Neuromol Med DOI 10.1007/s12017-014-8335-5

ORIGINAL PAPER

miR26a Modulates Th17/Treg Balance in the EAE Model of Multiple Sclerosis by Targeting IL6 Rongwei Zhang • Ayong Tian • Jun Wang Xueli Shen • Guoxian Qi • Yanqing Tang

•

Received: 28 August 2014 / Accepted: 28 October 2014 Ó Springer Science+Business Media New York 2014

Abstract A number of different microRNAs (miRNAs) have been implicated in various autoimmune diseases, including multiple sclerosis (MS). T helper (Th)17 and regulatory T cells (Tregs) have likewise been implicated as key players in MS, and a functional imbalance of these cell types is increasingly recognized as a key etiological factor in the disease. Although specific panels of transcription factors and cytokines are known to regulate the Th17/Treg balance, the role of noncoding RNAs remains poorly understood. The inflammatory cytokine, interleukin (IL)6, appears to play a critical role in both the development of the Th17 response and the inhibition of Treg functions. In this research, an IL6-associated miRNA, miR26a, was identified, and its normally downregulated expression was shown to be highly correlated with disease severity in patients suffering from MS as well as in C57BL/6 mice with experimental autoimmune encephalomyelitis (EAE; a well-established animal model of human MS). Using the EAE model system, in vivo silencing of miR26a was found to result in increased expression of Th17-related cytokines and increased severity of EAE, while overexpression of miR26a was found to result in reduced expression of Th17related cytokines and a milder form of EAE. By contrast, R. Zhang (&)  X. Shen  G. Qi  Y. Tang Department of Gerontology and Geriatrics, The First Affiliated Hospital of China Medical University, No. 155, Nanjing North Street, Heping District, Shenyang 110001, Liaoning, China e-mail: [email protected] A. Tian Department of Anesthesiology, The First Affiliated Hospital of China Medical University, Shenyang, China J. Wang Department of Neurology, The First Affiliated Hospital of China Medical University, Shenyang, China

Treg cell-specific transcription factor, Foxp3, was found to be positively correlated with miR26a expression. Finally, miR26a was found to downregulate Th17 and to upregulate Treg cell function through its targeting of IL6. Taken together, our data indicate an important role for miR26a in maintaining the Th17 and Treg cell balance in MS that involves repression of IL6 expression. Keywords Multiple sclerosis  Experimental autoimmune encephalomyelitis  miR26a  Th17  Treg  IL6

Introduction Multiple sclerosis (MS) is a chronic inflammatory demyelinating disease of the brain and spinal cord, primarily affecting young adults (Compston and Coles 2008). Dysregulation of the immune system in this neurodegenerative disease is considered to be a fundamental aspect of both initiation and progression. CD4? T cell-mediated autoimmunity is widely regarded as one of the most important aspects of MS pathogenesis, particularly in the early stages of disease initiation (Sospedra and Martin 2005; Pettinelli and McFarlin 1981). More specifically, interferon gamma (IFNc)-producing T helper (Th)1 cells have been characterized as the effector T cells that mediate both MS pathogenesis and also the pathogenesis of its animal model, experimental autoimmune encephalomyelitis (EAE) (Diveu et al. 2008; Windhagen et al. 1995; Lock et al. 2002). However, subsequent studies have indicated that the interleukin (IL)17-producing Th cells (Th17) also contribute to the MS pathogenic mechanism and have suggested that their role may be as critical as that of the Th1 cells (Kebir et al. 2009). Other intriguing findings include demonstrations of mice with fewer Th17 cells being less

123

Neuromol Med

susceptible to EAE (Langrish et al. 2005; Ivanov et al. 2006) and Th17 cells being detected in brain lesions upon autopsy of human MS patients (Tzartos et al. 2008). Another CD4? T cell subset, CD4? CD25? regulatory T cells (Tregs), is a critical regulator of protective autoimmunity and against tissue injury (Sakaguchi 2005). Suggestive evidence for the existence of these Treg cells in humans (Jonuleit et al. 2001) and their role in the regulation of human autoimmune diseases has likewise been found (Baecher-Allan and Hafler 2004; Ehrenstein et al. 2004). Additional analysis of the potential role of this subset of T cells in MS, in particular, has indicated that they are present at a lower frequency in MS patients and are defective with respect to their suppressor functions in vitro (Haas et al. 2005). These studies have suggested a functional antagonism between Th17 and Treg cells, and that there may also exist a dichotomy in their generation, with the differentiation pathway of CD4? naı¨ve T cells depending upon the relative levels of various cytokines that control differentiation of each cell subset. In a complex regulatory nexus, transforming growth factor beta (TGFb) can induce the differentiation of Treg cells from naı¨ve T cells. Mature Treg cells can then regulate peripheral tolerance through the secretion of immunosuppressive cytokines, such as IL10, thereby preventing the onset of autoimmune diseases (Mucida et al. 2007; Chen et al. 2007). However, Treg differentiation is altered in the presence of IL6, which then leads to TGFb production. IL6 and TGFb subsequently induce the differentiation of Treg cells to the Th17 subset. This skewed pattern of differentiation leads to secretion of the proinflammatory cytokine IL17 with autoimmune disease development, but does not promote production of Foxp3? Treg cells or to TGFb production (Oukka 2007). IL-6 and TGF-b are critical in differentiation of Th17 cells by inducing the IL17-specific transcription factors, retinoic acid-related orphan receptor (RORct) (Ivanov et al. 2006). Hence, IL6 blockade could potentially be used to control Th17-mediated immune responses, including responses found in autoimmune diseases (Nishihara et al. 2007). Despite these multiple lines of evidence, the underlying regulatory mechanisms involving the Th17/Treg axis in MS have not been established. Improvements in MS diagnosis, monitoring of disease activity and progression, and evaluation of treatment responses would greatly benefit from the identification of reliable MS biomarkers. However, identification of suitable MS biomarker sets based on peripheral blood is a research area still in its infancy (Bielekova and Martin 2004; Otaegui et al. 2009). Nonetheless, Th17/Treg balance appears to be critically involved in MS pathogenesis (Zhang et al. 2011), and regulators of Th17 differentiation

123

are viewed as having valuable potential for disease diagnosis and treatment. MicroRNAs (miRNA) are small endogenous noncoding regulatory RNAs that can post-transcriptionally repress gene expression. Dysregulation of miRNA expression and function is associated with a variety of human diseases, including cancer and many inflammatory diseases (O’Connell et al. 2010), and alterations in miRNA function can therefore potentially serve as useful diagnostic markers for these pathologies (Lu et al. 2005). The enzyme responsible for regulatory RNA biogenesis, Dicer, is required for lymphocyte function, suggesting a regulatory role for miRNAs in the immune system; miRNAs have been proposed as regulators of immune cell development (Baltimore et al. 2008; Xiao and Rajewsky 2009), as involved in the inflammatory response (O’Connell et al. 2007), and as key players in the pathogenesis of neurodegenerative diseases (Nelson et al. 2008). Recently, much research has focused on determining the properties of expression, regulation, and function of miRNAs in MS, and as a result many miRNAs have been characterized as highly dysregulated in MS patients and in the EAE mouse model. Ma et al. (2014) summarized the upregulated miRNAs and downregulated miRNAs in different samples from MS patients and EAE mice, all of which may play critical roles in MS pathogenesis, and suggested that these miRNAs may represent a signature for MS diagnosis or prognosis. To date, however, the therapeutic potential of differentially regulated miRNAs in MS has only been shown for a few of these miRNAs in studies using the EAE mouse model of MS. Specifically, Murugaiyan et al. (2011a) demonstrated that anti-miR-155 treatment significantly inhibits EAE development, and Du et al. (2009) showed that in vivo silencing of miR-326 significantly inhibits Th17 cells and markedly decreases EAE severity. Another study by Zhu et al. (2012) showed that miR-23b acts to downregulate IL-17, as well as to inhibit the activation of tumor necrosis factor alpha (TNF)a and the IL-1beta-induced nuclear factor kappa-B (NFjB); furthermore, these authors showed that miR-23b affects the downstream target gene transcription related to EAE pathogenesis in the mouse model. Taken together, these results suggest that miRNAs may be a good target for molecular therapy of MS. In the present study, the EAE model was used to demonstrate that miR26a may influence both Th17/T reg balance through translational inhibition of the cytokine IL6—a positive regulator of Th17 differentiation—and that this alteration of regulatory T cell balance may contribute to MS. Ultimately, our data suggest that miR26a may possibly serve as a potentially useful diagnostic marker, prognostic marker, or therapeutic target.

Neuromol Med

Materials and Methods

Pathologic Examination

This study was approved by the ethics committee of China Medical University (Shenyang, Liaoning, P. R. China), and oral and written informed consent was obtained from all study participants. Animal studies were conducted in accordance with the Animal Component of the Research Protocol guidelines at China Medical University.

For histopathological studies, spinal cord tissue was dissected from female mice, fixed in 10 % formalin in phosphate-buffered saline, embedded in a single paraffin block and sectioned. The resulting 6- to 10-lm-thick sections were stained with H&E and luxol fast blue, and subsequently evaluated by optical microscopy for immune cell infiltration and demyelination. For electron microscopy (EM) studies, samples were fixed in 2.5 % glutaraldehyde in phosphate buffer, pH 7.4, post-osmicated and processed routinely for EM. Transverse ultrathin sections (0.1 lm) of brain tissue were examined using an H-600 transmission electron microscope (Hitachi Inc., Tokyo, Japan).

Patient Characteristics All patients in this study, whose disease was clinically defined as being in the RRMS phase, were recruited consecutively from the Department of Neurology in The First Affiliated Hospital of China Medical University (Shenyang, Liaoning, China). Healthy blood donors, with no history of autoimmune diseases and no prior treatment with immunosuppressive agents, were enrolled as the control cohort. Whole blood samples (10 mL) were taken from all participants, after allowing 30 min of acclimatization to room temperature. Mice C57BL/6 (8–10 weeks old) female mice were purchased from Shanghai SLAC Laboratories Animal Co. Ltd. (Shanghai, P. R. China). Mice were housed under a 12-h light/dark cycle in micro-isolator cages contained within a laminar flow system to maintain a pathogen-free environment.

Vector Construction and Lentivirus Production A 200-bp DNA fragment corresponding to pre-miR26a and its flanking sequences was amplified from mouse genomic DNA and was subsequently cloned into pLVTHM lentiviral vector (http://www.addgene.org/Didier_Trono). For miR26a inhibition sequence, cDNA and shRNA for IL6 were cloned into the same lentiviral vector. The production, purification, and titration of lentivirus were performed as described by Tiscornia and colleagues (Tiscornia et al. 2006). The packaged lentiviruses were named LV-26a, LVanti26a, LV-IL6, and LV-shIL6, respectively. The empty (untransformed) lentiviral vector LV-Con served as control. Target cell HEK293 cells were infected by virus according to the user’s manual(Invitrogen, Carlsbad, CA, USA).

Induction of EAE C57BL/6 mice were immunized subcutaneously at two sites on their back (dorsal torso) with 100 mL (200 mg) of myelin oligodendrocyte glycoprotein (MOG35–55) peptide dissolved in distilled water and emulsified with an equal volume of complete Freund’s adjuvant supplemented with 4 mg/mL. Mycobacterium tuberculosis H37Ra. All animals were additionally injected intraperitoneally on days 0 and 2 with 400 ng of Pertussis toxin. Control animals followed an identical immunization protocol but were injected intraperitoneally with Pertussis toxin and subcutaneously with adjuvant without added MOG peptide. Animals were weighed daily and assessed for clinical signs of EAE by two independent observers. A clinical EAE scoring system was used to assess neurological deficits in our mouse EAE model according to the following scale: 0, no disease; 1, loss of weight and tail weakness; 2, weakness in hind limb; 3, complete hind limb paralysis; 4, hind limb paralysis with forelimb weakness or paralysis; and 5, moribund or deceased.

RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR Total RNA was extracted using the Trizol Reagent (Takara Bio Inc., Otsu, Shiga, Japan); cDNA was prepared as recommended (Progema) and used as the template for quantitative PCR. Levels of miR26a and of mRNAs for RORct and Foxp3 transcription factors, and for IL17 and IL6 from all groups were analyzed by real-time PCR, performed according to the manufacturer’s instructions(Takara Bio Inc., Otsu, Shiga, Japan). Specific primers are shown in Table 1. To normalize for differences in the amount of total RNA in each sample, the b-actin gene was used as endogenous control. All values were expressed relative to the expression of b-actin, using the 2DDCt method. Western Blot Analysis Mouse brain tissue samples were homogenized in cold lysis buffer containing protease inhibitors, then centrifuged

123

Neuromol Med Table 1 Primer sets used for real-time PCR in this study Species

Homo

Mus

Gene

Forward 50 –30

Reverse, 50 –30

miR26a

AAGGAGAACCCGTAGATCCG

GTGCAGGGTCCGAGGTATTC

IL17

CAAGACTGAACACCGACTAAG

GTTGGTCTGTTGATCTCTGAG

IL6

AATAACCACCCCTGACCCAAC

CCAGAAGAAGGAATGCCCATT

RORct

CTCAAAGCAGGAGCAATGGAA

AGGGAGTGGGAGAAGTCAAAGA

Foxp3

CGCCACAACCTGAGTCTGC

TGTTCGTCCATCCTCCTTTCC

b-actin

CTTAGTTGCGTTACACCCTTTCTTG

CTGTCACCTTCACCGTTCCAGTTT

miR26a

AAGGAGAACCCGTAGATCCG

GTGCAGGGTCCGAGGTATTC

IL17

CTGTGTCTCTGATGCTGTTGC

GTGGAACGGTTGAGGTAGTCT

IL6

ACTTCCATCCAGTTGCCTTCTT

TCATTTCCACGATTTCCCAGA

RORct

CAGTATGTGGTGGAGTTTGCCAAG

TGTAGGCCCTGCACATTCTGAC

Foxp3 b-actin

CAGCTCTGCTGGCGAAAGTG CTGTGCCCATCTACGAGGGCTAT

TCGTCTGAAGGCAGAGTCAGGA TTTGATGTCACGCACGATTTCC

(12,000g, 10 min, 4 °C). Total protein concentration was measured using the bicinchoninic acid protein assay kit (Pierce Biotechnology, Rockford, IL, USA). Normalized protein was separated by 10 % SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (EMD Millipore Corp., Billerica, MA, USA). The membranes were blocked with 5 % skim milk and incubated with antibodies against IL17 (1:100) and IL6 (1:1,000), followed by horseradish peroxidase (HRP)-labeled secondary antibodies (1:5,000). Signals were detected by enhanced chemiluminescence (Amersham Biosciences Corp., Piscataway, NJ, USA) according to the manufacturer’s instructions. b-actin was employed as protein-loading control.

cells. Luciferase activity was measured 36 h after transduction, using the Dual-Luciferase Reporter Assay System (Promega). Statistical Analysis SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Data were presented as mean ± SD. The two-tailed Student’s t test was used for comparisons of two independent groups. The relationship between IL6 and miR26a expression was assessed by Spearman’s correlation. Statistical significance was defined as p \ 0.05.

Enzyme-Linked Immunosorbent Assay (ELISA)

Results

Cytokine production from human serum and mouse serum and tissue was assessed with IL6 and IL17 ELISA kits (R&D Systems, Shanghai, P. R. China) according to the manufacturer’s instructions. A standard curve was generated using known amounts of the respective purified recombinant cytokines.

miR26a is Downregulated in MS Patients

miRNA Target Validation A 328-bp fragment of the IL6 30 untranslated region (UTR) was amplified by PCR and cloned into the pGLO vector (Promega Corp., Madison, WI, USA), downstream of the firefly luciferase gene. This vector was named wild-type (wt) 30 UTR. Site-directed mutagenesis of the miR26a binding site in IL6 30 UTR was performed using the Gene Tailor Site-Directed Mutagenesis System (Invitrogen, Grand Island, NY, USA) and named mutant (mt) 30 UTR. For reporter assays, wt or mt 30 UTR vector and the control vector pRL-TK (Promega) were co-transduced in HEK293

123

In clinical samples of RRMS patients, it was found that miR26a expression was significantly lower in peripheral blood lymphocytes (PBLs) of patients with RRMS (Fig. 1a) as compared with those of age-matched controls (p \ 0.01). Detailed analysis showed that PBLs from patients with relapsing MS had significantly lower miR26a expression, while PBLs from patients with remitting MS did not (p \ 0.01, Fig. 1a); this suggested a specific association of miR26a expression with relapsing MS. As previously noted, it has been found that CD4? T cells that participate in MS pathogenesis mainly take on the phenotype of Th17 cells or Treg cells, and that IL6 plays a crucial role by regulating the Th17/Treg polarization. In order to determine which CD4? T cell-subset was associated with miR26a downregulation in patients with RRMS, gene expression was determined as follows: expression of RORct (p \ 0.01, Fig. 1b), IL17 (p \ 0.01, Fig. 1c), and

Neuromol Med Fig. 1 MS patients show reduced miR26a expression. a–e Quantitative PCR analysis of mRNA expression of miR26a (a), of the transcription factors RORct and Foxp3 (b), and of the cytokines IL17 and IL6 (c) in PBLs from normal controls (n = 38) or from patients with RRMS (n = 42) and in PBLs from patients with relapsing multiple sclerosis (n = 25) or remitting multiple sclerosis (n = 17). d ELISA analysis of protein expression of the cytokines IL17 and IL6 in PBLs from normal controls (n = 38) or from patients with RRMS and PBLs from patients with relapsing multiple sclerosis (n = 25) or remitting multiple sclerosis (n = 17). e The linear correlation between miR26a and IL6 transcripts in PBLs from MS patients (n = 20) is shown. *p \ 0.05; **p \ 0.01 versus normal controls. #p \ 0.05; ## p \ 0.01 versus remitting multiple sclerosis patients

IL6 (p \ 0.01, Fig. 1c) were found to increase with lower miR26a expression in PBLs of patients with RRMS or patients with relapsing MS. In contrast, the Foxp3 gene (p \ 0.05, Fig. 1b) showed the same pattern with miR26a. Using ELISA, similar results were demonstrated at the protein level in PBLs of patients with either RRMS (p \ 0.05) or relapsing MS (p \ 0.01), for IL17 and IL6 (Fig. 1d). Linear correlation analysis of miR26a and IL6 transcripts in PBLs of patients with RRMS further demonstrated that miR26a expression was inversely correlated with IL6 expression (Fig. 1e). miR26a is Downregulated in EAE Mice To explore the expression of miR26a and its correlation with disease severity in EAE mice, the expression of miR26a and RORct, Foxp3, IL17, and IL6 were determined by quantitative reverse transcriptase PCR (Takara Bio, Inc.) and ELISA at peak acute phase. Brain tissues from EAE mice showed significantly higher expression of

RORct (p \ 0.01, Fig. 2a), IL17 (p \ 0.01, Fig. 2a), and IL6 (p \ 0.01, Fig. 2a) mRNA in the acute phase, but significantly lower expression of miR26a (p \ 0.01, Fig. 2b) and Foxp3 (p \ 0.05, Fig. 2a). Changes in protein expression mirrored that of the mRNAs for IL17 and IL6 (p \ 0.05, Fig. 2c). The findings in patients with RRMS were similar. miR26a Regulates EAE Development Given that the post-transcriptional regulatory function of miRNA has been extensively verified, the potential effects of miR26a on EAE development were investigated through the construction of lentiviral vectors for transformation of EAE mice. Vectors encoding pre-miR26a (LV-26a), its inhibitor (LV-anti 26a), and an empty lentiviral vector (LV-Con) delivered approximately 2 9 107 transforming units of recombinant lentivirus to mice by injection through the tail vein; the efficacy of lentivirus infection was assessed 7 days later by quantitative real-time PCR

123

Neuromol Med

Fig. 2 Downregulation of miR26a in EAE mice. a, b Quantitative PCR analysis of mRNA expression of the transcription factors RORct and Foxp3, of the cytokines IL17 and IL6 (a), and of miR26a (b) in the brain during EAE development (n = 6). c ELISA analysis of the

Fig. 3 miR26a regulation of EAE development. a Quantitative PCR analysis of miR26a mRNA expression in the brains of mice infected with LV-26a or LV-Con (day 7 after lentivirus administration; n = 3). b Clinical scores for EAE in mice infected with lentivirus (n = 9). c Histological evaluation of spinal cords from lentivirusinfected mice (day 19 after immunization; n = 3). d–e Quantification of spinal cord infiltrates (d) and demyelination (e) in the H&Estained paraffin sections, presented as demyelination area relative to total analyzed area (left) and infiltrates per mm2 (right). The boxed areas in the left columns (940) are enlarged on the right (9400). Scale bars 100 lm. f Transmission electron micrograph of brain tissue from lentivirus-infected mice (on day 19 after immunization; n = 3) shows the EAE characteristic vascular endothelial injury and cellular ultrastructure changes (98,000). *p \ 0.05; **p \ 0.01 versus normal controls

123

protein levels of IL17 and IL6 in the brain of EAE mice during the peak phase or in the normal controls. *p \ 0.05; **p \ 0.01 versus normal control

Neuromol Med

Fig. 4 In EAE mice, miR26a regulates the Th17/Treg cells’ balance through inhibition of IL6. a–f Quantitative PCR analysis of mRNA expression of RORct, Foxp3, IL17, and IL6 (a, c, e) and Western blotting analysis of IL17 and IL6 (b, d, f) protein in the brains of lentivirus-infected mice (day 19 after immunization; n = 6). a,

b Mice were immunized with MOG35-55 on day 7 after LV-26a or LV-anti26a virus injection. c, d Mice were immunized with MOG3555 on day 7 after LV-26a or LV-shIL6 virus injection. e, f Mice were immunized with MOG35-55 on day 7 after LV-26a and LV-IL6 virus were co-transfected. *p \ 0.05; **p \ 0.01 versus normal controls

analysis of miR26a expression in the brain of LV-26ainfected mice and LV-Con-infected mice (p \ 0.05, Fig. 3a). Lentivirus-infected mice were immunized with an encephalitogenic peptide of MOG35–55 on day 7 after virus injection. Relative to LV-con-infected mice, LV-26ainfected mice exhibited somewhat mild EAE, whereas LVanti26a-infected mice developed severe EAE (Fig. 3b). Histological analysis of spinal cord sections also showed that LV-26a-infected mice exhibited mild central nervous system pathology (p \ 0.05), whereas LV-anti26a-infected mice developed prominent inflammatory infiltration (p \ 0.01, Fig. 3c, d) and demyelination (Fig. 3c, e). Transmission EM revealed the obvious disappearance of mitochondrial cristae and obscuring of tight junctions of vascular endothelial cells in brain tissues of LV-anti26ainfected mice (Fig. 3f), demonstrating that miR26a is a critical factor in the development of EAE.

miR26a Regulation of the Balance of Th17 and Treg Cell Subsets is Dependent on the Inhibition of IL6 Expression in EAE Mice Through use of the TargetScan database (www.targetscan. org), it was predicted that miR26a has target sites in the 30 UTR of the IL6 mRNA. By examining the expression of Th17- and Treg-related cytokines IL17, IL6 and their transcription factors RORct and Foxp3 in the brain of lentivirus-infected EAE mice, it was further determined whether miR26 and IL6 affected the balance of Th17 and Treg subsets in EAE mice. The expression of Th17- and Treg-related cytokines IL17, IL6 and their transcription factors RORct and Foxp3 were examined in the brain of lentivirus-infected EAE mice, with results indicating that, relative to their expression in LV-Con-infected mice, the expression of genes for RORct (p \ 0.05, Fig. 4a), IL17

123

Neuromol Med

(p \ 0.05, Fig. 4a), and IL6 (p \ 0.05, Fig. 4a) was significantly downregulated in LV-26a-infected mice and upregulated in LV-anti26a-infected mice, whereas an inverse result was found for the Foxp3 gene (p \ 0.05, Fig. 4a) in LV-26a- and LV-anti26a-infected mice. Likewise, the protein levels of IL17 (p \ 0.05, Fig. 4b) and IL6 (p \ 0.05, Fig. 4b) in the three groups of lentivirus-infected mice mirrored the results for their mRNAs. In order to elucidate whether the balance of Th17 and Treg subsets was mediated by miR26a’s inhibition of IL6 expression in the brain of EAE mice, gain-of-function and loss-of-function studies were performed. First, IL6 was silenced in order to investigate whether reducing the expression of IL6 could mimic the effect of miR26a. After EAE mice were infected with either LV-shIL6 or LV-26a, gene expression levels of RORct, Foxp3, IL17, and IL6 were examined. As shown in Fig. 4 c through d, IL6 knockdown led to the downregulation of RORct (p \ 0.05, Fig. 4c), IL17 (Fig. 4c, p \ 0.05, and d, p \ 0.01), and IL6 (p \ 0.01, Fig. 4c, d) and to the upregulation of Foxp3 (p \ 0.05, Fig. 4c), results that were similar to those found by using miR26a. Subsequently, in order to evaluate whether IL6 overexpression could inhibit the effect of miR26a on RORct, IL17, and Foxp3, EAE mice were coinfected with LV-26a and LV-IL6 encoding the full-length IL6 coding sequence but without the 30 UTR. Results showed that IL6 overexpression led to significant suppression of the miR26a-induced downregulation of RORct (p \ 0.05, Fig. 4e), IL17 (p \ 0.05, Fig. 4e, f), and IL6 (Fig. 4 e, p \ 0.05 and f, p \ 0.01) and to the upregulation of Foxp3 (p \ 0.05, Fig. 4e).

IL6 is a Direct Target of miR26a in HEK293 Cells In order to support our data suggesting that the miR26a level may be inversely associated with IL6 level in EAE mice, a luciferase reporter assay was performed to determine whether miR26a could directly target the 30 UTR of IL6 mRNA in HEK293 cells. Either the wt target sequence of IL6 30 UTR (wt 30 UTR) or the mutant sequence (mt 30 UTR) were cloned into a luciferase reporter vector (Fig. 5a), and subsequently used to transfect HEK293 cells, which received miR26a mimic and either wt or mt 30 UTR vector. A significant decrease of luciferase activity was found when compared with the miR control (p \ 0.05, Fig. 5b). The activity of the mt 30 UTR vector was unaffected by a simultaneous transfection with miR26a (p \ 0.05, Fig. 5b). Moreover, co-transfection with antimiR26a and wt 30 UTR vector in HEK293 cells led to a two-fold increase of luciferase activity (p \ 0.05, Fig. 5c). Taken together, these results strongly suggest that IL6 is a direct target of miR26a in HEK293 cells.

123

Fig. 5 IL6 is a direct target of miR26a in HEK293 cells. a Diagram of the IL6 30 UTR—containing reporter constructs. b-c Luciferase activity assay of HEK293 cells at 36 h after co-transfection with miR26a (b) or miR26a inhibitor (c) and pGLO-IL6-30 UTR or pGLOIL6-30 UTR mutant. *p \ 0.05; **p \ 0.01 versus normal controls

Discussion Th17/Treg balance is critically involved in the pathogenesis of MS and regulators of Th17 differentiation represent promising targets of clinical diagnostic or treatment methods. Here, we report the demonstration of miR26a as a critical contributing factor to the pathogenesis of MS and its mechanism involving regulation of the Th17/Treg balance. Specifically, we showed that miR26a expression in PBLs is well correlated with disease in patients with relapsing MS and that its inhibition substantially aggravates disease severity in the EAE model. Finally, we demonstrated that miR26a targeting of IL6, a known positive regulator of Th17 differentiation, leads to inhibition of Th17 cell generation in vivo, and that this event can be reversed by the reintroduction of an IL6 gene engineered to be resistant to miR26a suppression. Collectively, our data suggest that miR26a is a MSassociated miRNA, and in contrast to research results previously cited, our data have provided multiple lines of evidence for this finding. miR26a appears to be centrally involved in the pathogenesis of MS and EAE by targeting the cytokine IL6. Our data show that miR26a expression in PBLs is inversely correlated with the disease state in patients with relapsing MS, and also that its overexpression substantially ameliorated disease severity in the EAE model of MS. Moreover, our data strongly confirm that by targeting IL6, a known positive regulator of Th17 cells, miR26a inhibited the generation of Th17 and instead,

Neuromol Med

promoted the generation of Treg in vivo, with this outcome reversed by the re-introduction of an IL6 gene construct designed to be resistant to miR26a suppression. Several studies published in recent years have described investigations into the role of miRNAs in MS (Otaegui et al. 2009; Murugaiyan et al. 2011b; Du et al. 2009; Junker et al. 2009a; Keller et al. 2009; Lindberg et al. 2010; Cox et al. 2010). In particular, the research conducted by Otagui et al. (2009) focused on miRNA upregulation in peripheral blood mononuclear cells (PBMCs) during MS relapse in patients; however, the study population was too small to ensure that results reached statistical significance. However, Keller et al. (2009) examined 20 relapsing-remitting multiple sclerosis (RRMS) patients during treatment and identified a number of miRNAs that were up- or downregulated, providing more indication for the potential of these molecules as contributing to the condition. Du et al. (2009) chose to study a Chinese population and identified miR-326 as a major determinant of the MS disease but not of another common autoimmune disease, neuromyelitis optica (classified as an MS-like illness). The study of MS patients conducted by Cox et al. (2010) identified miR-17 and miR-20a as inhibitors of T cell activation genes, which were demonstrated as under-expressed patient whole blood samples. In an earlier study of MS patients, miR-15a was shown to be upregulated in active brain white matter lesions obtained from patients with MS (Junker et al. 2009), but a related study carried out at a later date showed this miRNA to be downregulated in CD4? T cells from peripheral blood samples of RRMS patients (Lorenzi et al. 2012). The collective findings from these various studies involving patients of different ethnicities and with various MS disease conditions suggest that regulation of miRNA expression in MS is complicated. The results in the current study did not absolutely agree with those from previous studies. For example, Honardoost et al. (2014) showed that a high level of miR-26a expression in PBMCs was associated with RRMS and that a decreased level of miR26a expression in PBLs was associated with relapse (compared to the remitting phase or healthy individuals) in our current study, and the miR26a expression level was also lower in all MS patients (compared to the healthy group), including those in remission or experiencing relapse. These difference in findings between studies may be due to either different samples from relapsing phase patients, which may influence miR26a gene expression or limited number of clinical subjects. It is also possible that the different findings are related to the heterogeneity that exists among the miR26 family members (such as miR26a1, miR26a2 and miR26b, which are coded by different genome loci); focused comparison studies are needed to confirm the distinctive and similar functions of each of these family members in MS, and it

would be crucial to develop the above study in large case– control samples. The tissue- and time-dependent expression profiles of miRNAs are known to influence protein translation during distinct cellular processes. For example, studies of liver cancer and lymphoma have shown disease-related downregulation of miR-26a and other studies have shown that ectopic expression of miR-26a can suppress cell proliferation (Kota et al. 2009; Sander et al. 2008; Ji et al. 2009). However, in glioblastomas and gliomas, miR-26a expression was found to be amplified and was shown to promote cell growth (Huse et al. 2009; Kim et al. 2010). These controversial results suggested that miR-26a may have a tumor-specific function and/or be highly dependent upon its targets in cancer cells; indeed, in general, aberrant expression of miRNAs and their target genes can affect different biological signals with diverse functions (Ambros 2004). As reported previously, maintaining Th17/Treg balance is involved in the pathogenesis of MS. Our results suggest that miR26a is a IL6-associated miRNA and is therefore an indirect regulator of the Th17/Treg cells balance in both MS patients and EAE mice. The analysis of IL6-deficient animals also points to an important role for IL6 in the differentiation of Th17 cells because these animals are resistant to the development of EAE and do not develop a competent Th17 cell response (Bettelli et al. 2006). Therefore, under inflammatory conditions, the IL6 cytokine may act to promote the differentiation of Th17 cells, thereby further influencing the Th17/Treg balance in vivo. Our study has shown that the level of miR26a is dramatically decreased in relapsing MS patients. Moreover, miR26a level was found to have a significant inverse correlation with the level of IL6 mRNA, as shown in both MS patients and EAE mice. It was also found that the features of milder disease severity and of greater downregulation of RORct and IL17 or of upregulated Foxp3 expression in LV-26a-transducted mice were largely reversed by coinfection of these mice with LV expressing IL6 with a mutated 30 UTR. These findings indicate that IL6 acts as a key target of miR26a to regulate Th17/Treg balance, at least during the development of EAE and MS. In conclusion, miR26a may exert its functions in MS patients and EAE mice to elicit protective effects, acting at least partly through repression of IL6 expression. Because of the stable expression of miR26a and its easy detection in blood samples from MS patients, our results suggest that this miRNA has potential clinical value as a biomarker for MS diagnosis and/or prognosis, or to evaluate response to drug treatment. Additionally, given that miR26a is downregulated in MS patients, it is conceivable that reintroduction of this mature miRNA into target tissues could

123

Neuromol Med

represent an effective and safe therapeutic strategy to reduce the expression of targeted genes using a natural mechanism; miR26a may therefore be poised to serve as a new and valuable target for clinical applications in MS patients. Acknowledgments The work was supported by grants from the National Natural Science Foundation of China (No. 81100889), the Liaoning Province Scientific Research Foundation for Doctors, China (No. 20111106), and the Liaoning Province Nature Science Foundation, China (No. 2012225021-73). Conflict of interest of interests.

The authors declare that they have no conflict

References Ambros, V. (2004). The functions of animal microRNAs. Nature, 431, 350–355. Baecher-Allan, C., & Hafler, D. A. (2004). Suppressor T cells in human diseases. The Journal of Experimental Medicine, 200, 273–276. Baltimore, D., Boldin, M. P., O’Connell, R. M., Rao, D. S., & Taganov, K. D. (2008). MicroRNAs: New regulators of immune cell development and function. Nature Immunology, 9, 839–845. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T. B., Oukka, M., et al. (2006). Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature, 441, 235–238. Bielekova, B., & Martin, R. (2004). Development of biomarkers in multiple sclerosis. Brain, 127, 1463–1478. Chen, X., Howard, O. M., & Oppenheim, J. J. (2007). Pertussis toxin by inducing IL6 promotes the generation of IL17-producing CD4 cells. The Journal of Immunology, 178, 6123–6129. Compston, A., & Coles, A. (2008). Multiple sclerosis. Lancet, 372, 1502–1517. Cox, M. B., Cairns, M. J., Gandhi, K. S., Carroll, A. P., Moscovis, S., Stewart, G., et al. (2010). ANZgene Multiple Sclerosis Genetics Consortium. MicroRNAs miR-17 and miR-20a inhibit T cell activation genes and are under-expressed in MS whole blood. PLoS ONE, 5, e12132. Diveu, C., McGeachy, M. J., & Cua, D. J. (2008). Cytokines that regulate autoimmunity. Current Opinion in Immunology, 20, 663–668. Du, C., Liu, C., Kang, J., Zhao, G., Ye, Z., & Huang, S. (2009). MicroRNA miR-326 regulates TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis. Nature Immunology, 10, 1252–1259. Ehrenstein, M. R., Evans, J. G., Singh, A., Moore, S., Warnes, G., Isenberg, D. A., et al. (2004). Compromised function of regulatory T cells in rheumatoid arthritis and reversal by antiTNFalpha therapy. The Journal of Experimental Medicine, 200, 277–285. Haas, J., Hug, A., Vieho¨ver, A., Fritzsching, B., Falk, C. S., Filser, A., et al. (2005). Reduced suppressive effect of CD4 ? CD25high regulatory T cells on the T cell immune response against myelin oligodendrocyte glycoprotein in patients with multiple sclerosis. European Journal of Immunology, 35, 3343–3352. Honardoost, M. A., Kiani-Esfahani, A., Ghaedi, K., Etemadifar, M., & Salehi, M. (2014). miR-326 and miR-26a, two potential markers for diagnosis of relapse and remission phases in patient with relapsing–remitting multiple sclerosis. Gene, 544, 128–133.

123

Huse, J. T., Brennan, C., Hambardzumyan, D., Wee, B., Pena, J., Rouhanifard, S. H., et al. (2009). The PTEN-regulating microRNA miR-26a is amplified in high-grade glioma and facilitates gliomagenesis in vivo. Genes & Development, 23, 1327–1337. Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., Lafaille, J. J., et al. (2006). The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL17 ? T helper cells. Cell, 126, 1121–1133. Ji, J., Shi, J., Budhu, A., Yu, Z., Forgues, M., Roessler, S., et al. (2009). MicroRNA expression, survival, and response to interferon in liver cancer. New England Journal of Medicine, 361, 1437–1447. Jonuleit, H., Schmitt, E., Stassen, M., Tuettenberg, A., Knop, J., & Enk, A. H. (2001). Identification and functional characterization of human CD4(?)CD25(?) T cells with regulatory properties isolated from peripheral blood. The Journal of Experimental Medicine, 193, 1285–1294. Junker, A., Krumbholz, M., Eisele, S., Mohan, H., Augstein, F., Bittner, R., et al. (2009a). MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain, 132, 3342–3352. Junker, A., Krumbholz, M., Eisele, S., Mohan, H., Augstein, F., Bittner, R., et al. (2009b). MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain, 132, 3342–3352. Kebir, H., Ifergan, I., Alvarez, J. I., Bernard, M., Poirier, J., Arbour, N., et al. (2009). Preferential recruitment of interferon-gammaexpressing TH17 cells in multiple sclerosis. Annals of Neurology, 66, 390–402. Keller, A., Leidinger, P., Lange, J., Borries, A., Schroers, H., Scheffler, M., et al. (2009). Multiple sclerosis: microRNA expression profiles accurately differentiate patients with relapsing-remitting disease from healthy controls. PLoS ONE, 4, e7440. Kim, H., Huang, W., Jiang, X., Pennicooke, B., Park, P. J., & Johnson, M. D. (2010). Integrative genome analysis reveals an oncomir/oncogene cluster regulating glioblastoma survivorship. Proceedings of the National Academy of Sciences, 107, 2183–2188. Kota, J., Chivukula, R. R., O’Donnell, K. A., Wentzel, E. A., Montgomery, C. L., Hwang, H. W., et al. (2009). Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell, 37, 1005–1017. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., Sedgwick, J. D., et al. (2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. The Journal of Experimental Medicine, 201, 233–240. Lindberg, R. L., Hoffmann, F., Mehling, M., Kuhle, J., & Kappos, L. (2010). Altered expression of miR-17-5p in CD4 ? lymphocytes of relapsing-remitting multiple sclerosis patients. European Journal of Immunology, 40, 888–898. Lock, C., Hermans, G., Pedotti, R., Brendolan, A., Schadt, E., Garren, H., et al. (2002). Gene-microarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis. Nature Medicine, 8, 500–508. Lorenzi, J. C., Brum, D. G., Zanette, D. L., de Paula Alves Souza, A., Barbuzano, F. G., Dos Santos, A. C., et al. (2012). miR-15a and 16-1 are downregulated in CD4 ? T cells of multiple sclerosis relapsing patients. International Journal of Neuroscience, 122, 466–471. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., et al. (2005). MicroRNA expression profiles classify human cancers. Nature, 435, 834–838. Ma, X. T., Zhou, J., Zhong, Y., Jiang, L. I., Mu, P., Li, Y., et al. (2014). Expression, Regulation and Function of MicroRNAs in

Neuromol Med Multiple Sclerosis. International Journal of Medical Sciences, 11, 810–818. Mucida, D., Park, Y., Kim, G., Turovskaya, O., Scott, I., Kronenberg, M., et al. (2007). Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science, 317, 256–260. Murugaiyan, G., Beynon, V., Mittal, A., Joller, N., & Weiner, H. L. (2011a). Silencing microRNA-155 ameliorates experimental autoimmune encephalomyelitis. The Journal of Immunology, 187, 2213–2221. Murugaiyan, G., Beynon, V., Mittal, A., Joller, N., & Weiner, H. L. (2011b). Silencing microRNA-155 ameliorates experimental autoimmune encephalomyelitis. The Journal of Immunology, 187, 2213–2221. Nelson, P. T., Wang, W. X., & Rajeev, B. W. (2008). MicroRNAs (miRNAs) in neurodegenerative diseases. Brain Pathology, 18, 130–138. Nishihara, M., Ogura, H., Ueda, N., Tsuruoka, M., Kitabayashi, C., Tsuji, F., et al. (2007). IL6–gp130–STAT3 in T cells directs the development of IL17 ? Th with a minimum effect on that of Treg in the steady state. International Immunology, 19, 695–702. O’Connell, R. M., Taganov, K. D., Boldin, M. P., Cheng, G., & Baltimore, D. (2007). MicroRNA-155 is induced during the macrophage inflammatory response. Proceedings of the National Academy of Sciences, 104, 1604–1609. O’Connell, R. M., Rao, D. S., Chaudhuri, A. A., & Baltimore, D. (2010). Physiological and pathological roles for microRNAs in the immune system. Nature Reviews Immunology, 10, 111–122. Otaegui, D., Baranzini, S. E., Arman˜anzas, R., Calvo, B., Mun˜ozCulla, M., Khankhanian, P., et al. (2009). Differential micro RNA expression in PBMC from multiple sclerosis patients. PLoS ONE, 4, e6309. Oukka, M. (2007). Interplay between pathogenic Th17 and regulatory T cells. Annals of the Rheumatic Diseases, 66(Suppl. 3), iii87– iii90. Pettinelli, C. B., & McFarlin, D. E. (1981). Adoptive transfer of experimental allergic encephalomyelitis in SJL/J mice after

in vitro activation of lymph node cells by myelin basic protein: Requirement for Lyt1 ? 2-T lymphocytes. The Journal of Immunology, 127, 1420–1423. Sakaguchi, S. (2005). Naturally arising Foxp3-expressing CD25 ? CD4 ? regulatory T cells in immunological tolerance to self and non-self. Nature Immunology, 6, 345–352. Sander, S., Bullinger, L., Klapproth, K., Fiedler, K., Kestler, H. A., Barth, T. F., et al. (2008). MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood, 112, 4202–4212. Sospedra, M., & Martin, R. (2005). Immunology of multiple sclerosis. Annual Review of Immunology, 23, 683–747. Tiscornia, G., Singer, O., & Verma, I. M. (2006). Production and purification of lentiviral vectors. Nature Protocols, 1, 241–245. Tzartos, J. S., Friese, M. A., Craner, M. J., Palace, J., Newcombe, J., Esiri, M. M., et al. (2008). Interleukin-17 production in central nervous system-infiltrating T cells and glial cells is associated with active disease in multiple sclerosis. The American Journal of Pathology, 172, 146–155. Windhagen, A., Newcombe, J., Dangond, F., Strand, C., Woodroofe, M. N., Cuzner, M. L., et al. (1995). Expression of costimulatory molecules B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions. The Journal of Experimental Medicine, 182, 1985–1996. Xiao, C., & Rajewsky, K. (2009). MicroRNA control in the immune system: Basic principles. Cell, 136, 26–36. Zhang, R., Tian, A., Zhang, H., Zhou, Z., Yu, H., & Chen, L. (2011). Amelioration of experimental autoimmune encephalomyelitis by b-elemene treatment is associated with Th17 and Treg cell balance. Journal of Molecular Neuroscience, 44, 31–40. Zhu, S., Pan, W., Song, X., Liu, Y., Shao, X. R., Tang, Y. J., et al. (2012). The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB 2, TAB 3 and IKKalpha. Nature Medicine, 18, 1077–1086.

123