Gene, 107 (1991) 297-305 0

1991 Eisrvier

GENE

Science Publishers

B.V. A11 rights reserved.

297

0378-l 119/91/$03.50

06082

Synthesis and functional characterization of a recombinant monocloual antibody directed against the cc-chain of the human interleukin-2 receptor {Recombinant

DNA;

antibody-dependent

Brigitte Kaluzaa,

sequencing;

site-directed

mutagenesis;

cloned chime&

gene; electroporatio~;

complement

activation;

cellular cytotoxicity)

Helmut Lenzb,

Eberhard Russmann”,

Hanno Hock’,

Oliver RentropC, Otto Majdicd,

Walter Knappd

and Ulrich H. Weidle” 0 Abtei~ungf~r ~~~-~eukombination, ~oe~~~~er Ma~nhe~rnGmbH, II-8122 Penzberg (F.R.G.); ’ ~~5~~g~~c~~ ResearcFE Ceptter, Roe~ringer Mannheiin GmbH, D-8132 Tutzing (F.R.G.); ‘, Institutftir Immunologic, Freie UniversitiitBe&, D-1000 Berlin 45 (F.R, G,), and d Institutftir Immunologic der UniversitiitWien, Vienna (Austria) Received by II. Zachau: 2I January 1991 Revised/Accepted: 30 April 1991/2 May 1991 Received at publishers: 2 August 1991

SUMMARY

We have determined the sequence of the light and heavy chains of mAb 3G-10 (IgGl), a monoclonal antibody competing with interleukin 2 (IL2) for binding to the human IL2 receptor Tat protein. The antibody-encoding genes were chimerized by introducing splice donor and part of the intron sequences into the cDNA and subsequcntl~ linking it to the constant parts of the human IgGl gene. The chimeric mAb was produced in mouse myeloma cells and purified. Murine and chimeric mAbs showed similar properties with respect to inhibition of T-cell proliferation. In contrast to its murine counterpart, the chimeric mAb exhibited Ab-dependent cellular cytotoxicity and, when combined with an Ab recognizing a different epitope on the IL2 receptor Tat protein, was able to activate human complement. The chimc~zcd mAb might therefore have improved therapeutic efficacy.

INTRODUCTION

TWO major problems have hampered the exploration of the potential of murine Abs in clinical therapeutic interCorrespondenceto: Dr. kombination,

Boehringer

U.H. Weidle, Abteilung fur M~nheim GmbH, Nonnen~~ald

DNS-Neu2, Postfach

1152, D-8122 Penzberg (F.R.G.) Tel. (49~8856)60-280 1; Fax (49-8856) 8744.

vention: (n) significant immunogenicity and (b) depending on the isotype, ineffective recruitment of host effector functions (reviews in: Longo, 1987; Chat~~oud, 1986;

Waldmann, 1989). These problems may be curbed or even of the second and third domains of the constant region of the ~~hain; FCS, fetal calf serum; FITC, fluorescein isothiocyanate; H, heavy chain; HCMV, human cytomegalovirus; mAb, monoclonal Ab; MES, morpholino-ethanol-sulfonic acid; Ig, immunoglobulin; IL2, interleukin 2; kb, kilobase

or 1000 bp; L, light chain;

nt, nucleotide(s);

MTT,

3-(4,5-

oligo,

oligo-

Abbreviations: A, absorbance: aa, amino acid(s); Ab, antibody; ABTS, 2,Z’~ino-di-(3-ethylbenzthi~olille-sulfonate-6); ADCC, Ab-dependent

deoxyribonucleotide;

cell-mediated cytotoxicity; ATG, polyclonal anti-human T lymphocyte globulin from rabbit; bp, base pair(s); CDC, complement-dependent

phocytes; PBMC, peripheral blood mononuclear cells; PBS, phosphatebuffered saline (0.15 M NaCl/lO mM Na .phosphate pH 7.5); POD,

cytotoxicity; CDR, complementarity-determining region(s); ELISA, enzyme-Iinked immullosorbe~t assay; Fab fragments, ~tigen-bin~ng

peroxidase; RPMI, Roswell Park a-chain of the human IL2 receptor;

fragments of Abs which are derived by papain digestion and contain the light chain and part of the heavy chain (variable region and first constant

region; VDJ, variable region of rearranged of rearranged L chain.

domain);

Fc, Ab fragment

derived

by digestion

with papain,

consisting

dimethyl(-2-thi~~lyi)-~,5-dipbenyl-tetr~olium PA, polyacrylamide;

bromide; PBL, peripheral

blood Iym-

Memorial Institute (medium); Tat, UT, untranslated region; V, variable H chain; VJ, variable

region

298 eliminated 1

ATGATGGTCCTTGCTCAGTTTCTTGCATTCTTCTTGTTGCTTTGGTTTCCAGGTG~G~TGT MetMetValLeuAlaGlnPheLeuAlaPheLeuLeuLeuTrpPheProGlyAlaArgCys -20 61 GACATCCTGATGACCCMTCTCCATCCTCTGTATC AspIleLeuMetThrGlnSerProSerSerMetSerValSerLeuGlyAspThrValSer 1

20

121 ATCACTTGC~TGCEAGTCAGGGCAT~G~GTAATATAGTGTGGTTGCAG~G~C~ IleThrCysHisAlaSerGlnGlyIleArgSerAsnIleValTrpLeuGlnGlnLysPro CDRl

40

181 GGG~TCATTTAGGGGCCTGATCTATGGAACCAA(j GlyLysSerPheArgGlyLeuIle~rHisGlyThrLyalProSer CDRZ

60

241 AGGTTCAGTGGCAGTGGATCTGGAGCAGATTATTCTCTCACCATCAGCAGCCTGG~TCT ArgPheSerGlySerGlySerGlyAlaAspTyrSerLeuThrIleSerSerLeuGluSer 80 301 GAAGATTTTGCAGACTATTATTGTGTACAGTATGCTCAGT GluAspPheAlaAspTyrTyrCysValGlnTyrAlaGlnPheProArgThrPheGlyGly CDR3

100

361 GGCACCMGCTGGAPATCGGGCTGATGCTGCACCP GlyThrLysLeuGluIleLysArgAlaAspAlaAlaProThrValSerIlePheProPro J1

>>>constant

region

17.0

b 1

ATGGACTCCAGGCTCAATTTAGTTTTCCTTGTCCTTATTTT~GGTGTC~GTGTGAT MetAspSerArgLeuAsnLeuValPheLeuValLeuIleLeuLysGlyValGlnCysAsp 1.

-19 61

GTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGG~CTCTCC ValGlnLeuValGluSerGlyGl~lyL@uValGlnProGlyGlyS~rArgLysL@uSer 21 121

TGTGTTGCCTCTGGATTCACTTTCAGTACCTTTGG~TGCACTGGGTTCGTCAGGCTC~ CysValAlaSerGlyPheThrPheSerThrPheGlyMetHisTrpV~lArgGl~laPro CDRl_

41

181

by rendering

the foreign Ab more similar to those

of the hosts ‘chimeric’ Ab, in which the xeno-variable regions are combined with human constant regions (Morrison et al., 1984) and ‘hyperchimeric’ Ab (Jones et al., 1986; Junghans et al., 1990), in which only the small xeno-CDR which mediate epitope recognition are transplanted into human sequences for the L and H chains (Riechmann et al., 1988), are currently under intensive investigation. With regard to Ab therapy, the u-chain (~55; Tat; CD25) of the human IL2 receptor possesses distinctive characteristics that make it an attractive target for selective immune intervention: the Tat protein is broadly expressed on the surface of activated T cells, B cells and monocytes/macrophages playing a central role as mediators of the immune system, whereas only a minority of these cells possess the Tat protein while they are in their resting state. Furthermore, certain malignancies of lymphatic origin display high levels of Tat protein (review: Waldmann, 1989). In animal models, mAbs directed against the a-chain of the IL2 receptor have already been proven to be powerful and selective immunosuppressants to combat autoimmune diseases and allograft rejections (reviewed by: Diamantstein et al., 1989; Waldmann, 1989). ln larger clinical trials IL2 receptor p55-targeted therapy using murine Abs has been shown to be useful to reduce rejection episodes after kidney transplantation (Carpenter et al., 1989; Soulillou et al., 1990) and there is evidence for their efficacy in graft-vs.-host-disease (Her& et al., 1990). However, the clinical results are still disappointing as compared to animal models and may be improved by making use of possibly more powerful engineered antibodies. We tional against ration against

report in this paper cloning, expression and funccharacterization of a chimeric Ab (IgGl) directed the Tat protein as the first step towards the exploof the therapeutic potential of this Ab directed the IL2 receptor.

GAGAAGGGGCTGGAGTGGGTCGCATACATTA(jTAGTGGCGCA GluLySGlyLeuGluTrpValAlaTyrIleSerSerGlySerGlyThrIleTyrTyrAla

241 GACACAGTGMGGGCCGATT(1ACCATCTC~GAGACAATCCCACCCTGTTCCTG AspThrValLysGlyArqPheThrIleSerArqAspAsnProLysAsnThrLeuPheLeu 81 301 C~TGACCAGTCTAAGGTCTGAGGA~CGGC~TGTATTACTGTGC~GAGATTGGATG GlnMetThrSerLe~rgSerGlunspThrAlaMetTyrt . . . ..D...

signal sequence. The numbers above the sequence, near the left margin, specify the nt positions, with nt = 1 corresponding to A ofthe start codon. Methods. RNA was isolated from 3 x 10’ hybridoma cells secreting

121

mAb3G-10, selected for poly(A) + RNA on oligo(dT)-cellulose (Maniatis et al., 19 82) and a cDNA library was prepared with the Pharmacia cDNA

_CDR3 361 MCTGGGGC~GGGACTCTGGTCACTGTCTCTGCAGC~CGACACCCCCATCTGTC AsnTrpGlyGlnGlyThrLeuValThrValSerAlaALaLysThrThrProProSerVal >>sconstant

J3

Fig. 1.

Sequences

of (a)

L and (b) H

chains

region

of mAb3G-10.

The CDR

regions (Kabat et al., 1987) and J, (a) and J, (b) regions for K and yl. respectively, are underlined; the D region of the yl chain is indicated by a dotted line. The beginning of the constant regions is marked by the > > > symbols. The numbers below the sequence indicate aa positions; 1 indicates the first aa of the mature sequence; upstream aa represent the

synthesis kit according to the instructions ( 104) were screened by colony hybridization

of the manufacturer. Clones with oligos using for K clones

5’-CCCGACTACGACCT and 5’-CAGATAGGTGAACCGG for yl clones. The oligos match the 5’ regions of the constant domains of the L and H chains (Sablitzky et al., 1985). Full-length clones were identified by analysis with restriction enzymes, subcloned, and sequenced dideoxy chain-termination method (Sanger et al., 1977).

by the

299 RESULTS

moter and the lack of the consistently

AND DISCUSSION

signal sequences

present intron in the

of L and H chains (for review see: Honjo,

(a) Sequences of L and H chains of an Ah directed against Tat Monoclonal antibody CD 25-3610 (mAb3GlO) recognizes an epitope on the Tat protein of the human IL2

1983). While our work was in progress a similar strategy for chimerization of Ab has also been described by others (GilIies et al., 1989). Our approach differs from the timeconsuming classical way of chimerization. In this approach

receptor (Knapp et al., 1989; pp. 399-406). We have determined the sequences of its JCand y 1 chains (IgG 1) by cDNA sequence analysis (Sanger et al., 1977). The sequences are displayed in Fig. la and b. The variable part of the L chain consists of a 20 aa signal sequence, the mature variable part

rearranged VJ and VDJ fragments were isolated from genomic libraries and fused to the genomic constant regions of L and H chains (Shin and Morrison, 1989).

is composed of 107 aa starting with Asp’ i. The variable region of the L chain of mAb3GlO is most homologous to subgroup

V of murine

V, regions (Kabat

et al., 1987). For

the VJ rearrangement a Jl region is used (aa 96-107; Kabat et al., 1987), the constant region starts at Arg”‘. The mature heavy chain is preceded by a signal sequence of 19 aa. The mature V region starts with Asp + ’ and extends to Ala’13. Ala1i4 is the first aa of the yl constant domain (Kabat et al., 1987). The D (diversity) region comprises aa 99-102 and a J, region (aa 103-113) was used for VDJ recombination (Kabat et al., 1987). The variable region of mAb3G-10 can be classified into the miscellaneous subgroup of murine V, regions (Kabat et al., 1987). It shows extensive homology to the V, regions of MOPC21 (Bothwell et al., 1981). The aa at the N terminus of the mature chains were assigned by aa sequencing. The six CDR regions conferring epitope specificity are indicated in Fig. 1. (b) Chimerization of mAb3G-10 by introduction of splice donor signals into the cDNAs for L and H chains In contrast to Zg cDNAs, Zg genes are much more efficiently expressed after gene transfer into non-Ig producer hybridoma cells (Weidle et al., 1987). Therefore, splice donor and additional intron sequences were introduced 3’ to the appropriate J regions as well as a rare cutter enzyme cleavage site (NotI) to keep the VJ and VDJ regions as portable elements as outlined in Fig. 2a. According to the genomic organization of Ig genes splice donor and intron sequences were introduced into the L and H chain cDNAs after the first nt of the first codon of the constant regions which are separated by introns (for review see Honjo, 1983). For the L and H chains 20 nt of intron sequences including the splice donor site (GT) were introduced 3’ to the L-chain element Jl and H-chain element J3 identical to those occurring in the genome (Max, 1981; Sakano et al., 1980). As shown in Fig. 2, a and b, the mutagenized VJ and VDJ fragments were cloned into vectors harboring human tc and human yl constant regions. Expression of Zg genes in lymphoid cells is driven by the powerful HCMV promoter. The chimeric Zg genes are quite similar to Zg genes in their organization with the exception of the pro-

(c) Functional

characterization

of murine (IgGl) and chi-

merit Ab3G-IO (IgGl) After establishing transfectomas with the expression vectors described in the previous section, the chimeric Ab was purified from a ten-litre suspension culture inoculated with the transformed cell line. PA gel electrophoresis of purified Ab revealed that the electrophoretic mobilities of the chimeric H and L chains of Ab3G-10 are different from those of the murine H and L chains (Fig. 3A, lanes a, b and d). This is not surprising, because the constant regions are derived from mouse or human. Comparative inhibition studies on IL2-induced proliferation of pre-activated PBMC showed similar effects for identical concentrations of murine and chimeric Ab3G-10 (Fig. 3B). Murine and chimeric Ab3G-10 were tested for their ability to activate human complement for the lysis of L540 cells (= CDC; Br~~emann et al., 1987). L540 cells are neoplastic human bone-marrow cells isolated from a patient with Hodgkin’s disease and express the Tat protein of the IL2 receptor (Diehl et al., 1982). We did not observe any significant CDC activity with murine IgGl or chimeric human IgGl Ab3G-10 when human serum was used as the source for complement (data not shown), whereas significant chromium release (20% of that incorporated into the cells) was observed with ATG (polyclonal anti-hums T lymphocyte globulin from rabbit) and human serum. Although there have been cases reported in which murine (Hale et al., 1983) and chimeric Ab (Riechmann et al., 1988) mediated the lysis of human nucleated cells in the presence of human complement, in most of the cases reported, however, CDC is inhibited by homologous restriction factors. These factors inhibit different steps of the homologous, but not of the heterologous complement activation cascade (for review: Davies et al., 1989). The prop. erties of antigen recognized rather than the isotype of the Ab used seem to be of importance for the ability to lyse cells with homologous complement: rat Ab directed against the pan-lymphocyte antigen Campath 1 and against MHC class-1 molecules are able to lyse human l~phoc~es in the presence of human complement, while Ab of the same isotype directed against lymphocyte antigens CD45, CD3, CD7, CDS or CD18 do not mediate lysis (Bindon et al., 1985). Campath 1 showed this property also as a chimeric

BamHl

EcoRl

iotroni human ) K(human)

A

3’UT

pk^ chim

1

oligo mutagenesis

EcoRl

Barn1

mouse intron heavy thaw

avy chain intron (humans

H

p 1‘ 1chum

Cyl

(human)

of expressionvectors for chimeric Ab3G-10 (IgGl). V, variable region; D, diversity region; J, joining region; C, constant region of K or ygenes; CHl, H, CH2, CH3, constant regions of human yl gene; E, and E,, mouse enhancer for Land II chains; prom., promoter; HCMV, c~omeg~o~rus promoter; T7, bacteriophage T7; SV40, simian virus 40; SupF, suppressor tRNA. The four plasmids are drawn to scale.

Fig. 2. Construction human human

(A) introduction of splice donor and intron sequences into the cDNAs region and part of the constant region, was subcloned as an EcoRI-&a1

for L and H chains by mutagenesis. c-DNA for the K chain, containing the VJ fragment into pUC18 {Yanisch-Perron et al., 1985) giving rise to plasmid pUC,

The BamIII site indicated in the figure is derived from pUC18. Plasmid pUC,l the VDJ and part of the constant region) into pUCl8. For the introduction oligo-directed mutagenesis underlined, the functional 5’-GCAAATCAAAC

Primer

SD

for mutagenesis

5’-CTCTCTGCAG J3

was used (Morinaga et al., 1984). The nt on the following primers matching to sequences on plasmids pUC, relevance of nt on the primers is indicated below the sequence. Primer for mutagenesis of the K chain:

GT AAG TAG AAT CCA AAG TCT GCGGCCGC . . . ..~........................... oooooooo

Jl

II

Not I

intron

GGGCTGATGCT mouse

tc constant

of the yl chain:

GTGAGTCCTAACTTCTCCCA GCGGCCGC . . . . . . . . . . . . . . . . . . ..~........oooooooo SD

was obtained by subcloning an EcoRI-BamHI fragment (which contains of artificial splice donor sequences, intron sequences and a Not1 site,

53 intron

Nof I

TGCCTGGTCA mouse yl constant

and pUC,l

are

301

A 300

abed

200

100

- II2

60

+112

30

15

8

(pg

Fig. 3. Purification gel of purified mAb3G-10

and functional

murine

(IgGl).

Positions

slot for size dete~ination. with PVUI and transfeeted all done as described

characterization

and chimeric

of chimeric

Ab3G-IO

with respect

3G-10 Ab. Lanes: a and b, mAb3G-IO

(murine);

of H and L chains (55 and 25 kDa, respectively)

4

2

1

0.5

60

15

a

4

2

1

0.:

,100

(pg chimoric Ab)

to inhibition

of T lymphocytic

c, a chimeric

mAb (IgGl)

are indicated

30

murine Ab)

proliferation.

directed

by arrows. Marker proteins

against

(Pharmacia)

(Panel A) SDS-PA thyroxin;

d, chimeric

were run on a parallel

Methods. Purification into Sp2/0

and SDS-PA gel analysis ofchimeric mAb3E10: 5 ~*gpUCKchim and 5 ,ug pUCylchim were linearized cells (Ochi et al., 1983) by electroporation and clones resistant to G418 (1000 pg/ml) selected by limiting dilution,

(Lenz and Weidle,

1990). A transformant

secreting

about 4pg/ml

of chimeric

Ab3G-10

per lo6 cells in 24 h was isolated

and

fermented in a IO-liter reactor in suspension culture with 5% FCS. After concentration of the eluate to 680 ml, the y-globulin fraction was precipitated by adjusting the supernatant to 2 M (NH,}zSO, pH 7. After dialysis against 10 mM MES-buffer pH 5.8, the fraction was applied to S-Sepharose (Pharmacia) equilibrated with the same buffer at 4”C, and eluted with a linear NaCl gradient (0.1-0.25 IgGl were pooled. The fraction was adjusted to 1 M (NH,),SO, pH 9, applied to a Protein A Sepharose

M NaCl pH 5.8); fractions cont~ning chimeric column (Pharmacia) equilibrated with the same

buffer and eluted with 0.1 M Na, . citrate pH 3.4. After dialysis against PBS buffer pH 7.5, and ultrafiltration, contaminating bovine IgG was removed by adsorption to Spherosil conjugated with sheep anti-bovine IgG. Antigen-binding properties and localization in column fractions of chimeric mAb3G- 10 were assayed by ELISA. The ELISA is based on the fact that mAb3G-IO and mAb4E3 (Knapp et al., 1989) bind to different epitopes on the Tat protein. Briefly, microtiter plates were coated with polyclonal Ab against human Fey, incubated with purified Ab3G-10, column eluates or tissue-culture supernatants, and after washing incubated After incubation with ABTS and hydrogen

with a complex of POD-conjugated peroxide the A4,,5nn-,was determined

Fab fragments of Ab4E3 with soluble IL2 receptor (Shimizu et al., 1986). by an ELISA reader. Abs were dissolved in Laemmli (1970) buffer, boiled

for 5 mm, and fractionated on 0.1% SDS-lo% PA gels (Laemmli, 1970). Proteins were visualized by staining with Coomassie brilliant blue. (B) Inhibition of IL2-dependent proliferation of human peripheral blood lymphoc~~s by murine and chimeric Ab3G-IO. A550nm was registered for PBMC with IL2 stimulation without added Ab (open bars), with murine 3G-10 (shaded bars) and chimeric 3G-10 (hatched bars). The concentration of Ab (&ml) is indicated below the bars. Numbers above the bars indicate Y0 inhibition of T-cell proliferation. in the control experiment. The scale on the right margin indicates % inhibition of proliferation

The horizontal line indicates A,,, due to proliferation due to hb. PBL were isolated on a Ficoll gradient and

incubated with concanav~in A at 5 @g/ml (8 x 10’ c~lls~ml) for three days. The pre-activated PBL were washed, adjusted to 4 x lo6 cells/ml with culture medium and 25 ~1 of the cell suspension and 25 ~1 of murine or chimeric Ab3G-10 (concentrations indicated in Fig. 2B) were incubated for 30 min in a 96-well microtiter plate. Then 25 pl of IL2 (100 units/ml) were added and the culture was incubated for 48 h at 37” C. Subsequently, growth and vitality were determined with MTT. For this purpose, 10 pl of MTT (5 mg/ml in PBS) were added per well and incubated at 37°C for 4 h. Then the precipitated blue formazan dye was dissolved by incubation with 100 ~1 of a 10% SDSjO.01 N HCl at 37°C overnight. reader and compared to a control without added Ab.

Then A,,,,,

The final insertion

primers

mutants

pUC,-mut

and pUC,l-mut

were isolated by hybridization

with the mutagenesis

was determined

and sequenced

with an ELISA

by the dideoxy method

(Sanger et al., 1977). Portable VJ and VDJ sequences with appropriate splice donor signals could be isolated as EcoRI-Not1 patents pUC,-mut and pUC,l-mut. SD = splice-donor sequence. (Map B) Expression vector plcchim, for the chimer&c n gene of mAb3G-IO.

from plasmids Plasmid pzchim

contains: (I) the rearranged VJl region including splice donor sequences as anEcoRI-Not1 fragment fused to the exon of the constant region of the human K gene (the domains are separated by a hybrid intron containing L-chain intron sequences of mouse and human origin); (2) mouse L-chain enhancer region as a 2-kb EcoRI-Asp700 fragment (Picard and Schaffner, 1984); (3) part of the human L-chain intron; (4) the human K exon and 3’ UT region as a 2.8-kb fragment from plasmid pC1 (Klobeck et al., 1984); (5) the P>uI-&cRI fragment with DNA coding for mpP tRNA, HCMV and T7 promoters is derived from pcDNA1

(Invitrogen,

San Diego, CA; Aruffo and Seed, 1987); (6) an expression

cassette,

neo, for the phosphotransferase

allows isolation

of clones after transfection into mammalian cells by their resistance to G418 (Southern and Berg, 1982). T7 prom., phage T7 late promoter; 3’UT, 3’.untranslated region; supF, suppressor t-RNA; ColEl ori, origin of replication derived from plasmid ColEl. (Map C) Expression vector pplchim, for the chimeric II chain (~1) of mAb3G-10. Plasmid pplchim is derived from pcDNA1 (Invitrogen; Aruffo and Seed, 1987). (I ) Expression of the chimeric yl chain is driven by a HCMV/T7 promoter combination. (2) The rearranged VDJ3 segment including splice donor signals is present as an f&RI-A&I fragment separated by a hybrid intron with mouse and human H-chain intron sequences from the human yl gene. (3) Plasmid pylchim contains the mouse heavy-chain enhancer as a 1.6-kb HindIII-EcoRI fragment (Neuberger, 1983), and (4) part of the human H-chain intron, the four exons and three introns and 3’ UTregion of the human y 1 gene as a 2-kb HiradII strain MClQ61/P3 (Aruffo and Seed, 1987).

fragment

(Takahashi

et al., 1982), Propagation

of ph-chim and p ylchim was performed

in E. c&i

302 Ab (Riechmann et al., 1988) while chimeric and hyperchimerit Ab of the same isotype (human IgGl) directed against Tat were CDC-negative with human complement (Junghans et al., 1990). Previous investigations (manuscript in preparation) have shown that Ab directed against Tat that were not able to mediate CDC, however, were able to activate C3 fragments of human complement with subsequent deposition of the fragments on target cells. This was true, when at least two

relative fluorescence intensity Fig. 4. Complement human Tat protein

activation by combination of Ab directed against the analysed by fluorescence-activated flow cytometry.

The relative number of cells is displayed against the fluorescence intensity both on a logarithmic scale. Methods. The Abs mentioned have been explained

in section

c. C3 fragments

deposited

on target

Ab of appropriate isotype, directed against two different epitopes of the Tat protein, were used in combination, but was not observed when targeting Ab against only one epitope. Membrane-bound C3 fragments are able to interact with effector cells bearing appropriate C3 fragment receptors and thus augment cytotoxic mechanisms like phagocytosis or killer-cell-mediated lysis without establishment of the ‘membrane attack complex’ (Ehlenberger and Nussenzweig, 1977; Wahlin et al., 1983; Ross and Medof, 1985). Therefore, investigation of whether C3 fragments can be deposited on the cell membrane not only tells whether complement activation takes place at all, but also permits the identification of functionally important molecules. Murine and chimeric Ab3G-10 were investigated in combination with two mouse mAbs directed against human Tat: AHT54-2a and AHT107-2a (2a = IgG,,; Osawa and Diamantstein, 1983). AHT54 and AHT107 bind to different epitopes on the Tat protein. AHT54 interferes with IL2 binding, AHT107 does not. In preliminary competition experiments (data not shown) we found that Ab3G-10 binds to the same or a closely related epitope as Ab AHT54. ART 18-l is a control murine Ab directed against an epitope on the Tat protein of the rat (Osawa and Diamantstein, 1983). ART 18 served as a negative control, since it does not crossreact with the human Tat protein and does not bind to L540 cells. The results can be summarized as follows: (I) no deposition of C3 fragments on the cell surface was found when murine Ab3G-10, chimeric Ab3G-10, AHT54-2a or AHT107-2a were used alone (data not shown); (2) no deposition was found when chimeric Ab3G-10 and AHT542a were combined (Fig. 4A); (3) significant deposition of C3 fragments was however observed when chimeric Ab3G10 was combined with AHT107-2a (Fig. 4B), albeit reduced to that observed by combination of AHT54-2a and AHT107-2a (Fig. 4C); (4) we never observed C3 fragment

cells due to

complement activation were detected by flow cytometry. 5 x 10’ L540 cells (Diehl et al., 1982) were incubated with single Ab or Ab combi-

FCS/O.l% NaN, and then incubated for 30 min at 4°C with FITC-conju-

nations (10 pg/ml) for 20 min at 4°C in a volume of 150 ~1 with culture medium (Clicks RPMI/lO% heat inactivated FCSj’2 mM glutamine/lOO

gated rabbit antiserum (100 pg/ml) against human C3c (Dakopotts). Then the cells were washed, suspended with the buffer described above

units penicillin per ml/100 pg streptomycin per ml). Then 50 ~1 of human serum was added and the suspension was incubated for 30 min at 37°C. As a control, methylamine-treated human serum was used (Kai et al., 1988). Methylamine inhibits binding of C3 fragments to their target cells

in a volume of 500 pl, fixed by addition of 50 ~1 7% paraformaldehyde and analysed with an EPICS flow-cytometer. (A) a, ART 18-1 (30); b, chimeric mAb3G-10 + AHT54-2a (30); (B) a, ART 18-l (30); b, chimeric mAb3G-IO + AHT107-2a (60); (C) a, ART 18-l (30); b: AHT 54-

(Kai et al., 1988). The cells were washed

2a t AHT107-2a

three times with PBS/lo%

(110).

303 100

1

10 efficiently

mediated

ADCC

(Fig. 5) whereas

murine

Ab3G-10, AHT54-2a and AHT107-2a were ineffective. Other chimeric Abs of IgGl type have also been shown to be potent mediators of ADCC (Brtiggemann et al., 1987; Steplewski et al., 1988; Riechmann et al., 1988; Liu et al., 1987 ; Junghans et al., 1990). Taking this property into account, the chimeric Ab3G-10 may be of superior therapeutic efficacy in terms of cell elimination according to the study of switch variants of Campath 1 in vivo (Dyer et al., 1989). 25'1

5O:l

1OO:l

25.1

50.1

25:l

1OO:l

mouse Ab 3G-10

ATG

5O:l

1OO:l

chlmeric Ab

3G-10

effectorto targetcellrat10

Fig. 5. Evaluation of ADCC properties of murine and chimeric mAb3G10 on L540 cells. Percent (%) of specific release of 5LCr is displayed for ATG (polyclonal antihuman T lymphocyte globulin from rabbit), murine, and chimeric Ab3G-10 with varying effector cells/target cells ratio (indicated below the bars).

% spec. rel. =

(rel. in test - spontaneous (maximal

rel.) x 100

rel. - spontaneous

rel.)

Spontaneous release was determined by incubating the cells with ART18-1 under the same conditions, and maximal release was determined by incubating the cells with 100 pl Triton-X. Stippled bars represent ADCC due to ATG; striped bars ADCC due to mouse AbSG-10; hatched bars ADCC due to chimeric Ab3G-10. Methods. For the labelling reaction 3 x lo6 cells were incubated in 500 ~1 medium (RPM1 1640, Biochrom)/lO% FCS/Z mM glutamine/ units penicillin/50 pg streptomycin) with 200 FCi Na chromate (5’Cr; 37 MBq/ml, Amersham) for 4 h at 37°C. After washing, lo4 L540 cells were incubated with Ab (10 pg/ml) in 150 ~1 in 96-well microtiter plates for 20 min at 4” C. Then

(d) Conclusions (I) Introduction of artificial splice donor and intron sequences into cDNA of L and H chains of mAb3G-10 resulted in the construction of potent expression vectors for the chimerized chains of this Ab. (2) Murine and chimeric Abs had similar properties with respect to inhibition of IL2 function, but displayed different functional properties with regard to the activation of cytotoxic effector mechanisms. (3) In contrast to murine Ab3G-10, the chimerized Ab mediated activation of the human complement when applied with another Ab recognizing a different epitope on the Tat protein. (4) Chimerized Ab3G-10 efficiently mediated ADCC in contrast to its murine counterpart. (5) Because of its ability to mediate ADCC with human effector cells and to partially activate the human complement cascade, chimerized Ab3G-10 may be of improved therapeutic efficacy.

freshly isolated human PBMC were added at different ratios indicated in Fig. 5 in a volume of 50 pl. The mononuclear cells were isolated on a Ficoll-Paque (Pharmacia) gradient according to Boyum (1968). The microtiter 37°C

plates were centrifuged cells sedimented

in 100 pl supernatant

at 200

for 5 min at 200 x g

in a Packard

x g,

and the released

incubated

for 4 h at

“Cr was determined

y-counter.

when murine Ab3G-10 was investigated alone or in combination with other Abs (data not shown). The combinatorial effects of Ab on complement activation may be explained by assuming improved accessibility of antibody-Fc pieces for Clq binding (Howard and Hughes-Jones, 1988). Two mAbs binding to the same molecule might have the correct conformational arrangement for the required bivalent binding of the first component of the complement cascade, whereas with only one bound Ab per Tat protein at least two Tat proteins have to get into close contact on the cell surface in order to render bivalent binding of complement component Clq possible. ADCC was tested by binding Ab to 5’Cr-labelted L540 cells and monitoring 51Cr release after adding effector cells (human mononuclear cells from peripheral blood) at different ratios vs. the target cells. Only the chimeric Ab3Gdeposition

ACKNOWLEDGEMENTS

We would like to thank Heinrich Barchet, Judith Hacker and Marina Schwirzke for excellent technical assistance, Sabine Sperka for sequencing, Dr. Sandro Rusconi for useless comments on the manuscript and Brigitte Kindermann for help with the preparation of the manuscript. We would like to express our gratitude to Drs. T. Honjo and H.G. Zachau for providing us with plasmids. Our work was partially supported by BMFT (Bundesministerium fur Forschung und Technologie) and GIF (German-Israeli Foundation).

REFERENCES Aruffo,

A. and

Seed,

B.: Molecular

high-efficiency COS cell expression USA 84 (1987) 8573-8577.

cloning

of a CD28

system.

Proc.

cDNA

Natl. Acad.

by a Sci.

Bindon, CL, Hale, G., Clark, M. and Waldmann, H.: Therapeutic potential of monoclonal antibodies to the leucocyte-common antigen. Transplantation

40 (1985) 538-544.

304 Bothwell,

A.L.M., Paskind,

K. and Baltimare,

M., Reth, M., Imanishi-Kari,

D.: Heavy chain variable

of antibodies: somatic mutation 24 (1981) 625-637.

T., Rajewsky,

Kai, C., Sarmay,

region to the NPb family

evident in a y2a variable

region. Cell

sensitivity Immunol. Klobeck,

G., Ramos, O., Yefenof, E. and Klein, E.: Elevated

of Raji cells carrying 113 (1988) 227-234.

H.-G.,

Combriato,

acceptor

bound

G. and Zachau,

NK

C3 fragments.

H.G.:

Cell.

Immunoglobulin

Boyum, A.: Isolation of mononuclear cells and granulocytes from human blood. Stand. J. Clin. Lab. Invest. 21, Suppl. 97 (1968) 77-82.

genes of the light chain type from two human lymphoid cell lines are closely related. Nucleic Acids Res. 12 (1984) 6995-7006.

Br~ggemann, M., Williams, G.T., Bindon, CL, Clark, M.R., Walker, M.R., Jefferis, R., Waldmann, H. and Neuberger, M.S.: Comparison

Knapp, W., D&ken, B., Gilks, W.R., Rieber, E.P., Schmidt, R.E., Stein, H. and van dem Borne, A.E.G.K.: Leucocyte Typing, Vol. IV, White

of the effector functions of human immunoglobulins using a matched set of chimeric antibodies. .I. Exp. Med. 166 (1987) 1351-1361. Carpenter,

C.B., Kirkman,

N.L., Waldmann,

R.L., Shapiro,

T.A., Zimmermann,

ME.,

Milford,

C.E., Ramos,

Cell Differentiation Laemmli,

E.L., Tilney,

E.L. and Storm,

T.B.: Prophylactic use of monocional anti-112~receptor antibody in cadaveric renal transplantation. Am. J. Kidney Dis. 14, Suppl. 2 (1989) 54-57. Chatenaud, L.: The immune antibodies.

Immunol.

response

Today

against

therapeutic

7 (1986) 367-368.

expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells. .I. Exp. Hahn,

Weg~illski~ J.W.: Ill~erleukin update and attempt

at synthesis.

targeted

immunotherapy

Prog. in Immunol.

-

7 (1989) 619-626.

Diehl, V., Kirchner, H.H., Burrichter, II., Stein, H., Fonatsch, C., Gerdes, J., Schaadt, M., Heit, W., Vehauska-Ziegler, B., Ziegler, A., Heintz,

F. and

derived

cell lines. Cancer

Dyer,

M.J.,

Campath-l

Hale,

Sueno,

K.: Characteristics Treatm.

G,, Hayhoe,

antibodies

disease-

Rep. 66 (1982) 615-632.

F.G.

invivo

of Hodgkin’s

and Waldmann.

in patients

with

H.: Effects lymphoid

the head of bacteriophage genes transfected 213-218.

of

malig-

mediate lysis of cancer 3439-3443. Longo, D.L.: Monoclonal

A.J.

and Waldmann, H.: Removal of T cells from bone marrow for transplantation: a monoclonal antilymphocyte antibody that fixes human

human human

antibody constant

N., Cahn,

antibody

(B-B 10). Blood 7S (1990) 1017-1023.

genes.

Annu.

Rev.

Xmmunol.

1 (1983)

499-52s. Howard, J. and Hughes-Jones, N.: Complement-mediated lysis with monoclonal antibodies. In: Waldrn~ll, H. (Ed.), Monoclonal Antibody Therapy. Prog. Allergy, Vol. 45, Karger, Basel, 1988, pp. l-15. Jones, P.T., Dear, P.H., Foote, J., Neuberger, M. and Winter, G.: Replacing the complementary-determining regions in a human antibody with those from a mouse. Nature 321 (1986) 522-525.

Sci. USA 84 (1987)

sequence

of a 5.5-kilobase

DNA

segment

J and C region genes.

2 (1984) 636-639. L.A. and Oi, V.T.: Chimeric

molecules: mouse antigen-binding domains with region domains. Proc. Natl. Acad. Sci. USA 81

(1984) 6851-6855. and into

regulation lymphoid

of immunoglobulin heavy cells. EMBO J. 2 (1983)

1373-1378. G.R.,

Hawley,

T., Shulman,

ML,

Traunecker,

A.,

KShler, G. and Hozumi, N.: Functional immunoglobulin M production after transfection of cloned immunoglobulin heavy chains into lymphoid cells. Proc. Natl. Acad. Sci. USA 80 (1983) 6351-6355. Osawa, H. and Diamantstein, T.: The characteristics of a monoclonal antibody that binds sp~~i~call~~ to rat T l~mphobl~sts 2 receptor functions. J. Immunol. 130 (1983) 51-55.

Riechmann,

monoclonal

by

87 (1990)

Ann. Int. Med. 106 (1987) 427-429.

stranded plasmid DNA. Bio/Technology Morrison, S.L., Johnson, M.J., Herzenberg,

Kloft, M. and Peters, A.: Treatment of corticosteroid resistant acute graft-versus-host disease by in vivo administration of anti-InterIeukin T.: Immunoglobulin

antibodies

cells. Gene

Morinaga, Y., Franceschini, T., Inouye, S. and Inouye, M.: Improvement of oligonucleotide-directed site-specific mutagenesis using double-

Picard, D. and Schaffner, mouse immunoglobulin

2 receptor

of heterobispecitic

containing the mouse kappa immunoglob~lin J. Biol. Chem. 256 (1981) 5116-5120.

J.Y., Clement, C., Beliard, R., Morel-Fourier, B., Racadot. E., Troussard, X., Benz-Lemoine, E., Gaud, C., Legros, M., Attal, M.,

Honjo,

of

227 (1970) 680-685.

hybridoma

antibodies.

Ochi, A., Hawley,

I’., Milpied,

1989.

the assembly

Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring

Gillies, SD., Lo, KM. and Wesolowski, 1.: High-level expression of chimeric antibodies using adapted cDNA variable region cassettes.

complement. Blood 62 (1983) 873-882. Her&, P., Wijdenes, .I,, Bergerat, J.P., Bordigoni,

Press, Oxford,

during

ceils. Proc. Natl. Acad.

Neuberger, M.: Expression chain gene transfected

D., Munro,

T4. Nature

into producer

nancies; influence of antibody isotype. Blood 73 (1989) 1431-1439. Ehlenberger, A.G. and Nnss~nzweig, V.: The role of membrane receptors for C3b and C3d in phagocyfosis. J. Exp. Med. 145 (1977) 357-371.

J. Immunol. Methods 125 (1989) 191-202. HaIe, G., Bright, S., Chumbley, G., Hoang, I‘., Metcalf,

proteins

Len-z, H. and Weidle, U.H.: Expression

Harbor, NY, 1982. Max, E.E.: The nucteotide

H.J., Tilney, N.L. and Kupiec-

2 receptor

Oxford University

of structural

Liu, A.Y., Robinson, RR., Hellstrom, K.E.,Murray Jr., ED., Chang, C.P. and Hellstrom, E.: Chimeric mouse-human IgGl antibody that can

monoclonal

Davies, A., Simmons, D.L., Hale, G., Harrison, R.A., Tighe, H., Lachmann, P.J. and Waldmann, H.: CD 59, an LY-6-like protein

Med: 170 (1989) 637-654. Diamantstein, T., Volk, H.-D.,

Antigens.

U.K.: Cleavage

L., Clark,

and inhibits IL

W.: A lymphocyte-specific enhancer K gene. Nature 307 (1984) 80-82.

M., Waldmann,

H. and Winter,

G.: Reshaping

human antibodies for therapy. Nature 332 (1988) 323-327. Ross, G.D. and Medof, M.E.: Membrane complement receptors for bound fragments Sablitzky, F., Wildner,

in the

specific

of C3. Adv. Immunol. 37 (1985) 217-267. G. and Rajewsky, K.: Somatic mutation

clonal expansion of B cells in an beiges-driver 4 (1985) 345-350.

response.

and

EMBO J.

Sakano, H., Maki, R., Kurosawa, Y., Roeder, W. and Tonegawa, S.: Two types of somatic recombination are necessary for the generation of complete 676-683.

immunoglobulin

heavy

chain

genes.

Nature

286 (1980)

Junghans, R.P.. Waldmann, T.A., Landolli, N.F., Avdalovic, N.M., Schneider, W.P. and Queen, C.: Anti-Tat-W, a humanized antibody

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977)

to the interIeuki~ 2 receptor with new features for imm~o~herapy in malignant and immune disorders. Cancer Res. 50 (1990) 1495-1502. Kabat, E.A., Wu, T.T., Reid-Mtiiler, M., Perry, H.M. and Gottesman,

5463-5467. S~imizn, A., Kondo, N., Rondo, S., Hamuro, J. and Honjo, T.: Production and characterization of the extracytoplasmic portion of the

K.S.: Sequences of Proteins of Immunological Department of Health and Human Services, National

Institutes

of Health,

Bethesda,

MD,

Interest, 4th ed. U.S. Public Health Service, 1987.

human interleukin 2 receptor. Mol. Biol. Med. 3 (1986) 509-520. Shin, S.-U. and Morrison, S.L.: Production and properties of chimeric antibody

molecules.

Methods

Enzymol.

178 (1989) 459-476.

305 Soulillou,

J.P., Cantarovich,

Hourmant,

M., Hirn,

trial of a monoclona1

D., Le Mauff, B., Giral, M. and Jacques,

antibody

against

M. Robillard,

Y.: Randomized the ~nterleu~n-2

N.,

controlled receptor

(33

B 3.1) as compared with rabbit antilymphocyt~ globulin for prophylaxis against rejection of renal allografts. New England J. Med. 322 (1990) 1175-1182.

complementary

determining

(1984) 5194-519s. Wahlin. B., Perlmann,

region. Proc. Natl. Acad.

H., Perlmann,

P., Schreiber,

RD.

Sci. USA 81 and Miiller-

Eberhard, H.J.: C3 receptors on human lymphocyte subsets and recruitment of ADCC effector cells by C3 fragments. J. Immunol. 130

Southern, P. and Berg, P.: Transformation of mammalian cells to antibiotic resistance with a bacterial gene under the control of the SV40 early

(1983) 2831-2836. Waldmann, T.A.: Multichain interleukin 2 receptor: a target for immunotherapy in lymphoma. J. Natl. Cancer. Inst. 81 (1989) 914-923.

region promoter. J. Mol. Appl. Genet. 1 (1982) 327-341. Steplewski, Z., Sun, L.K., Shearman, C.W., Ghyrayeb, J., Daddona,

Weidle, U.H., Koch, S. and Buckel, P.: Expression of antibody cDNA in murine myeioma cells: possible evolvement of additional regulatory

P.

and Koprowski, H.: Biological activity of human-mouse IgGl, IgG2, IgG3 and IgG4 chimeric monoclonal antibodies with antitumor specificity. Proc. Natl. Acad. Sci. USA 85 (1988) 4852-4856. Takahashi, N., Noma, T. and Honjo, T.: Rearranged immunoglobulin heavy chain variable

region (V,)

pseudogene

that deletes the second

elements 205-216.

in transcription

of immunoglobulin

genes. Gene 60 (1987)

Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved Ml3 phage cloning vectors and host strains: nucleotide sequences of the Ml3mp18

and pUC19

vectors.

Gene 33 (1985) 103-109.