Gene, 110 (1992) 251-256 © 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/92/$05.00
251
GENE 06231
Synthesis of the biologically active ~-subunit of human nerve growth factor in E s c h e r i c h i a c o l i (Recombinant DNA; plasmid expression vector; phage 2 PR and PL promoters; immunological cross-reactivity; homodimer; dorsal root ganglion; neurite outgrowth)
Alessandro Negro a, Irene Martini a, Emilio Bigon a, Flavia Cazzola a, Cristina Minozzi b, Stephen D. Skaper b and Lanfranco Callegaroa aAdvanced Technology Division, and bFidia Research Laboratories. 35031 Abano Terme, PD (Italy) Received by H.M. Krisch: 30 July 1990 Revised/Accepted: 1 August/5 August 1991 Received at publishers: 21 October 1991
SUMMARY
The gene (NGFB) encoding the fl subunit of mature human nerve growth factor (hNGFB) was subcloned into the pJLA503 expression vector under the control of bacteriophage promoters PR and PL, and expressed in Escherichia coll. The recombinant protein represented approximately 3 ~o of the total cellular protein. Biologically active hNGFB was solubilized (0.2 total NGFB) and purified by cation-exchange chromatography and it yielded two bands on polyacrylamide-gel electrophoresis under nonreducing conditions, corresponding to the monomeric (14 kDa) and homodimeric (26.5 kDa) forms of the molecule. Both hNGFB forms were immunopositive on Western blots with rabbit anti-NGFB antibodies; however, following additional purification, only the species corresponding to the hNGFB homodimer was biologically active on cultured chicken dorsal root ganglion neurons. These results demonstrate the feasibility of synthesizing the biologically active form of hNGFB in E. coll.
INTRODUCTION
Nerve growth factor was originally identified by Ham= burger and Levi-Montalcini (1949), in their seminal work on the chicken DRG. The NGF appears to be a modulaCorrespondence to: Dr. A. Negro at his present address, Advanced Technology Division, Fidia S.p.A., Via Ponte della Fabbrica 3/A, 35031 Abano Terme, PD (Italy) Tel. (39-49)8232523; Fax (39-49)810653.
Abbreviations: aa, amino acid(s); Ap, ampicillin; BSA, bovine serum albumin; bp, base pair(s); DRG, dorsal root ganglion; hNGFB, human NGFB; IgG, immunoglobulinG; kb, kilobase(s) or I000 bp; LB, LuriaBertani (medium); mNGFB, mouse NGFB; NGF, nerve growth factor; NGFB, {3subunit (or 2.5S form) of NGF; NGFB, gene encoding NGFB; nt, nucleotide(s);oligo,oligodeoxyribonucleotide;PAGE, polyacrylamidegel electrophoresis; PBS, phosphate-buffered saline (8 mM Na2HPO4/ 1.47 mM KH2PO4/136 mM NaCI/2.7 mM KCI pH 7.5), vLand pg, phage leftward and rightward early major promoters, respectively; rehNGFB, recombinant hNGFB; SDS, sodium dodecyl sulfate; [ ], denotes plasmid-carrier state.
tor of neuronal development and of normal, developmental cell death. Its presently known trophic targets are the peripheral sympathetic neurons (Levi-Montalcini, 1966), neural crestodedved sensory neurons (Hamburger et al., 1981), and cholinergic neurons of the basal forebrain (Dreyfus, 1989). Chemically, much of our knowledge of NGF is based on studies using the protein extracted from adult male mouse submaxillary glands (Cohen, 1960). The complete NGF molecule (140 kDa, sedimentation coefficient of 7S), is composed of 0¢,p and ~,subunits. However, neuronotrophic activity resides exclusively with the fl subunit (NGFB) of approx. 26.5 kDa and a sedimentation coefficient of 2.5S. NGFB is a noncovalent homodimer (Bradshaw, 1978)" monomers consist of 118 aa with six Cys residues and three intrachain disulfide bridges (Angeletti and Bradshaw, 1971). Large quantities of NGF are found in exocrine glands, such as the prostate and its secretions, in certain animal species and in some snake venoms. It also occurs in lim-
252 ited quantities in human sources such as placenta and semen (Goldstein et al., 1978; C ~ e g a r o et at., 1990a) from which extraction is cumbersome and time-consuming. The human N G F B gene was isolated from a genomic library using m N G F B as a probe (UUrich et al., 1983). Transcription of the N G F B gene produces at least four different m R N A s and results in the formation of a precursor of 241 aa or more. This p r e p r o N G F is cleaved at dibasic residues Arg-Arg and Arg-Lys at the N- and C-terminals of the peptide, respectively, to generate the mature molecule (Edwards et at., 1988). In order to study the structure/ function and level of activity of the human molecule, we have expressed mature h N G F B in E. coll. The/~-subunit was isolated and its neuronotrophic activity confirmed.
htpR-lon mutant). The highest level of expression was ob-
tained in the CAG629 host. After induction, samples of the bacterial lysate were boiled at 100°C for I min in the presence of/~-mercaptoethanol. S D S - u r e a - P A G E showed a weak band of approx. 14 kDa. This band reacted strongly with polyclonal rabbit a n t i - m N G F B antibodies (Fig. 2). Evidence for cross-reactivity of h N G F B against rabbit polyclonal anti-mNGFB (Perez-Polo et al., 1983; Walker et al., 1980) has, until now, been equivocal. The present demonstration of cross-reactivity is in accord with that of Warren et al. (1980). Using the same antibody to evaluate r e h N G F B in another E. coil strain, we observed crossreactivity with h N G F B partially purified from placenta. These results, while eliminating doubts about crossreactivity between mouse and h u m a n N G F B s , do not clar-
EXPERIMENTAL AND DISCUSSION
A
(a) Expression of human reNGFB The expression of r e h N G F B by p J L A N G F (see Fig. 1) was evaluated for maximum protein yield in three strains of E. coli: HB101, 71/18 (which carries constitutively expressed gene clts857), and CAG629 (which is a double
B
C
A
B
43.0
-
t
k I
30.0
-
~-.
. . . .
~
Nde I
,
~ q
•
7"
*.
-"
I
f c o RI
5'-- TCCA[TATGTCATCATCCCATCCCATC T TCCACAGGGGCGIAAT illl ,~11 l] III III I I I I i I I I I I I I I I I I I I I I i i I !I,
C
kDa
TCTC .;,~
--3'
20.0
•
14.4
Y
_
SDS - P A G E
W E STER N BLOT
Fig. 1. Structureof the expressionvector pJLANGF. The gene encoding mature hNGFB was obtained from the pBBG26 plasmid (British Biotechnology Ltd., Oxford, U.K.). Two C-terminalcodons for Arg~t9 and Ala~2°were deleted from this sequence. The sequence was inserted into a pJLA503 (Schauder et at., 1987) expression vector downstream from the p~. and PR promoters. The restriction site Ndel was engineeredat the ATG start codon, Two complementaryoligoswere then annealed to form a double-stranded DNA as follows. The NdeI-EcoRl oligo was ligated with the EcoRl-BarnHI fragment from pBBG26 into Ndel + BamHI-cut pJLAS03.The resultingplasmid,containinghNGF sequences,was termed pJLANGF. Expression was regulated by the ~ phage thermosensitive repressor encoded by the clts857 gene and the PLO, and PRORpromoters/ operators. The double-stranded oligos Ndel-EcoRl are specifiedon the top; fd, transcriptionalterminator of fd bacteriophage.
Fig. 2. SDS-urea-PAGE (SDS-PAGE) and Western blot (WESTERN BLOT) of the expression products. E. coil strain 71/18 was transformed and induced to produce the recombinant protein. Single colonies were amplifiedin LB broth containing 50 lag Ap/ml at 28°C. The saturated culture, diluted h 100 in this medium was thermallyinduced at 42°C for 3 h. The bacterial cells from 10 lal of culture were dissolved in sample buffer,boiled for I min,electrophoresedin 0.1 ~ SDS/15% PAGE/0.5 M urea in the presence of 0.7 M 13-mercaptoethanol, and stained by Coomassie brilliant blue. Western blotting was performed for 16 h on nitrocellulose filter at 0.2 mA, equilibrated in 25raM Tris/192mM glycine/20% methanol/0.1% SDS, pH 8.3. The filterwas incubated with affinity-purifiedrabbit polyclonalantibodies (2.5 lag per ml in PBS/0.1% BSA) to mNGFB (Callegaroet at., 1990b)for 2 h at room temperature. Nitrocellulose sheets were saturated with 5% BSA in PBS for 30 rain, Proteins were visualizedwith goat anti-rabbit IgG secondary antibodies, and developed with Auroprobe Immunogold Silver Stain (Janssen). Lanes: A, 2 lag of purified mNGFB from submaxillaryglands (Mobley et at., 1976); B, total protein extract from E. col[ [pJLANGF], C, total protein extract from E, coli [pJLA503].
253 InducedE coil
2.Ot~
a
1
Centrifugatlon (9000 x g; 20rain) wash 3 time with PBS
I
pH9.0
C "lu
prig.0
m
D
÷
E F
I
~ Supernatant (discard)
Pellet
o 1.O1
m el
LySISin 50mM Naoacetate buffer (pit 4)/0.4M NaCI Gauiln Press (800 psi) Centrlfugatlon (800 x g; 15min)
1
Supernatant
0.O
I
40
80 Fractions
b Pellet
SDS - PAGE
k~
q4.0
120 WESTERN BLOT
-
CM52 cellulose
Solubilizatlon in 6M guanldinlum/100mM Na*acetate (pH 4)
NGF dimer
Dialysis against IM urea
1
6?.0. 43.0 -
~ mmm
SP S e p l ~ l ~ c-25
1
NGF monomer
30.0-.
q
2O.OD 14.4- ~ ~ oQb~
'
"'
Fig. 3. Flow diagram for NGFB isolation described in Figs. 4 and 6.
A ify structural homologies between the two NGFB species. The monomeric form of rehNGFB extracted under reducing conditions from the insoluble cell pellet represented about 3 % of the total protein. Although higher levels have been reported for other proteins in this expression system (Schauder et al., 1987), accumulation of rehNGFB was 30 times that reported for mNGFB in E. cog, expressed as a percent with respect to total cell protein in the pellet (Hu and Neet, 1988). Such differences may be related to the relative structural stability of the mRNAs (Zucker and Stiegler, 1981). As shown in the SDS-urea-PAGE in Fig. 2, mNGFB typically consists of two closely spaced bands at approx. 14 and 14.4 kDa: the complete NGFB monomer sequence and the polypeptide cleaved at the Met 9 residue [des(I-8) NGFB, which lacks the first eight N-terminal aa; Mobley et al., 1976]. The rehNGFB does not contain a M e t 9 and is, therefore, not cleaved. In addition, the Mr of the hNGFB appears slightly greater than that of mNGFB. This size difference is presumably due to differences in electrophoretic behaviour and not to the Met residue. (b) Partial purification of the rehNGFB protein Because the level of production of rehNGFB was low, induction was scaled up and the biologically active protein
B
C
D
E
F mNGF F mNGF
Fig. 4. Chromatography (map a) and SDS-PAGE analysis (panel b) of the soluble fraction of E. coli[pJLANGF] strain CAG629, The soluble protein fraction from E. cog was obtained after breaking the cells with a Gaulin press at 800 psi in 0.4 M NaCI/50 mM acetic acid (pH 4.0). After centrifugation at 800 x g this material was applied to a CM52 cellulose column (5 x 20 cm) in 0.4 M NaCI/50 mM Na.acetate (pH 4.0), the column was washed with 50 mM Na,acetate without NaCI and the pH increased to 9.0 by 50 mM Tris. HCI and the recombinant protein recovered at 0.4 M NaCI. Fractions marked B-F eluting from the column were subjected to 0.1% SDS/15% PAGE and Western blotting (panel b). The gel was run without ~-mercaptoethanol and silver-stained. Western blotting was performed as in Fig. 2, using the same rabbit polyclonal antibodies. Lanes: A, soluble fraction (see 'Supernatant' Fig. 3 lefthand branch) in 100 mM Na.acetate buffer (pH 4.0) (not shown in map a); B, unbound fraction; C, shoulder from fraction B; D, fraction eluting at pH 9.0; E, elute at 0.4 M NaCI, pH 9.0 (first peak); F, elute at 0.4 M NaCI, pH 9.0 (second peak); mNGF, 2 ~g mNGF purified from submaxillary
gland.
purified as follows. A 200 ml culture of E. cog CAG629 containing the pJLANGF plasmid was grown at 28°C overnight, then added to 121 of medium with vigorous agitation. When the absorbance (590 nm) reached 0.4, the temperature was shifted to 42 °C for 30 rain and the cells were grown for 3 h at 41 ° C. The ceils were then centrifuged (9000 x g, 20 min) and washed three times with PBS, and the final pellet lysed in 50 mM Na.acetate (pH 4.0)/0.4 M NaCI using a Gaulin press (800 psi). The supernatant (800 x g, 15 min) thus obtained, was seen to contain, by
254
Fig, 5, Biologicalassay for NGF (purified from the soluble fraction of E, coil [pJLANGF] strain CAG629). Bioassay for NGF activitywas carried out as previouslydescribed (Skaper and Varon, 1986)usingmicroculturesof DR(:; neurons from day 8 chicken embryos. (Panel A): DRG neurons without addition of NGF after 24 h. (Panel B): DRG neurons 24 h after addition of partially purified rehNGFB (10 ng/ml). Similarresults were obtained with 1-10 ng mNGFB/mi. means of immunoblotting, an estimated 0.2~o of the total rehNGFB from the pellet. This soluble fraction was chromatographed on a CM-52 cation exchange column, as described for mNGFB (Mobley et al., 1976). The eluent was pooled, dialyzed against 50ram Na.acetate (pH 4.5)/ 0.15 M NaCI, divided into aliquots and stored at -80°C. A flow diagram summarizing these procedures is given in Fig. 3.
Analysis of the protein fractions (Fig. 4a) by a nonreducing S D S - P A G E , followed by Western-blot analysis yielded only a s!,ngle immunoreactive band at approx. 26.5 kDa with anti-mNGFB affinity-purified polyclonal antibodies, corresponding to the Mr of the dimefic form of hNGFB (Fig. 4b). However, no band at 26 kDa was visible in the silverstained 0.1% SDS-15% PAGE gel. We have estimated by comparative immunoblotting that about
255 that formation of the dimeric form of rehNGFB may have been compromised by an altered folding of the recombinant DNA-derived product. Other methods for solubilization of the hNGFB were not effective, although attempts are in progress to devise a procedure for preparing the correctly refolded protein. The hNGFB has been cloned and expressed, producing a secretory protein in Saccharomyces cerevisiae (Kanaya et al., 1989). In this study, approx. 2 #g of the monomeric form of their rehNGFB was required to stimulate neurite outgrowth equivalent to that effected by 10 ng of natural mNGFB. This low intrinsic activity of monomeric rehNGFB may have been be due to limited reassociation of the single polypeptide to the biologically active homodimer after treatment with 6 M urea.
100 ng of recombinant hNGFB was obtained from 121 of culture broth. This same fraction at 1-10 ng/ml was biologically active on DRG neurons (Fig. 5), and inhibited by rabbit anti-mNGFB IgG (2 #g/ml). The pellet remaining after centrifugation (see Fig. 3, righthand side) and containing 99.8~o of the rehNGFB was solubilized under denaturing conditions and partially purified on a DE52 column according to Kanaya et al. (1989). Those molecules with the characteristics of the monomerie form of NGFB eluted unbound from the column, leaving behind many acidic proteins with Mr similar to NGFB (Fig. 6). The eluted molecules (about 14 kDa also under nonreducing conditions) reacted with rabbit antimNGFB antibodies. After exhaustive dialysis, this impure monomeric form contained no biological activity at (estimated) concentrations of 1-10ng/ml, a not surprising observation, as no convincing evidence has yet shown that the NGFB monomer represents the naturally bioactive form of NGFB. Western-blot analysis with these polyclonal anti-mNGFB antibodies demonstrated, however, immunochemical reactivity against mNGFB which had been boiled for lmin in the presence of 3% /~mercaptoethanol. The antibodies thus recognized either specific aa sequences or nondefined antigenic structural domains. We assume that the aa sequence of this protein partially purified from the insoluble pellet is correct, but that its three-dimensional structure is altered. It appears
SDS
kDa
°..o_,
W
43.0--
--
20.0
--
The present results demonstrate the feasibility of producing and purifying homodimeric hNGFB in E. coll. The elution profile of the protein on cation exchange chromatography, its size as determined by SDS-PAGE, crossreactivity with polyclonal antibodies specific for mNGFB and biological activity on DRG neurons indicate that this protein has been faithfully replicated in our system. The proposed investigation and treatment of possible NGF deficits in Alzheimer's disease and in brain aging (Hefti et al., 1989) will require the availability of the hNGFB
WESTERN
-PAGE
BLOT
I
.,0_
30.0
(c) Conclusions
/ume,w Im I ,,ramrod
i
qNI!lBmm,~
14.4--
II
ABC
O E
F
~ Z E
ABC
DE
F
0 Z
E
Fig. 6. Analysis of the products after lysis of cells in the washed pellet. The pellet remaining after centrifugation (see 'Pellet' in Fig. 3 righthand branch; and section b) was solubilized using 6 M guanidine.HC! dissolved in 0.1 M Na.acetate (pH 4.0). The solubilized fraction was chromatographed on a DE52 column (2.5 x 20 cm) equilibrated with the same buffer. Results of the silver-stained 0.1% SDS/0.5 M urea/15% PAGE in reducing conditions with 5% [I-mercaptoethanol and Western blots of the fractions eluting from the column are shown. Western blotting was performed as in Figs. 2 and 4. Lanes: A, total protein extracted from E. coil; B, soluble fraction in guanidine.HCl; C, fraction not bound to column; D, fraction eluting at 0.5 M NaCl; E, fraction eluting at 1.0 M NaCl; F, fraction eluting at 2.0 M NaCI; mNGF, I pg of mouse NGF purified from submaxillary glands was loaded in this lane.
256 with a proper three-dimensional conformation. Bacterial expression of biologically active h N G F B d e m o n s t r a t e s the feasibility of this approach, but also limitations in the use o f E. cog as a host for production of a protein with three intrachain disulfide bonds. The expression o f h N G F B in eukaryotic host cells m a y overcome problems o f correct conformation.
ACKNOWLEDGEMENTS The authors wish to t h a n k Dr. J o h n M c C a r t h y ( G B F , Braunschweig, G e r m a n y ) who generously provided the host cell CAG629 and Roberta Drigo for typing the manuscript.
REFERENCES Angeletti, R.H. and Bradshaw, R.A.: Nerve growth factor from mouse submaxillarygland: amino acid sequence. Prec. Natl. Acad. Sci. USA 68 (1971) 2417-2420. Bradshaw, R.A.: Nerve growth factor. Ann. Rev. Biochem. 47 (1978) 191-216. Callegaro, L., Bigon,E., Vantini, G., Di Martino, A., Skaper, S.D., Leon, A. and Toffano, G.: Biological and immunochemical properties of recombinant human NGF. In: Horrocks, L.A., Neff, H.N., Yates, J.A. and Hadjicostantinou, H. (Eds.), Trophic Factors and the Nervous System. Raven Press, New York, 1990a, pp. 75-82. Callegaro, L., Skaper, S.D., Vantini, G., Benvegn6, D., Di Martino, A., Schiavo, N., Triban, C., Minozzi, C. and Leon, A.: Purification and characterization of Fab fragments from anti-mouse NGF polyclonal antibodies. J. Mol. Recognition 3 (1990b) 187-191. Cohen, S.: Purificationof a nerve growth factor promoting protein from the mouse salivary gland and its neuro-cytotoxic antiserum. Prec. Natl. Acad. Sci. USA 46 (1960) 302-.~11. Dreyfus, C.F.: Effects of nerve growth factor on cholinergic brain neurons. Trends Pharmacoi. Sci. 10 (1989) 145-1~9. Edwards, R.H., Selby, MJ., Garcia, P.D. and Rutter, WJ.: Processing of the native nerve growth factor precursor to form biologicallyactive nerve growth factor. J. Biol. Chem. 263 (1988) 6810-6815.
Goldstein, L.D., Reynolds, C.P. and Perez-Polo, J.R.: Isolation of human nerve growth factor from parenteral tissue. J. Neurosci. Res. 3 (1978) 175-183. Hamburger, V. and Levi-Montalcini, R.: Proliferation, differentiation and degeneration in the spinal ganglia of the chick embryo under normal and experimental conditions. J. Exp. Zool. 111 (1949)457-502. Hamburger, V., Brunso-Bechtold, J.K. and Yip, J.W.: Neuronal death in the spinal ganglia of the chick embryo and its reduction by nerve growth factor. J. Neurosci. 1 (1981) 60-71. Hefti, F., Hartikka, J. and Knusel, B.: Function of neurotrophic factors in the adult and aging brain and their possible use in the treatment of neurodegenerative disorders. Neurobiol. Aging 10 (1989)515-533. Hu, G.L. and Neet, K.E.: Expression of the cDNA for mouse nerve growth factor protein in Escherichia coli. Gene 70 (1988) 57-65. Kanaya, E., Higashizaki, T., Ozawa, F., Hirai, K., Nishizawa, M., Tokunaga, M., Tsukui, H., Hatanaka, H. and Hishinuma, F.: Synthesis and secretion of human nerve growth factor by Saccharomyces cerevisiae. Gene 83 (1989) 65-74. Levi-Montalcini, R.: The nerve growth factor: its mode of action on sensory and sympathetic nerve cells. Harvey Lect. 60 (1966) 217-259. Mobley, W.C., Schenker, A. and Shooter, E.M.: Characterization and isolation of proteolyticallymodified nerve growth factor. Biochemistry 15 (1976) 5543-5552. Perez-Polo, J.R., Beck, C., Reynolds, C.P. and Blum, M.: Human nerve growth factor: comparative aspects. In: Guroff, G. (Ed.), Growth and Maturation Factors. Wiley, New York, 1983, pp. 31-54. Schauder, B., BlOcker, H., Frank, R. and McCarthy, J.E.G.: Inducible expression vector incorporating the Escherichia coli atpE translational initiation region. Gene 52 (1987) 279-283. Skaper, S.D. and Varon, S.: Age-dependent control of dorsal root ganglion neuron survival by macromolecular and low molecular weight trophic agents and substratum-bound laminins. Dev. Brain Res. 24 (1986) 39-46. UUrich, A., Gray, A., Berman, C. and Dull, T.J.: Human beta-nerve growth factor gene sequence highly homologous to that of mouse. Nature 303 (1983) 821-825. Walker, P., Weichsel Jr., M.E. and Fischer, D.A.: Human nerve growth factor: lack of immunoreactivitywith mouse nerve growth factor. Life Sci. 26 (1980) 195-200. Warren, S.L., Fanger, M. and Neet, L.E.: Inhibition of biological activity of mouse beta nerve growth factor by monoclonal antibody. Science 210 (1980) 910-912. Zucker, M. and Striegler, P.: Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9 (1981) 133-148.
251
GENE 06231
Synthesis of the biologically active ~-subunit of human nerve growth factor in E s c h e r i c h i a c o l i (Recombinant DNA; plasmid expression vector; phage 2 PR and PL promoters; immunological cross-reactivity; homodimer; dorsal root ganglion; neurite outgrowth)
Alessandro Negro a, Irene Martini a, Emilio Bigon a, Flavia Cazzola a, Cristina Minozzi b, Stephen D. Skaper b and Lanfranco Callegaroa aAdvanced Technology Division, and bFidia Research Laboratories. 35031 Abano Terme, PD (Italy) Received by H.M. Krisch: 30 July 1990 Revised/Accepted: 1 August/5 August 1991 Received at publishers: 21 October 1991
SUMMARY
The gene (NGFB) encoding the fl subunit of mature human nerve growth factor (hNGFB) was subcloned into the pJLA503 expression vector under the control of bacteriophage promoters PR and PL, and expressed in Escherichia coll. The recombinant protein represented approximately 3 ~o of the total cellular protein. Biologically active hNGFB was solubilized (0.2 total NGFB) and purified by cation-exchange chromatography and it yielded two bands on polyacrylamide-gel electrophoresis under nonreducing conditions, corresponding to the monomeric (14 kDa) and homodimeric (26.5 kDa) forms of the molecule. Both hNGFB forms were immunopositive on Western blots with rabbit anti-NGFB antibodies; however, following additional purification, only the species corresponding to the hNGFB homodimer was biologically active on cultured chicken dorsal root ganglion neurons. These results demonstrate the feasibility of synthesizing the biologically active form of hNGFB in E. coll.
INTRODUCTION
Nerve growth factor was originally identified by Ham= burger and Levi-Montalcini (1949), in their seminal work on the chicken DRG. The NGF appears to be a modulaCorrespondence to: Dr. A. Negro at his present address, Advanced Technology Division, Fidia S.p.A., Via Ponte della Fabbrica 3/A, 35031 Abano Terme, PD (Italy) Tel. (39-49)8232523; Fax (39-49)810653.
Abbreviations: aa, amino acid(s); Ap, ampicillin; BSA, bovine serum albumin; bp, base pair(s); DRG, dorsal root ganglion; hNGFB, human NGFB; IgG, immunoglobulinG; kb, kilobase(s) or I000 bp; LB, LuriaBertani (medium); mNGFB, mouse NGFB; NGF, nerve growth factor; NGFB, {3subunit (or 2.5S form) of NGF; NGFB, gene encoding NGFB; nt, nucleotide(s);oligo,oligodeoxyribonucleotide;PAGE, polyacrylamidegel electrophoresis; PBS, phosphate-buffered saline (8 mM Na2HPO4/ 1.47 mM KH2PO4/136 mM NaCI/2.7 mM KCI pH 7.5), vLand pg, phage leftward and rightward early major promoters, respectively; rehNGFB, recombinant hNGFB; SDS, sodium dodecyl sulfate; [ ], denotes plasmid-carrier state.
tor of neuronal development and of normal, developmental cell death. Its presently known trophic targets are the peripheral sympathetic neurons (Levi-Montalcini, 1966), neural crestodedved sensory neurons (Hamburger et al., 1981), and cholinergic neurons of the basal forebrain (Dreyfus, 1989). Chemically, much of our knowledge of NGF is based on studies using the protein extracted from adult male mouse submaxillary glands (Cohen, 1960). The complete NGF molecule (140 kDa, sedimentation coefficient of 7S), is composed of 0¢,p and ~,subunits. However, neuronotrophic activity resides exclusively with the fl subunit (NGFB) of approx. 26.5 kDa and a sedimentation coefficient of 2.5S. NGFB is a noncovalent homodimer (Bradshaw, 1978)" monomers consist of 118 aa with six Cys residues and three intrachain disulfide bridges (Angeletti and Bradshaw, 1971). Large quantities of NGF are found in exocrine glands, such as the prostate and its secretions, in certain animal species and in some snake venoms. It also occurs in lim-
252 ited quantities in human sources such as placenta and semen (Goldstein et al., 1978; C ~ e g a r o et at., 1990a) from which extraction is cumbersome and time-consuming. The human N G F B gene was isolated from a genomic library using m N G F B as a probe (UUrich et al., 1983). Transcription of the N G F B gene produces at least four different m R N A s and results in the formation of a precursor of 241 aa or more. This p r e p r o N G F is cleaved at dibasic residues Arg-Arg and Arg-Lys at the N- and C-terminals of the peptide, respectively, to generate the mature molecule (Edwards et at., 1988). In order to study the structure/ function and level of activity of the human molecule, we have expressed mature h N G F B in E. coll. The/~-subunit was isolated and its neuronotrophic activity confirmed.
htpR-lon mutant). The highest level of expression was ob-
tained in the CAG629 host. After induction, samples of the bacterial lysate were boiled at 100°C for I min in the presence of/~-mercaptoethanol. S D S - u r e a - P A G E showed a weak band of approx. 14 kDa. This band reacted strongly with polyclonal rabbit a n t i - m N G F B antibodies (Fig. 2). Evidence for cross-reactivity of h N G F B against rabbit polyclonal anti-mNGFB (Perez-Polo et al., 1983; Walker et al., 1980) has, until now, been equivocal. The present demonstration of cross-reactivity is in accord with that of Warren et al. (1980). Using the same antibody to evaluate r e h N G F B in another E. coil strain, we observed crossreactivity with h N G F B partially purified from placenta. These results, while eliminating doubts about crossreactivity between mouse and h u m a n N G F B s , do not clar-
EXPERIMENTAL AND DISCUSSION
A
(a) Expression of human reNGFB The expression of r e h N G F B by p J L A N G F (see Fig. 1) was evaluated for maximum protein yield in three strains of E. coli: HB101, 71/18 (which carries constitutively expressed gene clts857), and CAG629 (which is a double
B
C
A
B
43.0
-
t
k I
30.0
-
~-.
. . . .
~
Nde I
,
~ q
•
7"
*.
-"
I
f c o RI
5'-- TCCA[TATGTCATCATCCCATCCCATC T TCCACAGGGGCGIAAT illl ,~11 l] III III I I I I i I I I I I I I I I I I I I I I i i I !I,
C
kDa
TCTC .;,~
--3'
20.0
•
14.4
Y
_
SDS - P A G E
W E STER N BLOT
Fig. 1. Structureof the expressionvector pJLANGF. The gene encoding mature hNGFB was obtained from the pBBG26 plasmid (British Biotechnology Ltd., Oxford, U.K.). Two C-terminalcodons for Arg~t9 and Ala~2°were deleted from this sequence. The sequence was inserted into a pJLA503 (Schauder et at., 1987) expression vector downstream from the p~. and PR promoters. The restriction site Ndel was engineeredat the ATG start codon, Two complementaryoligoswere then annealed to form a double-stranded DNA as follows. The NdeI-EcoRl oligo was ligated with the EcoRl-BarnHI fragment from pBBG26 into Ndel + BamHI-cut pJLAS03.The resultingplasmid,containinghNGF sequences,was termed pJLANGF. Expression was regulated by the ~ phage thermosensitive repressor encoded by the clts857 gene and the PLO, and PRORpromoters/ operators. The double-stranded oligos Ndel-EcoRl are specifiedon the top; fd, transcriptionalterminator of fd bacteriophage.
Fig. 2. SDS-urea-PAGE (SDS-PAGE) and Western blot (WESTERN BLOT) of the expression products. E. coil strain 71/18 was transformed and induced to produce the recombinant protein. Single colonies were amplifiedin LB broth containing 50 lag Ap/ml at 28°C. The saturated culture, diluted h 100 in this medium was thermallyinduced at 42°C for 3 h. The bacterial cells from 10 lal of culture were dissolved in sample buffer,boiled for I min,electrophoresedin 0.1 ~ SDS/15% PAGE/0.5 M urea in the presence of 0.7 M 13-mercaptoethanol, and stained by Coomassie brilliant blue. Western blotting was performed for 16 h on nitrocellulose filter at 0.2 mA, equilibrated in 25raM Tris/192mM glycine/20% methanol/0.1% SDS, pH 8.3. The filterwas incubated with affinity-purifiedrabbit polyclonalantibodies (2.5 lag per ml in PBS/0.1% BSA) to mNGFB (Callegaroet at., 1990b)for 2 h at room temperature. Nitrocellulose sheets were saturated with 5% BSA in PBS for 30 rain, Proteins were visualizedwith goat anti-rabbit IgG secondary antibodies, and developed with Auroprobe Immunogold Silver Stain (Janssen). Lanes: A, 2 lag of purified mNGFB from submaxillaryglands (Mobley et at., 1976); B, total protein extract from E. col[ [pJLANGF], C, total protein extract from E, coli [pJLA503].
253 InducedE coil
2.Ot~
a
1
Centrifugatlon (9000 x g; 20rain) wash 3 time with PBS
I
pH9.0
C "lu
prig.0
m
D
÷
E F
I
~ Supernatant (discard)
Pellet
o 1.O1
m el
LySISin 50mM Naoacetate buffer (pit 4)/0.4M NaCI Gauiln Press (800 psi) Centrlfugatlon (800 x g; 15min)
1
Supernatant
0.O
I
40
80 Fractions
b Pellet
SDS - PAGE
k~
q4.0
120 WESTERN BLOT
-
CM52 cellulose
Solubilizatlon in 6M guanldinlum/100mM Na*acetate (pH 4)
NGF dimer
Dialysis against IM urea
1
6?.0. 43.0 -
~ mmm
SP S e p l ~ l ~ c-25
1
NGF monomer
30.0-.
q
2O.OD 14.4- ~ ~ oQb~
'
"'
Fig. 3. Flow diagram for NGFB isolation described in Figs. 4 and 6.
A ify structural homologies between the two NGFB species. The monomeric form of rehNGFB extracted under reducing conditions from the insoluble cell pellet represented about 3 % of the total protein. Although higher levels have been reported for other proteins in this expression system (Schauder et al., 1987), accumulation of rehNGFB was 30 times that reported for mNGFB in E. cog, expressed as a percent with respect to total cell protein in the pellet (Hu and Neet, 1988). Such differences may be related to the relative structural stability of the mRNAs (Zucker and Stiegler, 1981). As shown in the SDS-urea-PAGE in Fig. 2, mNGFB typically consists of two closely spaced bands at approx. 14 and 14.4 kDa: the complete NGFB monomer sequence and the polypeptide cleaved at the Met 9 residue [des(I-8) NGFB, which lacks the first eight N-terminal aa; Mobley et al., 1976]. The rehNGFB does not contain a M e t 9 and is, therefore, not cleaved. In addition, the Mr of the hNGFB appears slightly greater than that of mNGFB. This size difference is presumably due to differences in electrophoretic behaviour and not to the Met residue. (b) Partial purification of the rehNGFB protein Because the level of production of rehNGFB was low, induction was scaled up and the biologically active protein
B
C
D
E
F mNGF F mNGF
Fig. 4. Chromatography (map a) and SDS-PAGE analysis (panel b) of the soluble fraction of E. coli[pJLANGF] strain CAG629, The soluble protein fraction from E. cog was obtained after breaking the cells with a Gaulin press at 800 psi in 0.4 M NaCI/50 mM acetic acid (pH 4.0). After centrifugation at 800 x g this material was applied to a CM52 cellulose column (5 x 20 cm) in 0.4 M NaCI/50 mM Na.acetate (pH 4.0), the column was washed with 50 mM Na,acetate without NaCI and the pH increased to 9.0 by 50 mM Tris. HCI and the recombinant protein recovered at 0.4 M NaCI. Fractions marked B-F eluting from the column were subjected to 0.1% SDS/15% PAGE and Western blotting (panel b). The gel was run without ~-mercaptoethanol and silver-stained. Western blotting was performed as in Fig. 2, using the same rabbit polyclonal antibodies. Lanes: A, soluble fraction (see 'Supernatant' Fig. 3 lefthand branch) in 100 mM Na.acetate buffer (pH 4.0) (not shown in map a); B, unbound fraction; C, shoulder from fraction B; D, fraction eluting at pH 9.0; E, elute at 0.4 M NaCI, pH 9.0 (first peak); F, elute at 0.4 M NaCI, pH 9.0 (second peak); mNGF, 2 ~g mNGF purified from submaxillary
gland.
purified as follows. A 200 ml culture of E. cog CAG629 containing the pJLANGF plasmid was grown at 28°C overnight, then added to 121 of medium with vigorous agitation. When the absorbance (590 nm) reached 0.4, the temperature was shifted to 42 °C for 30 rain and the cells were grown for 3 h at 41 ° C. The ceils were then centrifuged (9000 x g, 20 min) and washed three times with PBS, and the final pellet lysed in 50 mM Na.acetate (pH 4.0)/0.4 M NaCI using a Gaulin press (800 psi). The supernatant (800 x g, 15 min) thus obtained, was seen to contain, by
254
Fig, 5, Biologicalassay for NGF (purified from the soluble fraction of E, coil [pJLANGF] strain CAG629). Bioassay for NGF activitywas carried out as previouslydescribed (Skaper and Varon, 1986)usingmicroculturesof DR(:; neurons from day 8 chicken embryos. (Panel A): DRG neurons without addition of NGF after 24 h. (Panel B): DRG neurons 24 h after addition of partially purified rehNGFB (10 ng/ml). Similarresults were obtained with 1-10 ng mNGFB/mi. means of immunoblotting, an estimated 0.2~o of the total rehNGFB from the pellet. This soluble fraction was chromatographed on a CM-52 cation exchange column, as described for mNGFB (Mobley et al., 1976). The eluent was pooled, dialyzed against 50ram Na.acetate (pH 4.5)/ 0.15 M NaCI, divided into aliquots and stored at -80°C. A flow diagram summarizing these procedures is given in Fig. 3.
Analysis of the protein fractions (Fig. 4a) by a nonreducing S D S - P A G E , followed by Western-blot analysis yielded only a s!,ngle immunoreactive band at approx. 26.5 kDa with anti-mNGFB affinity-purified polyclonal antibodies, corresponding to the Mr of the dimefic form of hNGFB (Fig. 4b). However, no band at 26 kDa was visible in the silverstained 0.1% SDS-15% PAGE gel. We have estimated by comparative immunoblotting that about
255 that formation of the dimeric form of rehNGFB may have been compromised by an altered folding of the recombinant DNA-derived product. Other methods for solubilization of the hNGFB were not effective, although attempts are in progress to devise a procedure for preparing the correctly refolded protein. The hNGFB has been cloned and expressed, producing a secretory protein in Saccharomyces cerevisiae (Kanaya et al., 1989). In this study, approx. 2 #g of the monomeric form of their rehNGFB was required to stimulate neurite outgrowth equivalent to that effected by 10 ng of natural mNGFB. This low intrinsic activity of monomeric rehNGFB may have been be due to limited reassociation of the single polypeptide to the biologically active homodimer after treatment with 6 M urea.
100 ng of recombinant hNGFB was obtained from 121 of culture broth. This same fraction at 1-10 ng/ml was biologically active on DRG neurons (Fig. 5), and inhibited by rabbit anti-mNGFB IgG (2 #g/ml). The pellet remaining after centrifugation (see Fig. 3, righthand side) and containing 99.8~o of the rehNGFB was solubilized under denaturing conditions and partially purified on a DE52 column according to Kanaya et al. (1989). Those molecules with the characteristics of the monomerie form of NGFB eluted unbound from the column, leaving behind many acidic proteins with Mr similar to NGFB (Fig. 6). The eluted molecules (about 14 kDa also under nonreducing conditions) reacted with rabbit antimNGFB antibodies. After exhaustive dialysis, this impure monomeric form contained no biological activity at (estimated) concentrations of 1-10ng/ml, a not surprising observation, as no convincing evidence has yet shown that the NGFB monomer represents the naturally bioactive form of NGFB. Western-blot analysis with these polyclonal anti-mNGFB antibodies demonstrated, however, immunochemical reactivity against mNGFB which had been boiled for lmin in the presence of 3% /~mercaptoethanol. The antibodies thus recognized either specific aa sequences or nondefined antigenic structural domains. We assume that the aa sequence of this protein partially purified from the insoluble pellet is correct, but that its three-dimensional structure is altered. It appears
SDS
kDa
°..o_,
W
43.0--
--
20.0
--
The present results demonstrate the feasibility of producing and purifying homodimeric hNGFB in E. coll. The elution profile of the protein on cation exchange chromatography, its size as determined by SDS-PAGE, crossreactivity with polyclonal antibodies specific for mNGFB and biological activity on DRG neurons indicate that this protein has been faithfully replicated in our system. The proposed investigation and treatment of possible NGF deficits in Alzheimer's disease and in brain aging (Hefti et al., 1989) will require the availability of the hNGFB
WESTERN
-PAGE
BLOT
I
.,0_
30.0
(c) Conclusions
/ume,w Im I ,,ramrod
i
qNI!lBmm,~
14.4--
II
ABC
O E
F
~ Z E
ABC
DE
F
0 Z
E
Fig. 6. Analysis of the products after lysis of cells in the washed pellet. The pellet remaining after centrifugation (see 'Pellet' in Fig. 3 righthand branch; and section b) was solubilized using 6 M guanidine.HC! dissolved in 0.1 M Na.acetate (pH 4.0). The solubilized fraction was chromatographed on a DE52 column (2.5 x 20 cm) equilibrated with the same buffer. Results of the silver-stained 0.1% SDS/0.5 M urea/15% PAGE in reducing conditions with 5% [I-mercaptoethanol and Western blots of the fractions eluting from the column are shown. Western blotting was performed as in Figs. 2 and 4. Lanes: A, total protein extracted from E. coil; B, soluble fraction in guanidine.HCl; C, fraction not bound to column; D, fraction eluting at 0.5 M NaCl; E, fraction eluting at 1.0 M NaCl; F, fraction eluting at 2.0 M NaCI; mNGF, I pg of mouse NGF purified from submaxillary glands was loaded in this lane.
256 with a proper three-dimensional conformation. Bacterial expression of biologically active h N G F B d e m o n s t r a t e s the feasibility of this approach, but also limitations in the use o f E. cog as a host for production of a protein with three intrachain disulfide bonds. The expression o f h N G F B in eukaryotic host cells m a y overcome problems o f correct conformation.
ACKNOWLEDGEMENTS The authors wish to t h a n k Dr. J o h n M c C a r t h y ( G B F , Braunschweig, G e r m a n y ) who generously provided the host cell CAG629 and Roberta Drigo for typing the manuscript.
REFERENCES Angeletti, R.H. and Bradshaw, R.A.: Nerve growth factor from mouse submaxillarygland: amino acid sequence. Prec. Natl. Acad. Sci. USA 68 (1971) 2417-2420. Bradshaw, R.A.: Nerve growth factor. Ann. Rev. Biochem. 47 (1978) 191-216. Callegaro, L., Bigon,E., Vantini, G., Di Martino, A., Skaper, S.D., Leon, A. and Toffano, G.: Biological and immunochemical properties of recombinant human NGF. In: Horrocks, L.A., Neff, H.N., Yates, J.A. and Hadjicostantinou, H. (Eds.), Trophic Factors and the Nervous System. Raven Press, New York, 1990a, pp. 75-82. Callegaro, L., Skaper, S.D., Vantini, G., Benvegn6, D., Di Martino, A., Schiavo, N., Triban, C., Minozzi, C. and Leon, A.: Purification and characterization of Fab fragments from anti-mouse NGF polyclonal antibodies. J. Mol. Recognition 3 (1990b) 187-191. Cohen, S.: Purificationof a nerve growth factor promoting protein from the mouse salivary gland and its neuro-cytotoxic antiserum. Prec. Natl. Acad. Sci. USA 46 (1960) 302-.~11. Dreyfus, C.F.: Effects of nerve growth factor on cholinergic brain neurons. Trends Pharmacoi. Sci. 10 (1989) 145-1~9. Edwards, R.H., Selby, MJ., Garcia, P.D. and Rutter, WJ.: Processing of the native nerve growth factor precursor to form biologicallyactive nerve growth factor. J. Biol. Chem. 263 (1988) 6810-6815.
Goldstein, L.D., Reynolds, C.P. and Perez-Polo, J.R.: Isolation of human nerve growth factor from parenteral tissue. J. Neurosci. Res. 3 (1978) 175-183. Hamburger, V. and Levi-Montalcini, R.: Proliferation, differentiation and degeneration in the spinal ganglia of the chick embryo under normal and experimental conditions. J. Exp. Zool. 111 (1949)457-502. Hamburger, V., Brunso-Bechtold, J.K. and Yip, J.W.: Neuronal death in the spinal ganglia of the chick embryo and its reduction by nerve growth factor. J. Neurosci. 1 (1981) 60-71. Hefti, F., Hartikka, J. and Knusel, B.: Function of neurotrophic factors in the adult and aging brain and their possible use in the treatment of neurodegenerative disorders. Neurobiol. Aging 10 (1989)515-533. Hu, G.L. and Neet, K.E.: Expression of the cDNA for mouse nerve growth factor protein in Escherichia coli. Gene 70 (1988) 57-65. Kanaya, E., Higashizaki, T., Ozawa, F., Hirai, K., Nishizawa, M., Tokunaga, M., Tsukui, H., Hatanaka, H. and Hishinuma, F.: Synthesis and secretion of human nerve growth factor by Saccharomyces cerevisiae. Gene 83 (1989) 65-74. Levi-Montalcini, R.: The nerve growth factor: its mode of action on sensory and sympathetic nerve cells. Harvey Lect. 60 (1966) 217-259. Mobley, W.C., Schenker, A. and Shooter, E.M.: Characterization and isolation of proteolyticallymodified nerve growth factor. Biochemistry 15 (1976) 5543-5552. Perez-Polo, J.R., Beck, C., Reynolds, C.P. and Blum, M.: Human nerve growth factor: comparative aspects. In: Guroff, G. (Ed.), Growth and Maturation Factors. Wiley, New York, 1983, pp. 31-54. Schauder, B., BlOcker, H., Frank, R. and McCarthy, J.E.G.: Inducible expression vector incorporating the Escherichia coli atpE translational initiation region. Gene 52 (1987) 279-283. Skaper, S.D. and Varon, S.: Age-dependent control of dorsal root ganglion neuron survival by macromolecular and low molecular weight trophic agents and substratum-bound laminins. Dev. Brain Res. 24 (1986) 39-46. UUrich, A., Gray, A., Berman, C. and Dull, T.J.: Human beta-nerve growth factor gene sequence highly homologous to that of mouse. Nature 303 (1983) 821-825. Walker, P., Weichsel Jr., M.E. and Fischer, D.A.: Human nerve growth factor: lack of immunoreactivitywith mouse nerve growth factor. Life Sci. 26 (1980) 195-200. Warren, S.L., Fanger, M. and Neet, L.E.: Inhibition of biological activity of mouse beta nerve growth factor by monoclonal antibody. Science 210 (1980) 910-912. Zucker, M. and Striegler, P.: Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9 (1981) 133-148.
