecular Devices (Sunnyvale). The primary antibodies for CDK11 (1:1000 dilution), Integrin b 3 (1:1000 dilution), MT1-MMP (1:1000 dilution), VEGF (1:1000 dilution), and actin (1:2000 dilution) were purchased from Cell Signaling Technology, Abcam, and Sigma–Aldrich, respectively. Secondary antibodies IRDye1 800CW or IRDye1 680LT were purchased from LI-COR (Biosciences, NE). Western blot analyses were carried out as previously described.25 Membrane signals were scanned using the Odyssey infrared imaging system and analyzed using Odyssey 3.0 software (LI-COR Biosciences). Relative expression values were normalized assigning the value of the cells in control groups to 1.0. Wound Healing Assay Cell migration activity was detection by wound healing assay. In brief, after transfection with CDK11-Cas9-GFP or pEFGP-N2, 2  105 cells were seeded onto 12-well plates. On the second day after cells reached 80–90% confluence, the cells were scraped in three parallel lines with a 200 ml tip, then washed three times with serum-free medium and incubated in regular medium. The wounds were observed at 0, 8, and 24 h after wounding, and photographed via microscope (Nikon Instruments, Inc.). Three images were taken per well at each time point using a 10 objective, and the distance between the two edges of the scratch (wound width) was measured at 10 sites in each image. The cell migration distance was determined by measuring the wound width at each time point from the wound width at the 0 h time point and then dividing by two. Matrigel Invasion Assay Cell invasion activity was evaluated by Matrigel invasion assay with a BD BioCoatTM MatrigelTM Invasion Chamber (Becton-Dickinson, MA) according to the manufacturer’s instructions. In brief, 24 h after transfection with CDK11Cas9-GFP or pEFGP-N2, 5  104 cells were seeded into the upper chamber of each well in serum-free medium, and the bottom chambers were filled with medium containing 10% FBS without antibiotics. After a 22 h incubation period, the noninvading cells were removed by scrubbing from the upper surface of the membrane with two cotton swabs. After washing the cells with medium, regular medium with 1 mg/ ml Hoechst 33342 (Invitrogen) was used to stain nuclei of the invading cells for 5 min. Images were acquired by Nikon Eclipse Ti-U fluorescence microscope and phase contrast microscope equipped with a SPOT RT digital camera. The number of invading cells was counted in three images per membrane by microscopy using a 20 objective. Statistical Analysis GraphPad PRISM 5 software (GraphPad Software, Inc) was used to statistically analyze the data. The differences between groups were also evaluated using the two-sided Student’s t-test. Errors were SD of averaged results and p values