j o u r n a l o f s u r g i c a l r e s e a r c h x x x ( 2 0 1 5 ) 1 e9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Q1 18 19 20 Q10 21 Q2 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
Available online at www.sciencedirect.com
66 67 68 69 70 71 journal homepage: www.JournalofSurgicalResearch.com 72 73 74 75 76 77 78 79 80 81 82 83 84 85 Haiying Tang,a,1 Huanyu He,a,1 Hong Ji,b Lili Gao,a Jingwei Mao,a Jia Liu,a c, a, 86 Hongli Lin, ** and Taihua Wu * 87 a 88 Department of Respiratory Medicine, The First Affiliated Hospital of Dalian Medical University, Dalian, 89 People’s Republic of China 90 b Department of Pediatrics, The First Affiliated Hospital of Dalian Medical University, Dalian, 91 People’s Republic of China 92 c Department of Nephrology, The First Affiliated Hospital of Dalian Medical University, Dalian, 93 People’s Republic of China 94 95 96 article info abstract 97 98 Article history: 99 Background: Epithelial to mesenchymal transition (EMT) of alveolar epithelial cells occurs in 100 Received 9 December 2014 lung fibrotic diseases. Tanshinone ⅡA (Tan ⅡA) has been reported to exert anti101 Received in revised form inflammatory effects in pulmonary fibrosis. Nonetheless, whether Tan ⅡA affects lung 102 15 February 2015 fibrosis-related EMT remains unknown and requires for further investigations. 103 Accepted 26 February 2015 Materials and methods: A single intratracheal instillation of saline containing bleomycin 104 Available online xxx (BLM; 5 mg/kg body weight) was performed to induce pulmonary fibrosis in Spraguee 105 Dawley rats. Rats receiving an instillation of equivoluminal normal saline served as 106 Keywords: controls. Then, these rats were given a daily intraperitoneal administration of Tan ⅡA 107 Pulmonary fibrosis (15 mg/kg body weight) for 28 d before sacrifice. In vitro, recombinant transforming growth 108 Tanshinone ⅡA 109 factor-beta 1 (TGF-b1; 10 ng/mL) was used to treat human alveolar epithelial A549 cells for Epithelial to mesenchymal 110 48 h. Tan ⅡA (10 mM) or control DMSO was used to pretreat cells for 2 h before TGF-b1 transition 111 stimulation. Rat lung tissue samples and A549 cells were then subjected to further 112 TGF-b signaling pathway assessments. 113 Results: Tan ⅡA was noted to alleviate BLMeinduced pulmonary collagen deposition and 114 macrophage infiltration in rats. Epithelial-cadherin expression was decreased after BLM 115 stimulation, whereas a-smooth muscle actin, fibronectin, and vimentin were increased. 116 These expression alterations were partially reversed by Tan ⅡA. Moreover, Tan ⅡA sup117 pressed BLM-induced increases in TGF-b1, phosphorylated Smad-2, and -3 in rats. Addi118 tionally, pretreatment of Tan ⅡA inhibited TGF-b1etriggered EMT, reduced collagen Ⅰ 119 production, and blocked TGF-b signal transduction in A549 cells. 120 121 122 123 * Corresponding author. Department of Respiratory Medicine, The First Affiliated Hospital of Dalian Medical University, 222 Zhongshan 124 Road, Dalian 116011, People’s Republic of China. Tel.: ---; fax: ---. Q3 Q4 125 ** Corresponding author. Department of Nephrology, The First Affiliated Hospital of Dalian Medical University, 222 Zhongshan Road, 126 Dalian 116011, People’s Republic of China. Tel.: þ86 411 83635963; fax: þ86 411 83622844. 127 E-mail addresses: [email protected] (H. Lin), [email protected] (T. Wu). 1 128 H.T. and H.H. contributed equally to this study. 129 0022-4804/$ e see front matter ª 2015 Elsevier Inc. All rights reserved. 130 http://dx.doi.org/10.1016/j.jss.2015.02.062
ScienceDirect
Tanshinone IIA ameliorates bleomycin-induced pulmonary fibrosis and inhibits transforming growth factor-beta-bedependent epithelial to mesenchymal transition
5.2.0 DTD YJSRE13173_proof 28 March 2015 1:31 am ce
2
j o u r n a l o f s u r g i c a l r e s e a r c h x x x ( 2 0 1 5 ) 1 e9
Conclusions: Our research suggests that Tan ⅡA mitigates BLMeinduced pulmonary fibrosis 131 and suppresses TGF-bedependent EMT of lung alveolar epithelial cells. 132 ª 2015 Elsevier Inc. All rights reserved. 133 134 135 136 1. Introduction in rats. Nonetheless, the effects of Tan ⅡA on TGF-b signal137 138 dependent EMT and the underlying mechanisms in fibrotic 139 Idiopathic pulmonary fibrosis (IPF) is a devastating and lung disease are elusive and required to be further 140 generally fatal form of interstitial lung disease, which is investigated. 141 characterized by excessive proliferation of fibroblasts/myofiTherefore, in the present study, we hypothesized that Tan 142 broblasts, aberrant deposition of extracellular matrix, failure ⅡA could mitigate TGF-berelated EMT process during IPF 143 of alveolar reepithelialization, and abnormality of vascular progress and investigated the potential molecular mecha144 repair and remodeling, and so forth [1,2]. These pathologic nisms in vivo and in vitro. 145 alterations often result in distortion of lung architecture, 146 eventually leading to respiratory failure [3]. Although a variety 147 of potential therapies for IPF are applied in clinical trials 148 2. Materials and methods 149 worldwide [4], IPF still leads to death within 5 y of diagnosis 150 [5]. Searching for novel effective therapeutic drugs for IPF is 2.1. Animals and treatment 151 still needed. 152 New developments in understanding the pathogenesis of SpragueeDawley rats (8-wk-old, weighing around 250 g) were 153 IPF include a growing consensus that the epithelial to obtained from Dalian Medical University, kept at a constant 154 mesenchymal transition (EMT) of epithelial cells may account temperature of 20 Ce22 C and humidity of 50%e60% with a 155 for the increased numbers of pulmonary fibroblasts during the 12-h lightedark cycle, and freely fed a standard diet and tap 156 fibrotic process [6]. Tanjore et al. [7] have demonstrated that water. BLM was used to stimulate pulmonary fibrosis in rats. 157 EMT of alveolar epithelial cells contributes to fibroblasts in Briefly, rats were anesthetized with intraperitoneal injection 158 bleomycin (BLM)einduced lung fibrosis. It has been suggested of 10% chloride hydrate (3.5 mL/kg) and then given a single 159 that suppression of abnormal EMT process either with exog160 intratracheal instillation of saline containing 5 mg/kg body 161 enous reagents such as methacycline and sorafenib [8,9] or weight BLM (Melonepharma, Dalian, China). Anesthetized rats 162 endogenous regulators such as microRNA-26a and microRNAthat only received intratracheal instillation of normal sterile 163 21 [10,11] can ameliorate pulmonary fibrogenesis. These presaline were used as controls. Thereafter, the control or BLM164 vious studies support a concept that EMT signaling is imporstimulated rats were given intraperitoneal administration of 165 tant to lung fibrosis, and inhibition of EMT may represent a Tan ⅡA daily (15 mg/kg body weight; Melonepharma). Animal 166 useful approach to attenuate pulmonary fibrosis. groups were as follows (n ¼ 6 per group): 1) control group; 2) 167 Tanshinone ⅡA (Tan ⅡA) is a bioactive constituent extracTan ⅡA group, control rats received daily injection of Tan ⅡA; 3) 168 ted from the root of Salvia miltiorrhiza Bunge, a Chinese herbal BLM; and 4) BLM þ Tan ⅡA, BLM-treated rats received daily 169 medicine [12]. Antitumor activities, cardioprotective, and injection of Tan ⅡA. The dose of Tan ⅡA used in the present 170 neuroprotective effects of Tan ⅡA have been reported in many 171 study was chosen on the basis of a previous study from Wang 172 earlier studies [13e15]. Notably, Tan ⅡA has also been proven et al. [25]. Rats from each group were sacrificed on day 28 after 173 to effectively mitigate seawater exposure-induced lung inthe initial instillation. After sacrifice, the right lungs were 174 juries such as lung edema and vascular leakage in rodents removed and fixed in 4% paraformaldehyde, dehydrated, and 175 [16,17], suggesting that Tan ⅡA has a protective activity in embedded in paraffin until use. Procedures of animals have 176 pulmonary diseases. Fu et al. [18] have found that Tan ⅡA been approved by the Institutional Animal Care and Use 177 Committee of Dalian Medical University, which conforms to Q5 blocks EMT in MCF-7 and HCC1973 breast cancer cell lines. 178 Likewise, Wang et al. [19] have reported that Tan ⅡA inhibits the provisions of the Declaration of Helsinki in 1995 (as revised 179 EMT and metastasis of hepatocellular carcinoma in vivo. These in Edinburgh 2000). 180 two previous lines of evidence indicate an inhibitory effect of 181 Tan ⅡA on EMT of breast and liver cancer cells. However, 182 2.2. Cell culture and treatment 183 studies on the cellular and molecular mechanisms regarding 184 the effects of Tan ⅡA on EMT process in fibrotic lung disease Human alveolar epithelial cell line (A549) was purchased from 185 are scarce. the Cell Bank of Chinese Academy of Sciences (Shanghai, 186 Transforming growth factor-beta 1 (TGF-b1), a profibrotic China). Cells were maintained in DMEM (Gibco, Grand Island, Q6 187 factor, is reported to contribute to pathologic fibrosis develNY) containing 10% fetal bovine serum (HyClone, Logan, UT), 188 opment in the liver [20] and kidney [21]. Treatment of TGF-b1 100 U/mL penicillin, and 100 g/mL streptomycin at 37 C in a 189 enhances EMT in human alveolar epithelial A549 cells [22], humidified 5% CO2 atmosphere. These A549 cells were de190 whereas neutralizing its activity mitigates the EMT and subtached with 0.25% trypsinization (SigmaeAldrich Co, Cam191 sequently attenuates the detrimental pulmonary fibrosis [23]. bridgeshire, United Kingdom) and seeded in 6-well plates 192 Interestingly, a recent study from Wu et al. [24] demonstrates (1 105 cells per well). Cells with a confluence of 70%e80% 193 that Tan ⅡA remarkably reduces BLM-induced inflammation 194 were pretreated with 10 mM Tan ⅡA or control DMSO (final Q7 195 in pulmonary fibrosis and decreases the expression of TGF-b1 concentration 30 )
TGF-b1 Forward: CAACAATTCCTGGCGTTACCT Reverse: AGCCCTGTATTCCGTCTCCTT b-actin Forward: GGAGATTACTGCCCTGGCTCCTAGC Reverse: GGCCGGACTCATCGTACTCCTGCTT
Fragment size (bp) 125 155
3
concentrations were determined by the bicinchoninic acid Protein Assay Kit (Beyotime). Equal amounts of protein samples were fractionated on SDS-PAGE, transferred onto PVDF Q8 membranes (Millipore, Bedford, MA), and blocked with 5% (w/ v) skim milk. The membranes were blotted with polyclonal antibodies against Smad-2 (1: 500 diluted; Bioss, Beijing, China), phosphorylated Smad-2 (p-Smad-2; 1: 500 diluted; Bioss), Smad3 (1: 500 diluted; Bioss), p-Smad3 (1: 500 diluted; Bioss), TGF-b1 (1: 1000 diluted; Wanleibio, Shenyang, China), epithelial-cadherin (E-cadherin; 1: 1000 diluted; Wanleibio), asmooth muscle actin (a-SMA; 1: 1000 diluted; Wanleibio), fibronectin (1: 1000 diluted; Wanleibio), and vimentin (1: 1000 diluted; Wanleibio) at 4 C overnight and then incubated with appropriate secondary antibodies at room temperature (RT) for 45 min. The protein blots on the membranes were visualized with an ECL Kit (Millipore), and the band density values were calculated as a ratio to b-actin.
2.7.
Immunofluorescence staining
The 5-mm-thick slices of rat lung tissues and the paraformaldehyde-fixed A549 cells incubated with 0.1% Triton X-100 (Amresco, Solon, OH) at 100 C for 10 min and at RT for 30 min, respectively. Then, the E-cadherin antibody (1: 100 diluted) was used to immunodetect E-cadherin protein in these samples at 4 C overnight. Thereafter, a Cyanine-3-CTP (Cy3)-labeled secondary antibody (1: 100 diluted; Beyotime) was used to incubate tissue and cell samples for 60 min in the dark. Nuclei of the specimens were stained with 40 ,6diamidino-2-phenylindole (Beyotime) and then viewed under a laser confocal microscopy (BX53; Olympus, Tokyo, Japan).
2.8.
Immunohistochemical staining assay
The 5-mm slices were deparaffinized in xylene, hydrated with graded alcohol, and rinsed with 1% phosphate-buffered saline (HyClone). Then, the slices were incubated in 10 mmol/L citrate buffer (pH 6.0) at 100 C for 10 min to retrieve the antigen and placed in 3% hydrogen peroxide for 15 min at RT to block the endogenous peroxidase activity. After being blocked with goat serum for 30 min, the slices were incubated with primary antibodies against a macrophage marker CD-68 (1: 50 diluted; Santa Cruz Biotechnology, Santa Cruz, CA) at 4 C overnight and with appropriate secondary antibody at 37 C for another 30 min. Immunostaining was then detected with horseradish peroxidaseeconjugated streptavidin (Beyotime), then visualized using 3, 3’-diaminobenzidine, and counterstained with hematoxylin (Solarbio).
2.9.
Statistical analysis
Statistical data in the present study were expressed as mean standard deviation. One-way analysis of variance followed by the Bonferroni post hoc test was used for multiple comparisons using the SPSS version 17.0 (SPSS, Chicago, IL). A P value
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Q1 18 19 20 Q10 21 Q2 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
Available online at www.sciencedirect.com
66 67 68 69 70 71 journal homepage: www.JournalofSurgicalResearch.com 72 73 74 75 76 77 78 79 80 81 82 83 84 85 Haiying Tang,a,1 Huanyu He,a,1 Hong Ji,b Lili Gao,a Jingwei Mao,a Jia Liu,a c, a, 86 Hongli Lin, ** and Taihua Wu * 87 a 88 Department of Respiratory Medicine, The First Affiliated Hospital of Dalian Medical University, Dalian, 89 People’s Republic of China 90 b Department of Pediatrics, The First Affiliated Hospital of Dalian Medical University, Dalian, 91 People’s Republic of China 92 c Department of Nephrology, The First Affiliated Hospital of Dalian Medical University, Dalian, 93 People’s Republic of China 94 95 96 article info abstract 97 98 Article history: 99 Background: Epithelial to mesenchymal transition (EMT) of alveolar epithelial cells occurs in 100 Received 9 December 2014 lung fibrotic diseases. Tanshinone ⅡA (Tan ⅡA) has been reported to exert anti101 Received in revised form inflammatory effects in pulmonary fibrosis. Nonetheless, whether Tan ⅡA affects lung 102 15 February 2015 fibrosis-related EMT remains unknown and requires for further investigations. 103 Accepted 26 February 2015 Materials and methods: A single intratracheal instillation of saline containing bleomycin 104 Available online xxx (BLM; 5 mg/kg body weight) was performed to induce pulmonary fibrosis in Spraguee 105 Dawley rats. Rats receiving an instillation of equivoluminal normal saline served as 106 Keywords: controls. Then, these rats were given a daily intraperitoneal administration of Tan ⅡA 107 Pulmonary fibrosis (15 mg/kg body weight) for 28 d before sacrifice. In vitro, recombinant transforming growth 108 Tanshinone ⅡA 109 factor-beta 1 (TGF-b1; 10 ng/mL) was used to treat human alveolar epithelial A549 cells for Epithelial to mesenchymal 110 48 h. Tan ⅡA (10 mM) or control DMSO was used to pretreat cells for 2 h before TGF-b1 transition 111 stimulation. Rat lung tissue samples and A549 cells were then subjected to further 112 TGF-b signaling pathway assessments. 113 Results: Tan ⅡA was noted to alleviate BLMeinduced pulmonary collagen deposition and 114 macrophage infiltration in rats. Epithelial-cadherin expression was decreased after BLM 115 stimulation, whereas a-smooth muscle actin, fibronectin, and vimentin were increased. 116 These expression alterations were partially reversed by Tan ⅡA. Moreover, Tan ⅡA sup117 pressed BLM-induced increases in TGF-b1, phosphorylated Smad-2, and -3 in rats. Addi118 tionally, pretreatment of Tan ⅡA inhibited TGF-b1etriggered EMT, reduced collagen Ⅰ 119 production, and blocked TGF-b signal transduction in A549 cells. 120 121 122 123 * Corresponding author. Department of Respiratory Medicine, The First Affiliated Hospital of Dalian Medical University, 222 Zhongshan 124 Road, Dalian 116011, People’s Republic of China. Tel.: ---; fax: ---. Q3 Q4 125 ** Corresponding author. Department of Nephrology, The First Affiliated Hospital of Dalian Medical University, 222 Zhongshan Road, 126 Dalian 116011, People’s Republic of China. Tel.: þ86 411 83635963; fax: þ86 411 83622844. 127 E-mail addresses: [email protected] (H. Lin), [email protected] (T. Wu). 1 128 H.T. and H.H. contributed equally to this study. 129 0022-4804/$ e see front matter ª 2015 Elsevier Inc. All rights reserved. 130 http://dx.doi.org/10.1016/j.jss.2015.02.062
ScienceDirect
Tanshinone IIA ameliorates bleomycin-induced pulmonary fibrosis and inhibits transforming growth factor-beta-bedependent epithelial to mesenchymal transition
5.2.0 DTD YJSRE13173_proof 28 March 2015 1:31 am ce
2
j o u r n a l o f s u r g i c a l r e s e a r c h x x x ( 2 0 1 5 ) 1 e9
Conclusions: Our research suggests that Tan ⅡA mitigates BLMeinduced pulmonary fibrosis 131 and suppresses TGF-bedependent EMT of lung alveolar epithelial cells. 132 ª 2015 Elsevier Inc. All rights reserved. 133 134 135 136 1. Introduction in rats. Nonetheless, the effects of Tan ⅡA on TGF-b signal137 138 dependent EMT and the underlying mechanisms in fibrotic 139 Idiopathic pulmonary fibrosis (IPF) is a devastating and lung disease are elusive and required to be further 140 generally fatal form of interstitial lung disease, which is investigated. 141 characterized by excessive proliferation of fibroblasts/myofiTherefore, in the present study, we hypothesized that Tan 142 broblasts, aberrant deposition of extracellular matrix, failure ⅡA could mitigate TGF-berelated EMT process during IPF 143 of alveolar reepithelialization, and abnormality of vascular progress and investigated the potential molecular mecha144 repair and remodeling, and so forth [1,2]. These pathologic nisms in vivo and in vitro. 145 alterations often result in distortion of lung architecture, 146 eventually leading to respiratory failure [3]. Although a variety 147 of potential therapies for IPF are applied in clinical trials 148 2. Materials and methods 149 worldwide [4], IPF still leads to death within 5 y of diagnosis 150 [5]. Searching for novel effective therapeutic drugs for IPF is 2.1. Animals and treatment 151 still needed. 152 New developments in understanding the pathogenesis of SpragueeDawley rats (8-wk-old, weighing around 250 g) were 153 IPF include a growing consensus that the epithelial to obtained from Dalian Medical University, kept at a constant 154 mesenchymal transition (EMT) of epithelial cells may account temperature of 20 Ce22 C and humidity of 50%e60% with a 155 for the increased numbers of pulmonary fibroblasts during the 12-h lightedark cycle, and freely fed a standard diet and tap 156 fibrotic process [6]. Tanjore et al. [7] have demonstrated that water. BLM was used to stimulate pulmonary fibrosis in rats. 157 EMT of alveolar epithelial cells contributes to fibroblasts in Briefly, rats were anesthetized with intraperitoneal injection 158 bleomycin (BLM)einduced lung fibrosis. It has been suggested of 10% chloride hydrate (3.5 mL/kg) and then given a single 159 that suppression of abnormal EMT process either with exog160 intratracheal instillation of saline containing 5 mg/kg body 161 enous reagents such as methacycline and sorafenib [8,9] or weight BLM (Melonepharma, Dalian, China). Anesthetized rats 162 endogenous regulators such as microRNA-26a and microRNAthat only received intratracheal instillation of normal sterile 163 21 [10,11] can ameliorate pulmonary fibrogenesis. These presaline were used as controls. Thereafter, the control or BLM164 vious studies support a concept that EMT signaling is imporstimulated rats were given intraperitoneal administration of 165 tant to lung fibrosis, and inhibition of EMT may represent a Tan ⅡA daily (15 mg/kg body weight; Melonepharma). Animal 166 useful approach to attenuate pulmonary fibrosis. groups were as follows (n ¼ 6 per group): 1) control group; 2) 167 Tanshinone ⅡA (Tan ⅡA) is a bioactive constituent extracTan ⅡA group, control rats received daily injection of Tan ⅡA; 3) 168 ted from the root of Salvia miltiorrhiza Bunge, a Chinese herbal BLM; and 4) BLM þ Tan ⅡA, BLM-treated rats received daily 169 medicine [12]. Antitumor activities, cardioprotective, and injection of Tan ⅡA. The dose of Tan ⅡA used in the present 170 neuroprotective effects of Tan ⅡA have been reported in many 171 study was chosen on the basis of a previous study from Wang 172 earlier studies [13e15]. Notably, Tan ⅡA has also been proven et al. [25]. Rats from each group were sacrificed on day 28 after 173 to effectively mitigate seawater exposure-induced lung inthe initial instillation. After sacrifice, the right lungs were 174 juries such as lung edema and vascular leakage in rodents removed and fixed in 4% paraformaldehyde, dehydrated, and 175 [16,17], suggesting that Tan ⅡA has a protective activity in embedded in paraffin until use. Procedures of animals have 176 pulmonary diseases. Fu et al. [18] have found that Tan ⅡA been approved by the Institutional Animal Care and Use 177 Committee of Dalian Medical University, which conforms to Q5 blocks EMT in MCF-7 and HCC1973 breast cancer cell lines. 178 Likewise, Wang et al. [19] have reported that Tan ⅡA inhibits the provisions of the Declaration of Helsinki in 1995 (as revised 179 EMT and metastasis of hepatocellular carcinoma in vivo. These in Edinburgh 2000). 180 two previous lines of evidence indicate an inhibitory effect of 181 Tan ⅡA on EMT of breast and liver cancer cells. However, 182 2.2. Cell culture and treatment 183 studies on the cellular and molecular mechanisms regarding 184 the effects of Tan ⅡA on EMT process in fibrotic lung disease Human alveolar epithelial cell line (A549) was purchased from 185 are scarce. the Cell Bank of Chinese Academy of Sciences (Shanghai, 186 Transforming growth factor-beta 1 (TGF-b1), a profibrotic China). Cells were maintained in DMEM (Gibco, Grand Island, Q6 187 factor, is reported to contribute to pathologic fibrosis develNY) containing 10% fetal bovine serum (HyClone, Logan, UT), 188 opment in the liver [20] and kidney [21]. Treatment of TGF-b1 100 U/mL penicillin, and 100 g/mL streptomycin at 37 C in a 189 enhances EMT in human alveolar epithelial A549 cells [22], humidified 5% CO2 atmosphere. These A549 cells were de190 whereas neutralizing its activity mitigates the EMT and subtached with 0.25% trypsinization (SigmaeAldrich Co, Cam191 sequently attenuates the detrimental pulmonary fibrosis [23]. bridgeshire, United Kingdom) and seeded in 6-well plates 192 Interestingly, a recent study from Wu et al. [24] demonstrates (1 105 cells per well). Cells with a confluence of 70%e80% 193 that Tan ⅡA remarkably reduces BLM-induced inflammation 194 were pretreated with 10 mM Tan ⅡA or control DMSO (final Q7 195 in pulmonary fibrosis and decreases the expression of TGF-b1 concentration 30 )
TGF-b1 Forward: CAACAATTCCTGGCGTTACCT Reverse: AGCCCTGTATTCCGTCTCCTT b-actin Forward: GGAGATTACTGCCCTGGCTCCTAGC Reverse: GGCCGGACTCATCGTACTCCTGCTT
Fragment size (bp) 125 155
3
concentrations were determined by the bicinchoninic acid Protein Assay Kit (Beyotime). Equal amounts of protein samples were fractionated on SDS-PAGE, transferred onto PVDF Q8 membranes (Millipore, Bedford, MA), and blocked with 5% (w/ v) skim milk. The membranes were blotted with polyclonal antibodies against Smad-2 (1: 500 diluted; Bioss, Beijing, China), phosphorylated Smad-2 (p-Smad-2; 1: 500 diluted; Bioss), Smad3 (1: 500 diluted; Bioss), p-Smad3 (1: 500 diluted; Bioss), TGF-b1 (1: 1000 diluted; Wanleibio, Shenyang, China), epithelial-cadherin (E-cadherin; 1: 1000 diluted; Wanleibio), asmooth muscle actin (a-SMA; 1: 1000 diluted; Wanleibio), fibronectin (1: 1000 diluted; Wanleibio), and vimentin (1: 1000 diluted; Wanleibio) at 4 C overnight and then incubated with appropriate secondary antibodies at room temperature (RT) for 45 min. The protein blots on the membranes were visualized with an ECL Kit (Millipore), and the band density values were calculated as a ratio to b-actin.
2.7.
Immunofluorescence staining
The 5-mm-thick slices of rat lung tissues and the paraformaldehyde-fixed A549 cells incubated with 0.1% Triton X-100 (Amresco, Solon, OH) at 100 C for 10 min and at RT for 30 min, respectively. Then, the E-cadherin antibody (1: 100 diluted) was used to immunodetect E-cadherin protein in these samples at 4 C overnight. Thereafter, a Cyanine-3-CTP (Cy3)-labeled secondary antibody (1: 100 diluted; Beyotime) was used to incubate tissue and cell samples for 60 min in the dark. Nuclei of the specimens were stained with 40 ,6diamidino-2-phenylindole (Beyotime) and then viewed under a laser confocal microscopy (BX53; Olympus, Tokyo, Japan).
2.8.
Immunohistochemical staining assay
The 5-mm slices were deparaffinized in xylene, hydrated with graded alcohol, and rinsed with 1% phosphate-buffered saline (HyClone). Then, the slices were incubated in 10 mmol/L citrate buffer (pH 6.0) at 100 C for 10 min to retrieve the antigen and placed in 3% hydrogen peroxide for 15 min at RT to block the endogenous peroxidase activity. After being blocked with goat serum for 30 min, the slices were incubated with primary antibodies against a macrophage marker CD-68 (1: 50 diluted; Santa Cruz Biotechnology, Santa Cruz, CA) at 4 C overnight and with appropriate secondary antibody at 37 C for another 30 min. Immunostaining was then detected with horseradish peroxidaseeconjugated streptavidin (Beyotime), then visualized using 3, 3’-diaminobenzidine, and counterstained with hematoxylin (Solarbio).
2.9.
Statistical analysis
Statistical data in the present study were expressed as mean standard deviation. One-way analysis of variance followed by the Bonferroni post hoc test was used for multiple comparisons using the SPSS version 17.0 (SPSS, Chicago, IL). A P value
