Targeted gene knockout in chickens mediated by TALENs Tae Sub Parka,b, Hong Jo Leea, Ki Hyun Kima, Jin-Soo Kimc, and Jae Yong Hana,1 a Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea; bInstitute of Green-Bio Science and Technology, Seoul National University, Pyeongchang-gun, Gangwon-do 232-916, Korea; and cDepartment of Chemistry, College of Natural Science, Seoul National University, Seoul 151-921, Korea
Edited by James E. Womack, Texas A&M University, College Station, TX, and approved July 30, 2014 (received for review June 7, 2014)
|
genetic modification programmable genome editing chimera poultry egg protein
|
|
S
| germ-line
ince knockout mice were generated using target locus disruption by homologous recombination (1–4), the knockout system has revolutionized the research field of functional genomics by allowing the analysis of specific gene functions in vivo (5). In avian species, however, germ-line-competent embryonic stem cells are lacking, and adapting somatic cell nuclear transfer and cloning are technically difficult; thus, targeted genome editing by homologous recombination is very difficult. Furthermore, birds have many evolutionary differences compared with mammals in terms of physiological characteristics and developmental processes (6). Therefore, conventional gene targeting techniques established in experimental animals are not easily applied to avian species. However, Schusser and colleagues (7) reported gene-targeted chickens through the use of homologous recombination. Novel approaches have been recently designed to efficiently produce animals that are genetically altered in specific genomic sequences; zinc-finger nuclease (ZFN) (8–10) and transcription activator-like effector nuclease (TALEN) (11–16) are representative next-generation platforms for customized genomic editing in transgenic animals, as well as in cultured cells in vitro. ZFNs and TALENs containing a DNA-binding domain and Fok I nuclease domain are currently crucial tools to dissect individual gene function in complicated biological systems with targeted genetic deletions and alterations. The targeted gene becomes inoperative by generating a double-strand DNA break and a frameshift-induced mutation during the repair process (11, 17). To date, these versatile engineered hybrid proteins have been applied to various animal species, including human embryonic stem cells (17). ZFN-mediated genomic modifications have been used to mutate specific genes in vertebrates such as mice, rats, and pigs (8, 9). TALENs were first adapted to human cells (11), and a heritable mutant mouse was efficiently generated after microinjection of specific locus-targeted TALENs into fertilized one-cell embryos (15). In one-cell-stage embryos of mammals, www.pnas.org/cgi/doi/10.1073/pnas.1410555111
the mRNA that encodes TALENs or ZFNs was injected to generate target gene-modified animals. However, programmable gene-edited poultry have not yet been reported. Unfortunately, the one-cell-stage injection method cannot be used to generate gene knockout chickens because the accessibility and manipulation of single-cell-stage embryos are very difficult and hatchability is too low. Results TALEN Validation for Chicken Genome Editing. To verify TALEN
activity in the chicken genome, effective TALEN expression constructs for three different genes [DsRed reporter, β1,4-galactosyltransferase 1 (B4GALT1), and β-actin] were designed and synthesized (Fig. S1). After each TALEN plasmid set was transfected into a regular or DsRed-expressing DF1 chicken cell line, we analyzed induced mutations in a targeted locus with a T7 endonuclease I (T7E1) assay and DNA sequencing (Fig. 1A and Fig. S2). The mutation ratios in DsRed-negative cells were 55.6% and 54.5% in DsRed TALEN 1 and DsRed TALEN 2, respectively (Fig. S2A). TALENs induced deletion/insertion mutants in the DsRed gene, which resulted in DsRed gene frameshifts (Fig. S2A). Next, to verify TALEN activity for genetic modification of chicken genes, TALENs targeted specifically to chicken B4GALT1 and β-actin genes were constructed. To select for TALEN-transfected DF1 cells after transfection, we introduced a CMV-GFP expression reporter plasmid along with the TALENs in which the DNA molecular weight ratio was 1:1:1 (CMV GFP:TALEN R:TALEN L). One day after transfection, Significance Targeted gene knockout by editing specific loci in genome has revolutionized the field of functional genomics. Transcription activator-like effector nucleases (TALENs) are representative next-generation platforms for customized genomic editing in transgenic animals, as well as cultured cells in vitro. In this study, in combination with chicken primordial germ cell line with germ-line transmission capacity, we generated the ovalbumin gene knockout chickens by TALEN-mediated gene targeting. Our results extended the application of state-of-the-art TALEN technology from experimental animals to farm animals. As TALEN-mediated knockout chickens are genetically modified but nontransgenic, without genomic integration of any exogenous transgenes, specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for agriculturally practical applications as well as for model animals. Author contributions: T.S.P., J.-S.K., and J.Y.H. designed research; T.S.P., H.J.L., and K.H.K. performed research; T.S.P., H.J.L., and K.H.K. analyzed data; and T.S.P., J.-S.K., and J.Y.H. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. 1
To whom correspondence should be addressed. Email: [email protected].
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1410555111/-/DCSupplemental.
PNAS Early Edition | 1 of 6
AGRICULTURAL SCIENCES
Genetically modified animals are used for industrial applications as well as scientific research, and studies on these animals contribute to a better understanding of biological mechanisms. Gene targeting techniques have been developed to edit specific gene loci in the genome, but the conventional strategy of homologous recombination with a gene-targeted vector has low efficiency and many technical complications. Here, we generated specific gene knockout chickens through the use of transcription activator-like effector nuclease (TALEN)-mediated gene targeting. In this study, we accomplished targeted knockout of the ovalbumin (OV) gene in the chicken primordial germ cells, and OV gene mutant offspring were generated through test-cross analysis. TALENs successfully induced nucleotide deletion mutations of ORF shifts, resulting in loss of chicken OV gene function. Our results demonstrate that the TALEN technique used in the chicken primordial germ cell line is a powerful strategy to create specific genome-edited chickens safely for practical applications.
A
&U4GF 6#.'0
6'
&U4GF 6#.'0
TGIWNCT&(
)CN66#.'0
6'
ߨ ߨ
ߨ ߨ OWVCPV
B
)CN66#.'0
OWVCPV
TGIWNCT&(
ƅCEVKP 6#.'0
6'
ߨ ߨ
ߨ ߨ
ƅCEVKP6#.'0
ߨ ߨ
OWVCPV
TGIWNCT&(
ߨ ߨ
186#.'0. 0VGTO
(QM +
4GRGCVFQOCKP
---TGCTGTTTGCTCTAGACAACTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCA-----ACGACAAACGAGATCTGTTGAGTCTCAAGTGGTACCCGAGGTAGCCACGTCGTTCGT--(QM +
4GRGCVFQOCKP
0VGTO
186#.'04
186#.'0
6'
186#.'0
TGIWNCT&(
TGIWNCT
6'
186#.'0
ߨ ߨ &(OWVCPV
C
ߨ ߨ 2)%OWVCPV
186#.'0 OWVCPVKP2)%U
TGCTGTTTGCTCTAGACAACTCAGAGTTCACC TGCTGTTTGCTCTAGACAACTCAGAGTT---TGCTGTTTGCTCTAGACAACTCA-------CC TGCTGTTTGCTCTAGACAACTCAGAGTTC-------------------------------ACC
M ATG --G ATG --ATG
G GGC GGC GGC --GGC
S TCC TCC TCC --TCC
I ATC ATC ATC -TC ATC
G GGT GGT GGT GGT GGT
A GCA GCA GCA GCA GCA
A GCA GCA GCA GCA GCA
S AGC AGC AGC AGC AGC
A A A A A
amino acids wild (8x) 6nt del (1x) 7nt del (1x) 13nt del (1x) 29nt del (1x)
Fig. 1. Genomic mutation analysis after TALEN introduction into chickens. (A) T7E1 assay of TALEN target sites for DsRed, B4GALT1, and β-actin in the chicken DF1 cell line. (B) Schematic TALEN design for the chicken OV gene. DNA-binding (left in red or right in blue) and spacer sequences (in black) are presented for OV TALEN 2. T7E1 assay of chicken DF1 cells mutated with OV TALEN 1 or 2 (Left), and chicken PGCs (SNUhp26) mutated with OV TALEN 2 (Right). (C) Mutated target DNA sequences of chicken PGCs with OV TALEN 2. A dash in the DNA sequences denotes the deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene.
GFP-positive cells were sorted by FACS, as it was expected that GFP-expressing cells were also delivered with both right and left TALEN constructs. After 10–14 d of in vitro culture, we examined mutations in chicken B4GALT1 and β-actin genes with a T7E1 assay (Fig. S2 B and C). TALEN-induced mutated frameshift efficiency was 36.4–60.0% in B4GALT1 and 8.3–9.1% in β-actin (Fig. S2 B and C). Various mutant genotypes and lengths were induced by TALENs in each gene: 1–33 nucleotide deletions and one additional nucleotide insertion (Fig. S2 A–C). Thus, the combination of cotransfection and FACS sorting with GFP expression was an effective and practical approach to selecting chicken cells with TALEN-mediated mutants of endogenous genes in the chicken genome. Next, to investigate whether specific gene-targeted chickens could be generated by a TALEN-mediated approach through germ-line transmission, we synthesized TALEN plasmid constructs specific to the chicken ovalbumin (OV) gene, which encodes a major protein in hen egg white. Two OV TALENs designed to disrupt the translational initiation codon (i.e., ATG) in chicken OV gene exon 2 (Fig. 1B and Fig. S3A) were transfected into chicken DF1 cells to measure the chicken genomic modification efficacy. Through T7E1 assay and DNA sequencing analysis, we observed that OV TALEN 2 actively mutated the ovalbumin target locus (Fig. 1B and Fig. S3B). However, OV TALEN 1 constructs did not induce mutation at the target site (Fig. 1B). The frequency of mutations was 36.7% with OV TALEN 2 in the DF1 cell line (Fig. S3B). Thus, the effective OV TALEN 2 set was applied to chicken germ cells for the production of mutant chickens. 2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
Mutation Induction of OV Gene in Chicken PGCs by TALENs. Genetic engineering techniques, such as stem cell-based and somatic cell nuclear transfer-mediated modifications, are difficult to apply in avian species because of technical difficulties associated with manipulating avian oocytes and accessing the oocyte nucleus. To overcome the technical obstacles of genomic modification in chickens, we recently established chicken primordial germ cell (PGC) lines with germ-line transmission capacity (18). We applied the same combination of techniques to the PGC line, using fluorescence-positive separation 1 d after cotransfection with the GFP vector and OV TALEN 2 set. PGC transient transfection efficiency was relatively low compared with DF1 cells; in general, GFP-expressing PGCs were sorted at less than 5% compared with 30–40% in DF1 cells 1 d after cotransfection with GFP and TALEN plasmids (Figs. S2 B and C and S4). When the OV TALEN 2 set was introduced into the SNUhp26 male PGC line (Fig. S4), we found that OV TALEN 2 effectively induced nucleotide deletions at the targeted locus (Fig. 1 B and C). TALENmediated mutations in chicken PGCs were 6–29 nucleotide deletions that induced frameshifts as well as in-frame mutations (Fig. 1C). In some mutations, nucleotides were deleted before the ATG start codon without any ORF shift, whereas mutations in the ATG site caused complete substitution in amino acid sequences, likely resulting in abolishment of the ovalbumin protein (Fig. 1C). Notably, DF1 cells had more various mutant genotypes compared with chicken PGCs (Fig. 1C and Fig. S3B). Furthermore, additional nucleotide insertion mutants were found in DF1 cells, although no insertion mutant was detected in chicken PGCs. However, no significant difference in mutation efficiency was observed between DF1 cells and PGCs (36.7% versus 33.3% with OV TALEN 2). Park et al.
A
B
&QPQT2)%FGTKXGFEJKEMU ,, 6'
ߨ ߨ
ߨ ߨ
ߨ ߨ
*[DTKFEJKEM ,L
M G S I G A A S TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A -------------------------GTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A
amino acids wild 29nt del
ID#704 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGT----- --- --- --- --- --- -CA GCA AGC A
wild 21nt del
frameshift
ID#736 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#781 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#784 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#787 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#803 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACA-------------- -TG GGC TCC ATC GGT GCA GCA AGC A
wild 15nt del
frameshift
D 186#.'0EQPUVTWEVRNCUOKF RI
RI
RI
HI HI
18OWVCPV RTQIGPKGU
YKNF
Fig. 2. (A) A germ-line chimeric male KOC founder (#4312) artificially inseminated a female WL. (B) The hatched chicks produced from the founder through test-cross and T7E1 assay of the offspring. Feather color of the donor WL (I/I)-derived chick was white, whereas the hybrid (I/i) chick produced from the recipient founder KOC had black spots. OV mutant chicks were identified by T7E1 assay. (C) Targeted DNA sequences in the OV gene were analyzed in the OV mutant donor PGC-derived offspring. A dash in the DNA sequences denotes deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene. (D) Detection of the OV TALEN 2 construct in mutant offspring by genomic PCR. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilutions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a negative control.
Production of Ovalbumin Mutant Chicks Through Germ-Line Chimeras.
Subsequently, OV knockout White Leghorn (WL) chicken PGCs were transplanted into recipient Korean Oge chicken (KOC) embryos to generate mutant offspring through germ-line transmission. After sexual maturation of the hatched founders (Fig. 2A and Table S1), sperm from founder roosters was analyzed, using WL or KOC strain-specific primers to detect PGC-differentiated donor sperm from the founder roosters before test-cross. The founders produced WL sperm as well as KOC sperm (Fig. S5A). Subsequently, the mutant sperm with TALEN-induced deletions were also detected by the T7E1 assay (Fig. S5B). DNA sequencing analysis with founder #4312 rooster sperm was conducted, and the mutant sperm rate was 18.8% (3/16), which demonstrated the
existence of two different genotypes (Fig. S5C). Through test-cross analysis, OV gene-targeted mutant offspring were successfully produced from mutated donor chicken PGCs, yielding an 8.0% mutant rate on average in the chicken progenies (Fig. 2B and Table 1). All mutant chickens had a monoallelic mutation because of mating between the germ-line chimeric rooster and wild-type hens (Fig. 2C). Similar to the founder sperm, four mutated alleles were found in the targeted ovalbumin of knockout chickens (Fig. 2C). This result indicated that chicken PGCs genetically edited with TALENs were germ-line-transmittable to the next generation through proliferation and differentiation processes into fertile gametes. The hatched monoallelic knockout chicks were normal and healthy without any phenotypic deformity (Fig. 2B).
Table 1. Efficiency of germ-line transmission derived from the founders and frequency of OV gene mutants in the offspring Founder ID 4309 4312 Total
Number of hatched chicks
Number of donor PGC-derived chicks, %*
Number of OV mutant chicks, %†
87 126 213
20 (22.3) 67 (53.2) 87 (40.8)
0 (0.0) 7 (10.4) 7 (8.0)
*Chicks derived from transplanted donor-PGCs in the recipient chickens. † Mutation was determined by T7E1 assay and targeted DNA sequencing.
Park et al.
PNAS Early Edition | 3 of 6
AGRICULTURAL SCIENCES
C ID#648
To assay TALEN-induced toxicity resulting from nonspecific double-strand DNA breaks, potential off-targets were analyzed in OV TALEN 2-transfected PGCs and the knockout chicks by sequencing analysis. We detected no off-target mutations induced by OV TALEN 2 in the genome of the hatched chicks or in chicken PGCs (Table S2 and Fig. S6A). In addition, in the knockout chicks, we screened OV TALEN construct plasmids that were transferred into PGCs to examine whether they contained foreign transgenes in their genomic content. The designed primer sets were highly sensitive and could detect 100-fg transgene plasmid DNAs, which amounted to less than 0.3 copies in the chicken genome (Fig. 2D). However, no transgene sequence was detected in the ovalbumin-knockout chicks (Fig. 2D). No GFP expression was observed in either of the mutant PGCs or donor-derived chicks, indicating that the transgene was not randomly integrated into the chicken genome during transfection or sorting procedures. In our previous report, the CMV promoter-controlled GFP gene was strongly expressed in transgenic chicks as well as in PGCs that contained a single transgene copy in their genome (18). Discussion Chickens have a diploid number of 78 chromosomes (2n = 78), which are classified into five pairs of macrochromosomes, five pairs of intermediate chromosomes, and 28 pairs of microchromosomes and sex chromosomes (19). Chicken microchromosomes represent approximately one-third of the total genome size, and the majority of genes were assumed to be located on microchromosomes (20). However, because of the small architectural size of microchromosomes, genetic modification of specific microchromosome target loci could be difficult. In this study, we validated TALEN accessibility and activity on the chicken B4GALT1 gene, which is located on the Z chromosome, and the β-actin gene on microchromosome 14. Our results indicated that the TALEN system can be efficiently applied to modify specific loci on chicken genome microchromosomes, albeit with various efficiency depending on the target genes and sites. The next steps should involve generating biallelic mutant hens through mating and breeding selection, as well as validating ovalbumin protein deposition in mutant chicken egg white. Hen egg white and egg white proteins occupy about 60% and 11%, respectively, of the whole egg weight (21). Ovalbumin is a major protein and constitutes ∼54% of total egg white proteins (21). In an ovalbumin knockout hen, the percentages of each egg white component could be changed, and it is necessary to examine whether the amount of small-quantity, high-value biofunctional proteins such as cystatin could be increased or not. Because of the massive deposition of proteins, hen egg is considered to be the best animal model for bioactive material production (22, 23). However, the excessive amount of ovalbumin hinders the purification processes of a small amount of biofunctional proteins. Thus, egg white component modification provides a powerful tool for wide-ranging agricultural and industrial applications. Using egg white composition-controlled eggs, a small quantity of therapeutic proteins in transgenic chicken bioreactors could be efficiently separated and isolated. In addition, we need to further examine the economic traits, such as egg production, egg size, and chicken embryo development, in the ovalbumin knockout chickens with the different mutant genotypes. Other egg white proteins, such as ovomucoid and ovotransferrin, are well-known major allergy-inducing components. Such allergy-inducing components can be eliminated by gene knockout with TALENs, and these allergen-reduced eggs could be used for vaccine production or even food consumption. A new genome editing tool platform was recently reported: Clustered Regularly Interspaced Short Palindromic RepeatsCRISPR-associated (CRISPR-Cas) (24–26). Compared with TALENs, CRISPR-Cas is a fast and cost-effective system for 4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
modifying the genomes of various organisms because of its simple, practical use and robust cutting activity (27–30). CRISPR is an immune system that was discovered in bacteria (31). CRISPR RNA specifically recognizes complementary target sequences of foreign DNA, and CRISPR-Cas nuclease generates a double-strand break that induces nucleotide sequence mutations. Therefore, the feasibility and applicability of the CRISPRCas platform need to be examined for editing the avian genome. The chicken as a classic model has unexcelled and valuable advantages for gaining insights into biological processes and their significance. At this time, chicken PGCs can be successfully maintained in vitro without the loss of germ cell integrity (32, 33), and generating transgenic chickens is feasible using transposon elements in cultured chicken PGCs (18, 34). This study demonstrated the creation of specific knockout chickens using TALENs. Our results extended the application of state-of-theart TALEN technology from experimental animals to farm animals. Tailored genome editing in chicken will open a new era to advance knowledge not only for comprehensive understanding of avian biology but also for agricultural applications. To generate economically important genetic resources, the conventional selective breeding system based on individual or population crossbreeds is an expensive, time-consuming, and laborious process. Because TALEN-mediated knockout chickens are genetically modified but nontransgenic, because of the lack of genomic integration of exogenous transgenes (Fig. 2D), specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for agriculturally practical applications as well as for model animals and embryo development studies. To our knowledge, this is the first description of genetic knockout chickens through germ-line transmission of TALEN-edited PGCs. Materials and Methods Experimental Animal Care. The care and experimental use of chickens were approved by the Institute of Laboratory Animal Resources, Seoul National University (SNU-070823-5). All experimental birds, including WL and KOCs, were maintained according to a standard management program at the University Animal Farm, Seoul National University, Korea. The procedures for animal management, reproduction, and embryo manipulation adhered to the standard operating protocols of our laboratory. TALEN Construction. To construct TALEN plasmids for DsRed, B4GALT1, and β-actin genes, TALEN expression plasmids were assembled via the one-step Golden Gate cloning system, as described previously (16). Chicken OV TALENs were assembled using methods described in Sanjana and colleagues (35). Briefly, three 18-mer tandem repeat hexamers were assembled individually by Golden Gate cloning, using the amplified monomers, and then treated with an exonuclease to remove all linear DNA regions, leaving only the properly assembled tandem hexamers. Subsequently, each tandem hexamer was amplified, and after purification, the hexamers corresponding to 1–6, 7–12, and 13–18 were ligated into the TALEN cloning backbone. Finally, the TALEN constructs were verified by DNA sequencing. DF1 Culture and Transfection for Fluorescence-Activated Cell Sorting. The chicken DF1 cell line was maintained and subpassaged in DMEM (Invitrogen, Carlsbad, CA), supplemented with 10% FBS (Invitrogen) and 1× antibiotic– antimycotic (Invitrogen). DF1 cells were cultured in an incubator at 37 °C in an atmosphere of 5% CO2 and 60–70% relative humidity. To generate the DsRed-expressing DF1 subline, plasmid DNA with the DsRed gene expressed by CMV immediate-early enhancer/promoter and neomycin-resistance gene with Simian vacuolating virus 40 promoter was transfected into chicken DF1 cells using Lipofectamine reagent (Invitrogen), according to the manufacturer’s protocol. One day after transfection, 300 μg/mL G418 was added to the culture media, and DsRed-expressing cells were completely selected after 2 wk. For DsRed gene knockout, 10 μL Lipofectamine reagent and 2.5 μg of each DsRed TALEN plasmid set were incubated in 250 μL OPTI-MEM (Invitrogen) at room temperature. After 5 min incubation, Lipofectamine and DsRed TALENs were combined and incubated for an additional 20 min. The complex mixture was gently pipetted and dropped into a well of a 6-well plate at 70–80% DF1 cell confluency. For chicken B4GALT1, β-actin, and OV
Park et al.
PGC Culture and Transfection for FACS Sorting. In a previous report (18), we established a male chicken PGC line (SNUhp26) from WL embryonic gonads at day 6 (stage 28). The SNUhp26 PGC line was maintained and subpassaged with knockout DMEM (Invitrogen) supplemented with 20% FBS (Invitrogen), 2% chicken serum (Sigma-Aldrich, St. Louis, MO), 1× nucleosides (Millipore, Temecula, CA), 2 mM L-glutamine, 1× nonessential amino acids, β-mercaptoethanol, 10 mM sodium pyruvate, 1× antibiotic–antimycotic (Invitrogen), and human basic fibroblast growth factor (10 ng/mL; Koma Biotech, Seoul, Korea). Chicken PGCs were cultured in an incubator at 37 °C with an atmosphere of 5% CO2 and 60–70% relative humidity. The cultured PGCs were subcultured onto mitomycin-inactivated mouse embryonic fibroblasts (MEFs) in 5–6-d intervals by gentle pipetting without any enzyme treatment. Similar to DF1 cells, the CMV GFP expression plasmid vector and each OV TALEN were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = CMV GFP: TALEN R:TALEN L). One day after lipofection, GFP-expressing PGCs were sorted using a FACSAria III cell sorter (Becton, Dickinson and Company). After harvesting, PGCs were resuspended in PBS containing 1% BSA and strained through a cell strainer for FACS separation (40 μm; BD Falcon; Becton, Dickinson and Company). T7E1 Assay and DNA Sequencing Analysis. Genomic DNA was extracted from DF1 cells or chicken PGCs after transfection of each TALEN set and FACS sorting. For the T7E1 assay (36), the genomic region encompassing the TALEN target site was amplified with a specific primer set for DsRed, chicken B4GALT1, β-actin, or OV gene (Table S3). We found the single nucleotide polymorphism of the first PCR amplicon of the OV gene in PGC line, and the nested products after second PCR were used for T7E1 assay (Table S3). The amplicons were reannealed to form a heteroduplex DNA structure after denaturation. Subsequently, the heteroduplex amplicons were treated with 5 units T7E1 (New England Biolabs, Ipswich, MA) for 15 min at 37 °C and then analyzed by agarose gel electrophoresis. T7E1 assay for founder sperm and offspring was also conducted using the same protocol. To confirm target locus mutation, PCR amplicons were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced with an ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA). Off-Target Prediction and Analysis. Potential chicken OV TALEN 2 off-targets were predicted using the web-based software program TAL Effector Nucleotide Targeter 2.0 (37) in the chicken genome. The chicken genome sequence was submitted by providing the latest GenBank Assembly ID (GCA_000002315.2). Two OV TALEN 2 repeat-variable di-residue sequences were submitted in the form required by the tool, and the spacer length
1. Thompson S, Clarke AR, Pow AM, Hooper ML, Melton DW (1989) Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 56(2):313–321. 2. Koller BH, et al. (1989) Germ-line transmission of a planned alteration made in a hypoxanthine phosphoribosyltransferase gene by homologous recombination in embryonic stem cells. Proc Natl Acad Sci USA 86(22):8927–8931. 3. Zijlstra M, Li E, Sajjadi F, Subramani S, Jaenisch R (1989) Germ-line transmission of a disrupted beta 2-microglobulin gene produced by homologous recombination in embryonic stem cells. Nature 342(6248):435–438. 4. Schwartzberg PL, Goff SP, Robertson EJ (1989) Germ-line transmission of a c-abl mutation produced by targeted gene disruption in ES cells. Science 246(4931):799–803. 5. Capecchi MR (2005) Gene targeting in mice: Functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet 6(6):507–512. 6. Brown WR, Hubbard SJ, Tickle C, Wilson SA (2003) The chicken as a model for largescale analysis of vertebrate gene function. Nat Rev Genet 4(2):87–98. 7. Schusser B, et al. (2013) Immunoglobulin knockout chickens via efficient homologous recombination in primordial germ cells. Proc Natl Acad Sci USA 110(50):20170–20175. 8. Cui X, et al. (2011) Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nat Biotechnol 29(1):64–67. 9. Hauschild J, et al. (2011) Efficient generation of a biallelic knockout in pigs using zincfinger nucleases. Proc Natl Acad Sci USA 108(29):12013–12017. 10. Kim S, Lee MJ, Kim H, Kang M, Kim JS (2011) Preassembled zinc-finger arrays for rapid construction of ZFNs. Nat Methods 8(1):7.
Park et al.
value between the two TAL effectors was set from 10 to 30 bp. The remaining setting values: “Score Cutoff,” “Upstream Base, ” and “Dimer Types to Find” were set to “3.0,” “T only,” and “Both,” respectively, as recommended by the tool. For analysis, three target sites that had the best scores (i.e., the sum of two TAL scores) were chosen. The genomic sequences of three sites were amplified by PCR, using primer sets for off-targets on chromosome 9 (forward: 5′-AGG GAA GGG ACA AAG AGC CT-3′ and reverse: 5′-GGT GGC TGT GGT ATG GTT CT-3′), chromosome 3 (forward: 5′-CAG CCA AAG AGA CCC AGA GG-3′ and reverse: 5′-TCC AGG GAG TTC TGA GAG GG-3′), and chromosome 4 (forward: 5′-GTT TTG GTT CCA GCA GTG GC-3′ and reverse: 5′-CTA CCT GAG CAA CAG GGC TC-3′), cloned into the pGEM-T easy vector (Promega) and sequenced. Microinjection of Chicken Ovalbumin Mutant PGCs into Recipients. To inject OV mutant PGCs into recipient embryos, a small window was made on the pointed end of the recipient KOC egg, and a 2-μL aliquot containing more than 3,000 PGCs was microinjected with a micropipette into the dorsal aorta of the recipient embryo. The egg window of the recipient embryo was sealed with paraffin film, and the egg was incubated with the pointed end down until hatching. We determined the sex of hatched chicks using W chromosome-specific primers (forward: 5′-CTA TGC CTA CCA CAT TCC TAT TTG C-3′ and reverse: 5′-AGC TGG ACT TCA GAC CAT CTT CT-3′), and only male chicks were used for test-cross analysis after sexual maturation. PCR was performed with an initial incubation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 30 s. The reaction was terminated by a final incubation at 72 °C for 7 min. Test-Cross Analysis and Detection of Mutant Chickens. WLs with a dominant pigmentation inhibitor gene (I/I) and KOCs with a recessive pigmentation inhibitor gene (i/i) were used for the donor PGCs and the recipient embryos, respectively. Through test-cross analysis by mating with WL hens (I/I), the germ-line chimeras were identified by offspring phenotype. Endogenous germ cells in the KOC recipient males (i/i) produced hybrid chicks (I/i) with black spots, whereas WL donor-derived germ cells (I/I) produced white chicks with I/I. Offspring derived from the transplanted mutant PGCs were screened using T7E1 assay, and the mutant genotype of individual chicks was subsequently identified by DNA sequencing (Fig. S6B). Transgene Detection in Mutant Offspring. To investigate whether any transgene was integrated into the mutant chicken genome, genomic PCR was conducted. OV TALEN 2 expression vector-specific primer sets were used (forward: 5′-GTG GGG AGC CCG ATT GAT TA-3′ and reverse: 5′-TTC AAC CGT GTG AGC TGG GC-3′). PCR was performed with an initial incubation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s and 68 °C and 72 °C for 30 s. The reaction was terminated by a final incubation at 72 °C for 7 min. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilutions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a negative control. ACKNOWLEDGMENTS. This work was supported by the Next-Generation BioGreen 21 Program Grant PJ008142, Rural Development Administration, Republic of Korea.
11. Miller JC, et al. (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29(2):143–148. 12. Sander JD, et al. (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29(8):697–698. 13. Huang P, et al. (2011) Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol 29(8):699–700. 14. Zu Y, et al. (2013) TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat Methods 10(4):329–331. 15. Sung YH, et al. (2013) Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol 31(1):23–24. 16. Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31(3):251–258. 17. Porteus MH, Carroll D (2005) Gene targeting using zinc finger nucleases. Nat Biotechnol 23(8):967–973. 18. Park TS, Han JY (2012) piggyBac transposition into primordial germ cells is an efficient tool for transgenesis in chickens. Proc Natl Acad Sci USA 109(24):9337–9341. 19. Wong GK, et al.; International Chicken Polymorphism Map Consortium (2004) A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms. Nature 432(7018):717–722. 20. Burt DW (2002) Origin and evolution of avian microchromosomes. Cytogenet Genome Res 96(1-4):97–112. 21. Yamamoto T, Juneja LR, Hatta H, Kim M (1997) Hen Eggs: Their Basic and Applied Science (CRC press, Boca Raton), pp 13–24.
PNAS Early Edition | 5 of 6
AGRICULTURAL SCIENCES
gene knockout, CMV GFP expression plasmid vector and each TALEN set of target genes were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = CMV GFP:TALEN R:TALEN L). After incubation at 37 °C in 5% CO2 for 6 h, cells were gently washed with PBS three times, and new culture medium was added. One day after lipofection, GFP-expressing cells were sorted using a FACSAria III cell sorter (Becton, Dickinson and Company, Franklin Lakes, NJ). After total cells were harvested using 0.05% trypsin-EDTA (Invitrogen), cells were resuspended in PBS containing 1% BSA and strained through a cell strainer for FACS separation (40 μm; BD Falcon; Becton, Dickinson and Company).
22. Zhu L, et al. (2005) Production of human monoclonal antibody in eggs of chimeric chickens. Nat Biotechnol 23(9):1159–1169. 23. Lillico SG, et al. (2007) Oviduct-specific expression of two therapeutic proteins in transgenic hens. Proc Natl Acad Sci USA 104(6):1771–1776. 24. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823. 25. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339(6121): 823–826. 26. Cho SW, Kim S, Kim JM, Kim JS (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31(3):230–232. 27. Hwang WY, et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31(3):227–229. 28. Wang H, et al. (2013) One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153(4):910–918. 29. Cho SW, Lee J, Carroll D, Kim JS, Lee J (2013) Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195(3):1177–1180. 30. Sung YH, et al. (2014) Highly efficient gene knockout in mice and zebrafish with RNAguided endonucleases. Genome Res 24(1):125–131.
6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
31. Barrangou R, et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315(5819):1709–1712. 32. Choi JW, et al. (2010) Basic fibroblast growth factor activates MEK/ERK cell signaling pathway and stimulates the proliferation of chicken primordial germ cells. PLoS ONE 5(9):e12968. 33. Macdonald J, Glover JD, Taylor L, Sang HM, McGrew MJ (2010) Characterisation and germline transmission of cultured avian primordial germ cells. PLoS ONE 5(11): e15518. 34. Macdonald J, et al. (2012) Efficient genetic modification and germ-line transmission of primordial germ cells using piggyBac and Tol2 transposons. Proc Natl Acad Sci USA 109(23):E1466–E1472. 35. Sanjana NE, et al. (2012) A transcription activator-like effector toolbox for genome engineering. Nat Protoc 7(1):171–192. 36. Kim HJ, Lee HJ, Kim H, Cho SW, Kim JS (2009) Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res 19(7): 1279–1288. 37. Doyle EL, et al. (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: Tools for TAL effector design and target prediction. Nucleic Acids Res 40(Web Server issue): W117-22.
Park et al.
Edited by James E. Womack, Texas A&M University, College Station, TX, and approved July 30, 2014 (received for review June 7, 2014)
|
genetic modification programmable genome editing chimera poultry egg protein
|
|
S
| germ-line
ince knockout mice were generated using target locus disruption by homologous recombination (1–4), the knockout system has revolutionized the research field of functional genomics by allowing the analysis of specific gene functions in vivo (5). In avian species, however, germ-line-competent embryonic stem cells are lacking, and adapting somatic cell nuclear transfer and cloning are technically difficult; thus, targeted genome editing by homologous recombination is very difficult. Furthermore, birds have many evolutionary differences compared with mammals in terms of physiological characteristics and developmental processes (6). Therefore, conventional gene targeting techniques established in experimental animals are not easily applied to avian species. However, Schusser and colleagues (7) reported gene-targeted chickens through the use of homologous recombination. Novel approaches have been recently designed to efficiently produce animals that are genetically altered in specific genomic sequences; zinc-finger nuclease (ZFN) (8–10) and transcription activator-like effector nuclease (TALEN) (11–16) are representative next-generation platforms for customized genomic editing in transgenic animals, as well as in cultured cells in vitro. ZFNs and TALENs containing a DNA-binding domain and Fok I nuclease domain are currently crucial tools to dissect individual gene function in complicated biological systems with targeted genetic deletions and alterations. The targeted gene becomes inoperative by generating a double-strand DNA break and a frameshift-induced mutation during the repair process (11, 17). To date, these versatile engineered hybrid proteins have been applied to various animal species, including human embryonic stem cells (17). ZFN-mediated genomic modifications have been used to mutate specific genes in vertebrates such as mice, rats, and pigs (8, 9). TALENs were first adapted to human cells (11), and a heritable mutant mouse was efficiently generated after microinjection of specific locus-targeted TALENs into fertilized one-cell embryos (15). In one-cell-stage embryos of mammals, www.pnas.org/cgi/doi/10.1073/pnas.1410555111
the mRNA that encodes TALENs or ZFNs was injected to generate target gene-modified animals. However, programmable gene-edited poultry have not yet been reported. Unfortunately, the one-cell-stage injection method cannot be used to generate gene knockout chickens because the accessibility and manipulation of single-cell-stage embryos are very difficult and hatchability is too low. Results TALEN Validation for Chicken Genome Editing. To verify TALEN
activity in the chicken genome, effective TALEN expression constructs for three different genes [DsRed reporter, β1,4-galactosyltransferase 1 (B4GALT1), and β-actin] were designed and synthesized (Fig. S1). After each TALEN plasmid set was transfected into a regular or DsRed-expressing DF1 chicken cell line, we analyzed induced mutations in a targeted locus with a T7 endonuclease I (T7E1) assay and DNA sequencing (Fig. 1A and Fig. S2). The mutation ratios in DsRed-negative cells were 55.6% and 54.5% in DsRed TALEN 1 and DsRed TALEN 2, respectively (Fig. S2A). TALENs induced deletion/insertion mutants in the DsRed gene, which resulted in DsRed gene frameshifts (Fig. S2A). Next, to verify TALEN activity for genetic modification of chicken genes, TALENs targeted specifically to chicken B4GALT1 and β-actin genes were constructed. To select for TALEN-transfected DF1 cells after transfection, we introduced a CMV-GFP expression reporter plasmid along with the TALENs in which the DNA molecular weight ratio was 1:1:1 (CMV GFP:TALEN R:TALEN L). One day after transfection, Significance Targeted gene knockout by editing specific loci in genome has revolutionized the field of functional genomics. Transcription activator-like effector nucleases (TALENs) are representative next-generation platforms for customized genomic editing in transgenic animals, as well as cultured cells in vitro. In this study, in combination with chicken primordial germ cell line with germ-line transmission capacity, we generated the ovalbumin gene knockout chickens by TALEN-mediated gene targeting. Our results extended the application of state-of-the-art TALEN technology from experimental animals to farm animals. As TALEN-mediated knockout chickens are genetically modified but nontransgenic, without genomic integration of any exogenous transgenes, specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for agriculturally practical applications as well as for model animals. Author contributions: T.S.P., J.-S.K., and J.Y.H. designed research; T.S.P., H.J.L., and K.H.K. performed research; T.S.P., H.J.L., and K.H.K. analyzed data; and T.S.P., J.-S.K., and J.Y.H. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. 1
To whom correspondence should be addressed. Email: [email protected].
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1410555111/-/DCSupplemental.
PNAS Early Edition | 1 of 6
AGRICULTURAL SCIENCES
Genetically modified animals are used for industrial applications as well as scientific research, and studies on these animals contribute to a better understanding of biological mechanisms. Gene targeting techniques have been developed to edit specific gene loci in the genome, but the conventional strategy of homologous recombination with a gene-targeted vector has low efficiency and many technical complications. Here, we generated specific gene knockout chickens through the use of transcription activator-like effector nuclease (TALEN)-mediated gene targeting. In this study, we accomplished targeted knockout of the ovalbumin (OV) gene in the chicken primordial germ cells, and OV gene mutant offspring were generated through test-cross analysis. TALENs successfully induced nucleotide deletion mutations of ORF shifts, resulting in loss of chicken OV gene function. Our results demonstrate that the TALEN technique used in the chicken primordial germ cell line is a powerful strategy to create specific genome-edited chickens safely for practical applications.
A
&U4GF 6#.'0
6'
&U4GF 6#.'0
TGIWNCT&(
)CN66#.'0
6'
ߨ ߨ
ߨ ߨ OWVCPV
B
)CN66#.'0
OWVCPV
TGIWNCT&(
ƅCEVKP 6#.'0
6'
ߨ ߨ
ߨ ߨ
ƅCEVKP6#.'0
ߨ ߨ
OWVCPV
TGIWNCT&(
ߨ ߨ
186#.'0. 0VGTO
(QM +
4GRGCVFQOCKP
---TGCTGTTTGCTCTAGACAACTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCA-----ACGACAAACGAGATCTGTTGAGTCTCAAGTGGTACCCGAGGTAGCCACGTCGTTCGT--(QM +
4GRGCVFQOCKP
0VGTO
186#.'04
186#.'0
6'
186#.'0
TGIWNCT&(
TGIWNCT
6'
186#.'0
ߨ ߨ &(OWVCPV
C
ߨ ߨ 2)%OWVCPV
186#.'0 OWVCPVKP2)%U
TGCTGTTTGCTCTAGACAACTCAGAGTTCACC TGCTGTTTGCTCTAGACAACTCAGAGTT---TGCTGTTTGCTCTAGACAACTCA-------CC TGCTGTTTGCTCTAGACAACTCAGAGTTC-------------------------------ACC
M ATG --G ATG --ATG
G GGC GGC GGC --GGC
S TCC TCC TCC --TCC
I ATC ATC ATC -TC ATC
G GGT GGT GGT GGT GGT
A GCA GCA GCA GCA GCA
A GCA GCA GCA GCA GCA
S AGC AGC AGC AGC AGC
A A A A A
amino acids wild (8x) 6nt del (1x) 7nt del (1x) 13nt del (1x) 29nt del (1x)
Fig. 1. Genomic mutation analysis after TALEN introduction into chickens. (A) T7E1 assay of TALEN target sites for DsRed, B4GALT1, and β-actin in the chicken DF1 cell line. (B) Schematic TALEN design for the chicken OV gene. DNA-binding (left in red or right in blue) and spacer sequences (in black) are presented for OV TALEN 2. T7E1 assay of chicken DF1 cells mutated with OV TALEN 1 or 2 (Left), and chicken PGCs (SNUhp26) mutated with OV TALEN 2 (Right). (C) Mutated target DNA sequences of chicken PGCs with OV TALEN 2. A dash in the DNA sequences denotes the deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene.
GFP-positive cells were sorted by FACS, as it was expected that GFP-expressing cells were also delivered with both right and left TALEN constructs. After 10–14 d of in vitro culture, we examined mutations in chicken B4GALT1 and β-actin genes with a T7E1 assay (Fig. S2 B and C). TALEN-induced mutated frameshift efficiency was 36.4–60.0% in B4GALT1 and 8.3–9.1% in β-actin (Fig. S2 B and C). Various mutant genotypes and lengths were induced by TALENs in each gene: 1–33 nucleotide deletions and one additional nucleotide insertion (Fig. S2 A–C). Thus, the combination of cotransfection and FACS sorting with GFP expression was an effective and practical approach to selecting chicken cells with TALEN-mediated mutants of endogenous genes in the chicken genome. Next, to investigate whether specific gene-targeted chickens could be generated by a TALEN-mediated approach through germ-line transmission, we synthesized TALEN plasmid constructs specific to the chicken ovalbumin (OV) gene, which encodes a major protein in hen egg white. Two OV TALENs designed to disrupt the translational initiation codon (i.e., ATG) in chicken OV gene exon 2 (Fig. 1B and Fig. S3A) were transfected into chicken DF1 cells to measure the chicken genomic modification efficacy. Through T7E1 assay and DNA sequencing analysis, we observed that OV TALEN 2 actively mutated the ovalbumin target locus (Fig. 1B and Fig. S3B). However, OV TALEN 1 constructs did not induce mutation at the target site (Fig. 1B). The frequency of mutations was 36.7% with OV TALEN 2 in the DF1 cell line (Fig. S3B). Thus, the effective OV TALEN 2 set was applied to chicken germ cells for the production of mutant chickens. 2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
Mutation Induction of OV Gene in Chicken PGCs by TALENs. Genetic engineering techniques, such as stem cell-based and somatic cell nuclear transfer-mediated modifications, are difficult to apply in avian species because of technical difficulties associated with manipulating avian oocytes and accessing the oocyte nucleus. To overcome the technical obstacles of genomic modification in chickens, we recently established chicken primordial germ cell (PGC) lines with germ-line transmission capacity (18). We applied the same combination of techniques to the PGC line, using fluorescence-positive separation 1 d after cotransfection with the GFP vector and OV TALEN 2 set. PGC transient transfection efficiency was relatively low compared with DF1 cells; in general, GFP-expressing PGCs were sorted at less than 5% compared with 30–40% in DF1 cells 1 d after cotransfection with GFP and TALEN plasmids (Figs. S2 B and C and S4). When the OV TALEN 2 set was introduced into the SNUhp26 male PGC line (Fig. S4), we found that OV TALEN 2 effectively induced nucleotide deletions at the targeted locus (Fig. 1 B and C). TALENmediated mutations in chicken PGCs were 6–29 nucleotide deletions that induced frameshifts as well as in-frame mutations (Fig. 1C). In some mutations, nucleotides were deleted before the ATG start codon without any ORF shift, whereas mutations in the ATG site caused complete substitution in amino acid sequences, likely resulting in abolishment of the ovalbumin protein (Fig. 1C). Notably, DF1 cells had more various mutant genotypes compared with chicken PGCs (Fig. 1C and Fig. S3B). Furthermore, additional nucleotide insertion mutants were found in DF1 cells, although no insertion mutant was detected in chicken PGCs. However, no significant difference in mutation efficiency was observed between DF1 cells and PGCs (36.7% versus 33.3% with OV TALEN 2). Park et al.
A
B
&QPQT2)%FGTKXGFEJKEMU ,, 6'
ߨ ߨ
ߨ ߨ
ߨ ߨ
*[DTKFEJKEM ,L
M G S I G A A S TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A -------------------------GTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A
amino acids wild 29nt del
ID#704 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGT----- --- --- --- --- --- -CA GCA AGC A
wild 21nt del
frameshift
ID#736 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#781 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#784 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#787 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A
wild 6nt del
frameshift
ID#803 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A TGCTGTTTGCTCTAGACA-------------- -TG GGC TCC ATC GGT GCA GCA AGC A
wild 15nt del
frameshift
D 186#.'0EQPUVTWEVRNCUOKF RI
RI
RI
HI HI
18OWVCPV RTQIGPKGU
YKNF
Fig. 2. (A) A germ-line chimeric male KOC founder (#4312) artificially inseminated a female WL. (B) The hatched chicks produced from the founder through test-cross and T7E1 assay of the offspring. Feather color of the donor WL (I/I)-derived chick was white, whereas the hybrid (I/i) chick produced from the recipient founder KOC had black spots. OV mutant chicks were identified by T7E1 assay. (C) Targeted DNA sequences in the OV gene were analyzed in the OV mutant donor PGC-derived offspring. A dash in the DNA sequences denotes deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene. (D) Detection of the OV TALEN 2 construct in mutant offspring by genomic PCR. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilutions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a negative control.
Production of Ovalbumin Mutant Chicks Through Germ-Line Chimeras.
Subsequently, OV knockout White Leghorn (WL) chicken PGCs were transplanted into recipient Korean Oge chicken (KOC) embryos to generate mutant offspring through germ-line transmission. After sexual maturation of the hatched founders (Fig. 2A and Table S1), sperm from founder roosters was analyzed, using WL or KOC strain-specific primers to detect PGC-differentiated donor sperm from the founder roosters before test-cross. The founders produced WL sperm as well as KOC sperm (Fig. S5A). Subsequently, the mutant sperm with TALEN-induced deletions were also detected by the T7E1 assay (Fig. S5B). DNA sequencing analysis with founder #4312 rooster sperm was conducted, and the mutant sperm rate was 18.8% (3/16), which demonstrated the
existence of two different genotypes (Fig. S5C). Through test-cross analysis, OV gene-targeted mutant offspring were successfully produced from mutated donor chicken PGCs, yielding an 8.0% mutant rate on average in the chicken progenies (Fig. 2B and Table 1). All mutant chickens had a monoallelic mutation because of mating between the germ-line chimeric rooster and wild-type hens (Fig. 2C). Similar to the founder sperm, four mutated alleles were found in the targeted ovalbumin of knockout chickens (Fig. 2C). This result indicated that chicken PGCs genetically edited with TALENs were germ-line-transmittable to the next generation through proliferation and differentiation processes into fertile gametes. The hatched monoallelic knockout chicks were normal and healthy without any phenotypic deformity (Fig. 2B).
Table 1. Efficiency of germ-line transmission derived from the founders and frequency of OV gene mutants in the offspring Founder ID 4309 4312 Total
Number of hatched chicks
Number of donor PGC-derived chicks, %*
Number of OV mutant chicks, %†
87 126 213
20 (22.3) 67 (53.2) 87 (40.8)
0 (0.0) 7 (10.4) 7 (8.0)
*Chicks derived from transplanted donor-PGCs in the recipient chickens. † Mutation was determined by T7E1 assay and targeted DNA sequencing.
Park et al.
PNAS Early Edition | 3 of 6
AGRICULTURAL SCIENCES
C ID#648
To assay TALEN-induced toxicity resulting from nonspecific double-strand DNA breaks, potential off-targets were analyzed in OV TALEN 2-transfected PGCs and the knockout chicks by sequencing analysis. We detected no off-target mutations induced by OV TALEN 2 in the genome of the hatched chicks or in chicken PGCs (Table S2 and Fig. S6A). In addition, in the knockout chicks, we screened OV TALEN construct plasmids that were transferred into PGCs to examine whether they contained foreign transgenes in their genomic content. The designed primer sets were highly sensitive and could detect 100-fg transgene plasmid DNAs, which amounted to less than 0.3 copies in the chicken genome (Fig. 2D). However, no transgene sequence was detected in the ovalbumin-knockout chicks (Fig. 2D). No GFP expression was observed in either of the mutant PGCs or donor-derived chicks, indicating that the transgene was not randomly integrated into the chicken genome during transfection or sorting procedures. In our previous report, the CMV promoter-controlled GFP gene was strongly expressed in transgenic chicks as well as in PGCs that contained a single transgene copy in their genome (18). Discussion Chickens have a diploid number of 78 chromosomes (2n = 78), which are classified into five pairs of macrochromosomes, five pairs of intermediate chromosomes, and 28 pairs of microchromosomes and sex chromosomes (19). Chicken microchromosomes represent approximately one-third of the total genome size, and the majority of genes were assumed to be located on microchromosomes (20). However, because of the small architectural size of microchromosomes, genetic modification of specific microchromosome target loci could be difficult. In this study, we validated TALEN accessibility and activity on the chicken B4GALT1 gene, which is located on the Z chromosome, and the β-actin gene on microchromosome 14. Our results indicated that the TALEN system can be efficiently applied to modify specific loci on chicken genome microchromosomes, albeit with various efficiency depending on the target genes and sites. The next steps should involve generating biallelic mutant hens through mating and breeding selection, as well as validating ovalbumin protein deposition in mutant chicken egg white. Hen egg white and egg white proteins occupy about 60% and 11%, respectively, of the whole egg weight (21). Ovalbumin is a major protein and constitutes ∼54% of total egg white proteins (21). In an ovalbumin knockout hen, the percentages of each egg white component could be changed, and it is necessary to examine whether the amount of small-quantity, high-value biofunctional proteins such as cystatin could be increased or not. Because of the massive deposition of proteins, hen egg is considered to be the best animal model for bioactive material production (22, 23). However, the excessive amount of ovalbumin hinders the purification processes of a small amount of biofunctional proteins. Thus, egg white component modification provides a powerful tool for wide-ranging agricultural and industrial applications. Using egg white composition-controlled eggs, a small quantity of therapeutic proteins in transgenic chicken bioreactors could be efficiently separated and isolated. In addition, we need to further examine the economic traits, such as egg production, egg size, and chicken embryo development, in the ovalbumin knockout chickens with the different mutant genotypes. Other egg white proteins, such as ovomucoid and ovotransferrin, are well-known major allergy-inducing components. Such allergy-inducing components can be eliminated by gene knockout with TALENs, and these allergen-reduced eggs could be used for vaccine production or even food consumption. A new genome editing tool platform was recently reported: Clustered Regularly Interspaced Short Palindromic RepeatsCRISPR-associated (CRISPR-Cas) (24–26). Compared with TALENs, CRISPR-Cas is a fast and cost-effective system for 4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
modifying the genomes of various organisms because of its simple, practical use and robust cutting activity (27–30). CRISPR is an immune system that was discovered in bacteria (31). CRISPR RNA specifically recognizes complementary target sequences of foreign DNA, and CRISPR-Cas nuclease generates a double-strand break that induces nucleotide sequence mutations. Therefore, the feasibility and applicability of the CRISPRCas platform need to be examined for editing the avian genome. The chicken as a classic model has unexcelled and valuable advantages for gaining insights into biological processes and their significance. At this time, chicken PGCs can be successfully maintained in vitro without the loss of germ cell integrity (32, 33), and generating transgenic chickens is feasible using transposon elements in cultured chicken PGCs (18, 34). This study demonstrated the creation of specific knockout chickens using TALENs. Our results extended the application of state-of-theart TALEN technology from experimental animals to farm animals. Tailored genome editing in chicken will open a new era to advance knowledge not only for comprehensive understanding of avian biology but also for agricultural applications. To generate economically important genetic resources, the conventional selective breeding system based on individual or population crossbreeds is an expensive, time-consuming, and laborious process. Because TALEN-mediated knockout chickens are genetically modified but nontransgenic, because of the lack of genomic integration of exogenous transgenes (Fig. 2D), specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for agriculturally practical applications as well as for model animals and embryo development studies. To our knowledge, this is the first description of genetic knockout chickens through germ-line transmission of TALEN-edited PGCs. Materials and Methods Experimental Animal Care. The care and experimental use of chickens were approved by the Institute of Laboratory Animal Resources, Seoul National University (SNU-070823-5). All experimental birds, including WL and KOCs, were maintained according to a standard management program at the University Animal Farm, Seoul National University, Korea. The procedures for animal management, reproduction, and embryo manipulation adhered to the standard operating protocols of our laboratory. TALEN Construction. To construct TALEN plasmids for DsRed, B4GALT1, and β-actin genes, TALEN expression plasmids were assembled via the one-step Golden Gate cloning system, as described previously (16). Chicken OV TALENs were assembled using methods described in Sanjana and colleagues (35). Briefly, three 18-mer tandem repeat hexamers were assembled individually by Golden Gate cloning, using the amplified monomers, and then treated with an exonuclease to remove all linear DNA regions, leaving only the properly assembled tandem hexamers. Subsequently, each tandem hexamer was amplified, and after purification, the hexamers corresponding to 1–6, 7–12, and 13–18 were ligated into the TALEN cloning backbone. Finally, the TALEN constructs were verified by DNA sequencing. DF1 Culture and Transfection for Fluorescence-Activated Cell Sorting. The chicken DF1 cell line was maintained and subpassaged in DMEM (Invitrogen, Carlsbad, CA), supplemented with 10% FBS (Invitrogen) and 1× antibiotic– antimycotic (Invitrogen). DF1 cells were cultured in an incubator at 37 °C in an atmosphere of 5% CO2 and 60–70% relative humidity. To generate the DsRed-expressing DF1 subline, plasmid DNA with the DsRed gene expressed by CMV immediate-early enhancer/promoter and neomycin-resistance gene with Simian vacuolating virus 40 promoter was transfected into chicken DF1 cells using Lipofectamine reagent (Invitrogen), according to the manufacturer’s protocol. One day after transfection, 300 μg/mL G418 was added to the culture media, and DsRed-expressing cells were completely selected after 2 wk. For DsRed gene knockout, 10 μL Lipofectamine reagent and 2.5 μg of each DsRed TALEN plasmid set were incubated in 250 μL OPTI-MEM (Invitrogen) at room temperature. After 5 min incubation, Lipofectamine and DsRed TALENs were combined and incubated for an additional 20 min. The complex mixture was gently pipetted and dropped into a well of a 6-well plate at 70–80% DF1 cell confluency. For chicken B4GALT1, β-actin, and OV
Park et al.
PGC Culture and Transfection for FACS Sorting. In a previous report (18), we established a male chicken PGC line (SNUhp26) from WL embryonic gonads at day 6 (stage 28). The SNUhp26 PGC line was maintained and subpassaged with knockout DMEM (Invitrogen) supplemented with 20% FBS (Invitrogen), 2% chicken serum (Sigma-Aldrich, St. Louis, MO), 1× nucleosides (Millipore, Temecula, CA), 2 mM L-glutamine, 1× nonessential amino acids, β-mercaptoethanol, 10 mM sodium pyruvate, 1× antibiotic–antimycotic (Invitrogen), and human basic fibroblast growth factor (10 ng/mL; Koma Biotech, Seoul, Korea). Chicken PGCs were cultured in an incubator at 37 °C with an atmosphere of 5% CO2 and 60–70% relative humidity. The cultured PGCs were subcultured onto mitomycin-inactivated mouse embryonic fibroblasts (MEFs) in 5–6-d intervals by gentle pipetting without any enzyme treatment. Similar to DF1 cells, the CMV GFP expression plasmid vector and each OV TALEN were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = CMV GFP: TALEN R:TALEN L). One day after lipofection, GFP-expressing PGCs were sorted using a FACSAria III cell sorter (Becton, Dickinson and Company). After harvesting, PGCs were resuspended in PBS containing 1% BSA and strained through a cell strainer for FACS separation (40 μm; BD Falcon; Becton, Dickinson and Company). T7E1 Assay and DNA Sequencing Analysis. Genomic DNA was extracted from DF1 cells or chicken PGCs after transfection of each TALEN set and FACS sorting. For the T7E1 assay (36), the genomic region encompassing the TALEN target site was amplified with a specific primer set for DsRed, chicken B4GALT1, β-actin, or OV gene (Table S3). We found the single nucleotide polymorphism of the first PCR amplicon of the OV gene in PGC line, and the nested products after second PCR were used for T7E1 assay (Table S3). The amplicons were reannealed to form a heteroduplex DNA structure after denaturation. Subsequently, the heteroduplex amplicons were treated with 5 units T7E1 (New England Biolabs, Ipswich, MA) for 15 min at 37 °C and then analyzed by agarose gel electrophoresis. T7E1 assay for founder sperm and offspring was also conducted using the same protocol. To confirm target locus mutation, PCR amplicons were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced with an ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA). Off-Target Prediction and Analysis. Potential chicken OV TALEN 2 off-targets were predicted using the web-based software program TAL Effector Nucleotide Targeter 2.0 (37) in the chicken genome. The chicken genome sequence was submitted by providing the latest GenBank Assembly ID (GCA_000002315.2). Two OV TALEN 2 repeat-variable di-residue sequences were submitted in the form required by the tool, and the spacer length
1. Thompson S, Clarke AR, Pow AM, Hooper ML, Melton DW (1989) Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 56(2):313–321. 2. Koller BH, et al. (1989) Germ-line transmission of a planned alteration made in a hypoxanthine phosphoribosyltransferase gene by homologous recombination in embryonic stem cells. Proc Natl Acad Sci USA 86(22):8927–8931. 3. Zijlstra M, Li E, Sajjadi F, Subramani S, Jaenisch R (1989) Germ-line transmission of a disrupted beta 2-microglobulin gene produced by homologous recombination in embryonic stem cells. Nature 342(6248):435–438. 4. Schwartzberg PL, Goff SP, Robertson EJ (1989) Germ-line transmission of a c-abl mutation produced by targeted gene disruption in ES cells. Science 246(4931):799–803. 5. Capecchi MR (2005) Gene targeting in mice: Functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet 6(6):507–512. 6. Brown WR, Hubbard SJ, Tickle C, Wilson SA (2003) The chicken as a model for largescale analysis of vertebrate gene function. Nat Rev Genet 4(2):87–98. 7. Schusser B, et al. (2013) Immunoglobulin knockout chickens via efficient homologous recombination in primordial germ cells. Proc Natl Acad Sci USA 110(50):20170–20175. 8. Cui X, et al. (2011) Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nat Biotechnol 29(1):64–67. 9. Hauschild J, et al. (2011) Efficient generation of a biallelic knockout in pigs using zincfinger nucleases. Proc Natl Acad Sci USA 108(29):12013–12017. 10. Kim S, Lee MJ, Kim H, Kang M, Kim JS (2011) Preassembled zinc-finger arrays for rapid construction of ZFNs. Nat Methods 8(1):7.
Park et al.
value between the two TAL effectors was set from 10 to 30 bp. The remaining setting values: “Score Cutoff,” “Upstream Base, ” and “Dimer Types to Find” were set to “3.0,” “T only,” and “Both,” respectively, as recommended by the tool. For analysis, three target sites that had the best scores (i.e., the sum of two TAL scores) were chosen. The genomic sequences of three sites were amplified by PCR, using primer sets for off-targets on chromosome 9 (forward: 5′-AGG GAA GGG ACA AAG AGC CT-3′ and reverse: 5′-GGT GGC TGT GGT ATG GTT CT-3′), chromosome 3 (forward: 5′-CAG CCA AAG AGA CCC AGA GG-3′ and reverse: 5′-TCC AGG GAG TTC TGA GAG GG-3′), and chromosome 4 (forward: 5′-GTT TTG GTT CCA GCA GTG GC-3′ and reverse: 5′-CTA CCT GAG CAA CAG GGC TC-3′), cloned into the pGEM-T easy vector (Promega) and sequenced. Microinjection of Chicken Ovalbumin Mutant PGCs into Recipients. To inject OV mutant PGCs into recipient embryos, a small window was made on the pointed end of the recipient KOC egg, and a 2-μL aliquot containing more than 3,000 PGCs was microinjected with a micropipette into the dorsal aorta of the recipient embryo. The egg window of the recipient embryo was sealed with paraffin film, and the egg was incubated with the pointed end down until hatching. We determined the sex of hatched chicks using W chromosome-specific primers (forward: 5′-CTA TGC CTA CCA CAT TCC TAT TTG C-3′ and reverse: 5′-AGC TGG ACT TCA GAC CAT CTT CT-3′), and only male chicks were used for test-cross analysis after sexual maturation. PCR was performed with an initial incubation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 30 s. The reaction was terminated by a final incubation at 72 °C for 7 min. Test-Cross Analysis and Detection of Mutant Chickens. WLs with a dominant pigmentation inhibitor gene (I/I) and KOCs with a recessive pigmentation inhibitor gene (i/i) were used for the donor PGCs and the recipient embryos, respectively. Through test-cross analysis by mating with WL hens (I/I), the germ-line chimeras were identified by offspring phenotype. Endogenous germ cells in the KOC recipient males (i/i) produced hybrid chicks (I/i) with black spots, whereas WL donor-derived germ cells (I/I) produced white chicks with I/I. Offspring derived from the transplanted mutant PGCs were screened using T7E1 assay, and the mutant genotype of individual chicks was subsequently identified by DNA sequencing (Fig. S6B). Transgene Detection in Mutant Offspring. To investigate whether any transgene was integrated into the mutant chicken genome, genomic PCR was conducted. OV TALEN 2 expression vector-specific primer sets were used (forward: 5′-GTG GGG AGC CCG ATT GAT TA-3′ and reverse: 5′-TTC AAC CGT GTG AGC TGG GC-3′). PCR was performed with an initial incubation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s and 68 °C and 72 °C for 30 s. The reaction was terminated by a final incubation at 72 °C for 7 min. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilutions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a negative control. ACKNOWLEDGMENTS. This work was supported by the Next-Generation BioGreen 21 Program Grant PJ008142, Rural Development Administration, Republic of Korea.
11. Miller JC, et al. (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29(2):143–148. 12. Sander JD, et al. (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29(8):697–698. 13. Huang P, et al. (2011) Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol 29(8):699–700. 14. Zu Y, et al. (2013) TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat Methods 10(4):329–331. 15. Sung YH, et al. (2013) Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol 31(1):23–24. 16. Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31(3):251–258. 17. Porteus MH, Carroll D (2005) Gene targeting using zinc finger nucleases. Nat Biotechnol 23(8):967–973. 18. Park TS, Han JY (2012) piggyBac transposition into primordial germ cells is an efficient tool for transgenesis in chickens. Proc Natl Acad Sci USA 109(24):9337–9341. 19. Wong GK, et al.; International Chicken Polymorphism Map Consortium (2004) A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms. Nature 432(7018):717–722. 20. Burt DW (2002) Origin and evolution of avian microchromosomes. Cytogenet Genome Res 96(1-4):97–112. 21. Yamamoto T, Juneja LR, Hatta H, Kim M (1997) Hen Eggs: Their Basic and Applied Science (CRC press, Boca Raton), pp 13–24.
PNAS Early Edition | 5 of 6
AGRICULTURAL SCIENCES
gene knockout, CMV GFP expression plasmid vector and each TALEN set of target genes were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = CMV GFP:TALEN R:TALEN L). After incubation at 37 °C in 5% CO2 for 6 h, cells were gently washed with PBS three times, and new culture medium was added. One day after lipofection, GFP-expressing cells were sorted using a FACSAria III cell sorter (Becton, Dickinson and Company, Franklin Lakes, NJ). After total cells were harvested using 0.05% trypsin-EDTA (Invitrogen), cells were resuspended in PBS containing 1% BSA and strained through a cell strainer for FACS separation (40 μm; BD Falcon; Becton, Dickinson and Company).
22. Zhu L, et al. (2005) Production of human monoclonal antibody in eggs of chimeric chickens. Nat Biotechnol 23(9):1159–1169. 23. Lillico SG, et al. (2007) Oviduct-specific expression of two therapeutic proteins in transgenic hens. Proc Natl Acad Sci USA 104(6):1771–1776. 24. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823. 25. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339(6121): 823–826. 26. Cho SW, Kim S, Kim JM, Kim JS (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31(3):230–232. 27. Hwang WY, et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31(3):227–229. 28. Wang H, et al. (2013) One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153(4):910–918. 29. Cho SW, Lee J, Carroll D, Kim JS, Lee J (2013) Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195(3):1177–1180. 30. Sung YH, et al. (2014) Highly efficient gene knockout in mice and zebrafish with RNAguided endonucleases. Genome Res 24(1):125–131.
6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111
31. Barrangou R, et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315(5819):1709–1712. 32. Choi JW, et al. (2010) Basic fibroblast growth factor activates MEK/ERK cell signaling pathway and stimulates the proliferation of chicken primordial germ cells. PLoS ONE 5(9):e12968. 33. Macdonald J, Glover JD, Taylor L, Sang HM, McGrew MJ (2010) Characterisation and germline transmission of cultured avian primordial germ cells. PLoS ONE 5(11): e15518. 34. Macdonald J, et al. (2012) Efficient genetic modification and germ-line transmission of primordial germ cells using piggyBac and Tol2 transposons. Proc Natl Acad Sci USA 109(23):E1466–E1472. 35. Sanjana NE, et al. (2012) A transcription activator-like effector toolbox for genome engineering. Nat Protoc 7(1):171–192. 36. Kim HJ, Lee HJ, Kim H, Cho SW, Kim JS (2009) Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res 19(7): 1279–1288. 37. Doyle EL, et al. (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: Tools for TAL effector design and target prediction. Nucleic Acids Res 40(Web Server issue): W117-22.
Park et al.
