MOLECULAR AND CELLULAR BIOLOGY, Feb. 1991, p. 677487

Vol. 11, No. 2

0270-7306/91/010677-11$02.00/0 Copyright © 1991, American Society for Microbiology

Synergistic Interactions between Transcription Factors Control Expression of the Apolipoprotein Al Gene in Liver Cells RUSSELL L. WIDOM, JOHN A. A. LADIAS, SOPHIA KOUIDOU, AND SOTIRIOS K. KARATHANASIS* Laboratory of Molecular and Cellular Cardiology, Department of Cardiology, Children's Hospital, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02115 Received 15 August 1990/Accepted 8 November 1990

The gene coding for apolipoprotein Al (apoAl), a plasma protein involved in the transport of cholesterol and other lipids in the plasma, is expressed predominantly in liver and intestine. Previous work in our laboratory has shown that different cis-acting elements in the 5'-flanking region of the human apoAl gene control its expression in human hepatoma (HepG2) and colon carcinoma (Caco-2) cells. Hepatocyte-specific expression is mediated by elements within the -256 to -41 DNA region relative to the apoAl gene transcription start site (+1). In this study it was found that the -222 to -110 apoAI gene region is necessary and sufficient for expression in HepG2 cells. It was also found that this DNA region functions as a powerful hepatocyte-specific transcriptional enhancer. Gel retardation and DNase I protection experiments showed that HepG2 cells contain proteins that bind to specific sites, sites A (-214 to -192), B (-169 to -146), and C (-134 to -119), within this enhancer. Site-directed mutagenesis that prevents binding of these proteins to individual or different combinations of these sites followed by functional analysis of these mutants in HepG2 cells revealed that protein binding to any one of these sites in the absence of binding to the others was not sufficient for expression. Binding to any two of these sites in any combination was sufficient for only low levels of expression. Binding to all three sites was essential for maximal expression. These results indicate that the transcriptional activity of the apoAl gene in liver cells is dependent on synergistic interactions between transcription factors bound to its enhancer.

The accumulation and utilization of cholesterol by tissues dependent on a dynamic balance between the mechanisms that determine the rates of de novo cholesterol synthesis, the rates of synthesis and hydrolysis of stored pools of cholesteryl esters, and the rates of uptake and removal of cholesterol from cells by plasma lipoproteins (reviewed in references 4 and 20). Removed cholesterol binds to a species of high-density lipoprotein (HDL) particles containing primarily apolipoprotein AI (apoAI). After its esterification by lecithin:cholesterol acyltransferase (an enzyme activated by apoAI), cholesterol is transported to the liver, where it is excreted either directly or in the form of bile acids (reviewed in references 3, 20, and 24). The critical role of HDL and apoAI in cholesterol homeostasis, and in particular in preventing deposition of excessive amounts of cholesterol in coronary and other arteries, is exemplified by epidemiological and genetic evidence indicating a strong correlation between decreased HDL and apoAI plasma levels and the development of atherosclerotic heart disease (reviewed in references 3, 39, and 51). Thus, the recent observation that there is a direct correlation between apoAI plasma levels and hepatic apoAI mRNA concentrations (54, 55) suggests that factors controlling expression of the apoAI gene in liver could play an important role in tissue cholesterol accumulation and atherosclerosis. Previous studies indicate that expression of the apoAl gene exhibits diverse patterns of tissue-specific, speciesspecific, and temporal regulation during development. In mammals, it is activated in three independent cell lineages: the liver, the gastrointestinal tract, and the visceral yolk sac (14, 22, 37). In rodents 13 to 18 days in utero, the apoAI mRNA concentration increases 10- to 20-fold in the liver but

remains unchanged in the intestine and the visceral yolk sac (14, 37). Immediately following birth, the apoAI mRNA concentration increases abruptly in the intestine but remains unchanged in the liver (14, 22, 45). During prepubertal life, its concentration decreases markedly in the liver but changes very little in the intestine (45, 57). Among different species, the expression of apoAI mRNA varies greatly with regard to both tissue specificity and concentration within a given tissue (reviewed in reference 54). In addition, experiments with adult animals suggest that the transcriptional activity of the apoAl gene in response to dietary fat and cholesterol or thyroid hormone is completely different between liver and intestine (1, 9, 15, 55, 59). Although the mechanisms for this diversity are not understood, recent experimental evidence suggests that transcriptional regulation of the apoAl gene may be involved (45, 56, 59). The frequency of transcription initiation is ultimately determined by specific interactions of DNA-binding proteins with cis-acting regulatory elements arranged in a unique configuration as to type, number, and spatial organization in gene promoter regions (reviewed in references 28, 35, and 40). Previous experiments showed that the -256 to -41 DNA region upstream from the transcription start site (+ 1) of the human apoAI gene contains regulatory elements which are necessary and sufficient for expression in hepatoma (HepG2) cells and in the livers of transgenic mice but are not sufficient for expression in intestinal carcinoma (Caco-2) cells and the intestines of these animals (26, 50, 60). These observations led to the proposal that different regulatory elements acting via alternative transcription-activating pathways play an important role in generation of the diverse patterns of expression of the apoAl gene in different tissues (50, 60). This report shows that activation of the apoAl gene in mammalian liver cells depends on synergistic interactions

are

*

Corresponding author. 677

678

WIDOM ET AL.

between nuclear proteins that bind to three distinct sites within a hepatocyte-specific transcriptional enhancer located between nucleotides -222 to -110 in the apoAI gene 5'flanking region. Each site is inactive on its own and does not activate transcription when it is individually multimerized or when it is combined with other protein-binding sites present in the simian virus 40 (SV40) early promoter. Synergism between these proteins is unlikely to be due to direct interaction with each other facilitating binding to DNA because each binds independently of the others. We speculate that protein-protein interactions between transcription factors bound to specific sites within the apoAl gene enhancer couple this enhancer to the basic transcription machinery.

MATERIALS AND METHODS Plasmid constructions. Essentially all plasmid constructions were done by the general procedures described previously (49). The structures of the resulting constructs were verified by restriction mapping and nucleotide sequencing. The apoAI-chloramphenicol acetyltransferase (CAT) gene constructs -256AL.CAT, -192AL.CAT, -41AI.CAT, and [SV]-41AL.CAT have been previously described (50). Additional constructs were made by cloning several DNA fragments spanning different regions of the apoAI gene 5'-flanking sequences into a BamHI site engineered at the -41 nucleotide position in construct -41AL.CAT (50). To generate fragments with ends compatible with the BamHI site, most of these fragments were first subcloned into the bacteriophage vector M13mp7 and then excised by using the flanking BamHI sites in the polylinker region of the vector. For the construction of -133AI.CAT, a Hinfl-PstI fragment spanning the -366 to -41 region of the apoAl gene was subcloned in the PstI site of M13mp7. The fragment was subsequently excised by digestion of replicative-form DNA from this subclone with BamHI; after digestion at nucleotide position -133 with Sau3A, the -133 to -41 DNA fragment was cloned in the BamHI site of -41AI.CAT. Similarly, for the construction of -256[A-80/-41]AI.CAT, an MspI fragment spanning the -256 to -80 region was subcloned in the AccI site of M13mp7; after its excision by digestion of replicative-form DNA from this subclone with BamHI, the fragment was cloned in the BamHI site of -41AI.CAT. For the construction of -222[A-110/-41]AI.CAT, a synthetic double-stranded oligonucleotide (oligo) spanning the -222 to -110 region of the apoAl gene with ends compatible with the BamHI restriction site was synthesized on a DNA synthesizer (Biosearch model 8600) and cloned into the BamHI site of -41AL.CAT. For the construction of -203[A&-133/ -41]AI.CAT, a Sau3A fragment spanning the -203 to -133 region of the rat apoAl gene (22), the sequence of which is nearly identical to that of the corresponding region in the human apoAl gene (see Fig. 5), was cloned in the BamHI site of -41AL.CAT. For the construction of -256[A&-192/ -41]AI.CAT, a previously described apoAl-CAT gene fusion construct containing approximately 2.5 kb of the apoAl gene 5'-flanking sequences but lacking the -192 to -41 DNA region (construct A-192/-41AI.CAT; 50) was digested at the SmaI sites located at nucleotide position -256 and in the polylinker region 3' to the CAT gene, and the resulting fragment was cloned in pUC9. The ability of various apoAl gene fragments to drive transcription from the heterologous SV40 early promoter was evaluated by using the SV40 early promoter-CAT gene fusion vector, pAlOCATGEM4. pAlOCATGEM4 was con-

MOL. CELL. BIOL.

structed by transferring a SalI-BamHI fragment, which contains the SV40 promoter and the CAT gene, from the previously described vector pAlOCAT2 (32) into pGEM4 (Promega Biotec). pSV2CATGEM4, a vector similar to pA1OCATGEM4 but containing the SV40 enhancer, was constructed by replacing a PvuII fragment that contains the SV40 early promoter and a part of the CAT gene in pAlOCATGEM4 with the corresponding fragment from the previously described vector pSV2CAT (19). Like pAlOCAT2, the pA1OCATGEM4 vector contains a BglII site proximal to the SV40 promoter and a BamHI site distal to this promoter (i.e., at the 3'end of the CAT gene). Several apoAl gene fragments with ends compatible with the BglII and BamHI sites were prepared as described above and cloned into pA1OCATGEM4 in one or multiple copies (see Fig. 2). Mutated versions of the -222 to -110 region in pAlOCATGEM4 were constructed by using the oligo assembly method described previously (29). Seven synthetic oligos spanning the -222 to -110 region, some containing mutations (described below), were mixed in equimolar amounts, phosphorylated with T4 kinase (New England BioLabs), annealed by slow cooling from 65 to 25°C, and ligated into the BglII site of pAlOCATGEM4. Synthetic oligos. Oligos were synthesized on a Biosearch model 8600 DNA synthesizer, deblocked at 55°C, and purified through polyacrylamide gels as described previously (49). Complementary oligos spanning the -222 to -110, -214 to -192 (oligo A), -178 to -148 (oligo B), -136 to -114 (oligo C), -196 to -174 (oligo E), and -155 to -133 (oligo F) apoAl gene upstream region, all containing the tetranucleotide 5'-GATC-3' at their 5' ends, were synthesized, annealed, and used for cloning, for gel retardation, and as competitors in DNase I protection assays (see below). Mutated versions of oligos A, B, and C (oligos Amut, Bmut, and Cmut, respectively) were prepared similarly. The nucleotide substitutions in these oligos are indicated in Fig. 4. The -222 to -110 apoAl gene region was also synthesized by annealing a mixture of three oligos spanning positions -221 to -183, -182 to -148, and -147 to -110 in the coding strand with four oligos spanning positions -221 to -193, -192 to -165, -164 to -129, and -128 to -110 in the noncoding strand. To facilitate cloning, -221 to -183 and -128 to -110 contained the tetranucleotide 5'-GATC-3' at their 5' ends. Mutated versions of the -222 to -110 DNA region were obtained by replacing appropriate oligos by their mutated versions (see Fig. 4) in the annealing mixture. Cell culture, transfections, and CAT assays. Plasmid DNA from the various constructs was prepared and transfected into cultured cells by the calcium phosphate coprecipitation method (21) as described previously (50). All cultured cells were maintained in Dulbecco modified Eagle medium (GIBCO) supplemented with 10% fetal calf serum (Sigma), penicillin, and streptomycin at 37°C in 5% CO2. Human hepatoma (HepG2) cells were seeded at 4 x 106 cells per 100-mm dish, human colon carcinoma (CaCo-2) cells were seeded at 2.5 x 106 cells per 100-mm dish, and other cell types (i.e., HeLa, NIH 3T3, and C2) were seeded at 106 cells per 100-mm dish, 1 day before transfection. To correct for variations in DNA uptake by the cells, 5 ,ug of plasmid pRSV-3-gal (13) was cotransfected with each test construct. Protein extracts from transfected cells were made by three cycles of freeze-thaw as described previously (50). CAT (19) and ,-galactosidase (P-gal) (13) enzyme activities in cell extracts were assayed as previously described, and for each

VOL . 1 l, 1991

APOLIPOPROTEIN Al GENE REGULATION IN LIVER CELLS

experiment the CAT enzymatic activity was normalized to that of a-gal activity. Nuclear extracts. HepG2 nuclear extracts were prepared from 10 confluent 150-mm dishes essentially as described previously (11) except that buffers A and C were supplemented with 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 ,ug each of pepstatin A and leupeptin (Sigma) per ml. Additionally, buffer C contained NaCl at a final concentration of 0.5 M, and buffer D was replaced by a similar buffer, buffer G (20 mM N-2-hydroxyethylpiperazine-N'-2-ethane sulfonic acid [HEPES; pH 7.8], 0.1 M KCI, 0.2 mM EDTA, 1 mM DTT, 1 mM PMSF, 20% glycerol). Aliquots of nuclear extracts were snap-frozen and stored in liquid nitrogen. The protein concentration of extracts was determined by the Lowry assay (34) and was typically 3 to 8 mg/ml. Gel retardation assays. Protein-DNA complexes were analyzed by electrophoresis in low-ionic-strength nondenaturing polyacrylamide gels as described previously (16). Approximately 15 ,ul of HepG2 cell nuclear extracts (10 ,ug of protein) in buffer G was mixed with poly(dI-dC) (2 ,ug; Pharmacia) in a final volume of 28 RI and incubated on ice for 10 min. Then 10 fmol of DNA fragments or synthetic oligos end labeled at their 5' ends with [y-32P]ATP (New England Nuclear) and T4 polynucleotide kinase (New England BioLabs) in 2 ,lI of TE (10 mM Tris, 1 mM EDTA [pH 7.5]) was added, and incubation continued on ice for an additional 30 min. Subsequently 3 ,ul of buffer G supplemented with 60% (wt/vol) sucrose and 0.24% (wt/vol) bromophenol blue was added, and the mixture was loaded on a 4% polyacrylamide gel (80:1 acrylamide:bisacrylamide) made with 0.Sx TBE buffer (1 x TBE is 89 mM Tris base, 89 mM boric acid, and 2 mM EDTA) and electrophoresed for 1.5 h at 200 V, using a Protean II gel apparatus (Bio-Rad Laboratories). Gels were fixed in 10% methanol-10% acetic acid, dried, and exposed with X-ray film overnight at -70°C with intensifying screens. DNase I protection assays. DNase I protection assays were carried out by using as a probe a DNA fragment spanning the -256 to -80 region of the apoAl gene. The fragment was labeled with 32P at the 5' end of either the coding (upper) or noncoding (lower) strand as follows. For labeling of the upper strand, plasmid construct -256[A&-80/-41]AI.CAT (see above) was digested at a HindIII site located in the polylinker region of the vector proximal to the -256 nucleotide position of the apoAl gene; after dephosphorylation with bacterial alkaline phosphatase (Bethesda Research Laboratories) and labeling with [y-32P]ATP and T4 polynucleotide kinase, the plasmid was digested at a Sall site in the polylinker region of the vector proximal to the -80 nucleotide position of the apoAl gene. The resulting 176-bp radiolabeled fragment was subsequently isolated by polyacrylamide gel electrophoresis and electroelution onto DEAE filter strips (NA45; Schleicher & Schuell). Labeling of the lower strand was carried out exactly as described above except that digestion with SalI was done prior to labeling and digestion with HindIII was done after labeling. To a volume (usually 10 to 50 RI) of HepG2 nuclear extracts (75 to 120,ig of protein) in buffer G, 0.1 volume of 0.1 mM MgCl2, 0.1 volume of 1-mg/ml poly(dI-dC), and 0.4 volume of 10% polyvinyl alcohol (Sigma) were added, and the mixture was incubated on ice for 5 to 20 min. Then 0.4 volume of TE containing 1 to 2 fmol (approximately 10,000 cpm) of probe was added, and incubation on ice continued for an additional 30 to 40 min. The mixture was subsequently incubated at 25°C for 1 to 3 min; after addition of 0.1 volume of DNase I (25 jLg/ml; Worthington) in 25 mM CaCl2-50 mnM MgCl2,

679

incubation continued at 25°C for 1 min. Then 5 volumes of stop solution (100 mM Tris hydrochloride [pH 8], 100 mM NaCl, 1% sodium dodecyl sulfate [SDS], 10 mM EDTA, 100 ,ug of proteinase K [Boehringer Mannheim] per ml, 25 ,ug of salmon sperm DNA [Sigma] per ml) was added; after incubation of the mixture at 65°C for 15 min, the DNA was purified by phenol extraction and ethanol precipitation and analyzed on 7% polyacrylamide sequencing gels. Sequence coordinates were obtained by running in the same sequencing gel a G+A chemical sequencing ladder (36), using the same end-labeled probe. DNase I digestion patterns in the absence of nuclear extracts were obtained as described above except that 1/10 as much DNase I was used. RESULTS The -222 to -110 apoAl gene region drives expression of the apoAl gene in HepG2 cells. Previous experiments with cultured human hepatoma HepG2 cells (26, 50) and transgenic mice (60) have shown that sequences within the -256 to -41 apoAl gene 5'-flanking region are necessary and sufficient to direct liver-specific expression. To further delineate the regulatory elements present within this region, several 5' and 3' deletions of the -256 to -41 DNA fragrhent were prepared and inserted 41 nucleotides upstream from the transcription start site of the apoAI gene in a vector which contains the -41 to +397 apoAl gene region fused in the same transcriptional orientation with the bacterial CAT gene (vector -41AL.CAT; 50). The resulting plasmid constructs (Fig. 1) were transiently transfected into HepG2 cells; the CAT enzymatic activity in these cells was determined, corrected for variations in DNA uptake by the cells as described in Materials and Methods, and compared with the corrected CAT activity of the vector -41AL.CAT (Fig. 1). Consistent with previous observations (50), the CAT activity of the construct containing the intact -256 to -41 DNA fragment (construct -256AI.CAT) was 60.6 times greater than that of -41AL.CAT and approximately half the activity of a similar construct containing the SV40 enhancer instead of the -256 to -41 DNA fragment (construct [SV]-41AI.CAT). Deletion of 5' seqeunces from -256 to -192 (construct -192AI.CAT) resulted in CAT activity only 22.7 times greater than that of -41AL.CAT, while further deletion to nucleotide -133 resulted in activity very similar to that of -41AL.CAT. Deletion of 3' sequences from -41 to -80 (construct -256[A-80/-41]AI.CAT) resulted in CAT activity 50.2 times greater than that of -41AL.CAT, while further deletions to nucleotides -133 (constrUct -256[A-133/-41]AI.CAT) and -192 (construct -256[A192/-41]AI.CAT) resulted in activities 10.1 and 5.1 times greater, respectively, than that of -41AL.CAT. Similar experiments using DNA fragments spanning different internal regions of the -256 to -41 apoAl 5'-flanking region showed that the CAT activity of a construct containing a fragment that spans the -203 to -133 DNA region (construct -203[A-133/-41]AI.CAT) was only 12.7 times greater than that of -41AI.CAT, while the activity of a construct containing a fragment that spans the -222 to -110 region (construct -222[A-110/-41]AI.CAT) was 57.4 times greater than that of -41AL.CAT (Fig. 1). The CAT activity levels obtained with the vector -41AI.CAT and its derivative constructs reflect rates of transcription initiation from the authentic apoAl gene transcription start site (50; data not shown). These results indicate that sequences within the -110 to -41 DNA region contribute very little to the activity of the

WIDOM ET AL.

680

ApoAl 5' Flanking Region -133 -110 -80

-256 -222 -192 I

-256AI.CAT

CA | 60.6

-192ALCAT

CA

22.7

I'CAT'

0.5

I_I

-133ALCAT

I

41IALCAT

*203[&1331/41J

ALCAT

-256/-41 [

1.0

CAT I 10.1

_

-222/-110

CAT

^. CAT

CAT I 50.2

ALCAT

*222[&-110/-411 ALCAT

Flanking Fragment

-256/80 [

ICATI

-256[AlC-41

.256[&-133/411 ALCAT *256[&-192/-411 ALCAT

ApoAI 5'

CAT Activity

+1 +397

41

5.1

l

CAT i 12.7

T

7

11. 111.8

[SV]-41AI.CAT FIG. 1. Expression of apoAl-CAT fusion genes in hepatoma HepG2 cells. Plasmid constructs with the CAT gene (indicated) under the control of the -41 to +397 apoAl gene region (=) and either several DNA fragments spanning different portions of the -256 to -41 apoAl 5'-flanking region (_) or the SV40 enhancer which contains its 72-bp repeats (large hatched boxes) and 21-bp repeats (small hatched boxes) were tested for CAT activity by transient transfection into HepG2 cells (see Materials and Methods). Each construct (25 p,g) was cotransfected with plasmid pRSV-P-gal (5 ,ug; 13) to correct for variations in DNA uptake by the cells (see Materials and Methods). Relative CAT activity values represent CAT/P-gal enzymatic activity ratios relative to that of construct -41AL.CAT and are averages of at least three independent experiments.

-256 to -41 apoAl 5'-flanking region in HepG2 cells and that nearly all (greater than 90%) of this activity is mediated by sequences within the -222 to -110 DNA region. The -222 to -110 apoAI gene region functions as a hepatocyte-specific transcriptional enhancer. The finding that nearly all of the transcriptional activity of the -256 to -41 apoAI 5'-flanking region in HepG2 cells is mediated by sequences within the -222 to -110 DNA region together with the previous observation that the -238 to -41 apoAl fragment functions as a hepatoma cell-specific transcriptional enhancer (50) raised the possibility that this enhancer activity is mediated by sequences within the -222 to -110 DNA region. To evaluate this possibility, several DNA fragments spanning different portions of the -256 to -41 apoAI 5'-flanking region were inserted in both orientations adjacent to the SV40 early promoter in a CAT expression vector which contains the SV40 early promoter (but not its enhancer) fused in the same transcriptional orientation with the CAT gene (vector pAlOCATGEM4; see Materials and Methods). The resulting constructs were used for CAT expression assays in HepG2 cells. CAT enzymatic activities in these cells were compared with the activity of the vector pAlOCATGEM4. The CAT activities of constructs containing the -256 to -41, -256 to -80, and -222 to -110 DNA fragments were 5.1 to 11.3 times greater than that of pAlOCATGEM4, while the activities of constructs containing the -256 to -133, -203 to -133, and -133 to -42 fragments were very similar to that of pAlOCATGEM4 (Fig. 2). Furthermore, the CAT activities of constructs containing

Relative

CAT Activity 5.1 7.4 4.6

5.2

CAT

10.5

CAT

11.3

PAM-C-AT---M=

3.8

&R-C-ATI=

5.9

CAT 57.4

_

MOL. CELL. BIOL.

19.9 2.0 -256/-133 [

1=:P,,'=-CA..T----l MPM-C-AT-- 1 MRM-C-AT-1 ^'MMM

-203/-133 [

WAI

2.2 1.8 1.9 1.1

-1331J41 [

I

0.7

RM-CAT---l F/F/I=.CAT. V,AZX 9PI

1.0

__N

pA1OCATGEM4 oSV2CATGEM4

r.AT WAI

19.0

FIG. 2. Expression of the CAT gene under the control of the SV40 early promoter and different DNA fragments from the apoAl gene 5'-flanking region. Plasmid constructs with the CAT gene (indicated) under the control of the SV40 early promoter (hatched boxes; see also Fig. 1) and several DNA fragments spanning different portions of the -256 to -41 apoAl gene 5'-flanking region (indicated by filled boxes; arrows indicate the orientation of these fragments relative to apoAl gene transcription) were tested for CAT activity by transfection into HepG2 cells as described in the legend to Fig. 1. Relative CAT activity values represent CAT/,-gal enzymatic activity ratios relative to that of the construct pA1OCATGEM4 and are averages of at least three independent experiments.

the -222 to -110 DNA fragment distal to the SV40 early promoter (i.e., adjacent to the 3' end of the CAT gene) were 3.8 to 5.9 times greater than that of pAlOCATGEM4. In addition, the CAT activities of constructs containing two copies of the -222 to -110 DNA fragment adjacent to the SV40 early promoter were approximately twice that of the construct containing a single copy and nearly identical to that of a similar construct containing the SV40 enhancer instead of the -222 to -110 DNA fragment (construct pSV 2CATGEM4; see Materials and Methods). Thus, the activity of the single-copy -222 to -110 DNA fragment was approximately half of that of the SV40 enhancer irrespective of whether transcription was initiated by the apoAI TATA box (compare the relative CAT activities of constructs -222[A-110/-41]AI.CAT and [SV]-41AL.CAT in Fig. 1) or the SV40 early promoter (Fig. 2). The difference in the magnitude of the relative CAT activity of construct -222[A-110/-41]AI.CAT compared with that of the construct containing the -222 to -110 apoAl gene fragment proximal to the SV40 promoter (Fig. 2) reflects the higher basal activity of the SV40 early promoter compared with

VOL . 1 l,

APOLIPOPROTEIN Al GENE REGULATION IN LIVER CELLS

1991

TABLE 1. Transcriptional activity of the apoAl gene enhancer in different cell typesa Construct HepG2

pSV2CATGEM4 pAlOCATGEM4 -222 to -110 2x -222 to -110

19 1 11 20

Relative CAT activityb C2 Caco-2 NIH 3T3 C2

HeLa

360 1 1.7 4.8

64 1 0.7 2

10 1 1 1

42 1 1 1

a Plasmid constructs containing one (-222 to -110) or two (2x -222 to -110) copies of the apoAl gene enhancer adjacent to and in the same transcriptional orientation with the SV40 early promoter in the vector pAlOCATGEM4 (see Fig. 2) and the constructs pA1OCATGEM4 and pSV2CATGEM4 were tested for CAT activity by transient transfection into the indicated celi types as described in the legend to Fig. 1. b Determined as described in the legend to Fig. 2; average of at least three independent experiments.

construct -41AL.CAT, both of which were used to determine the relative CAT activities values (see Materials and

Methods). To determine whether the enhancer activity of the -222 to -110 DNA fragment, like that of the -238 to -41 DNA fragment (50), is hepatocyte specific, the constructs containing one or two copies of the -222 to -110 DNA fragment adjacent to the SV40 early promoter in pAlOCATGEM4 were used for CAT expression assays by transient transfection into HepG2 cells and several other cultured cell types derived from various nonhepatic tissues. For each cell type, CAT activities were compared with the activity of pAlOCATGEM4. In contrast to HepG2 cells, in which the activities of the constructs containing the -222 to -110 DNA fragment were comparable to that of the construct containing the SV40 enhancer (i.e., pSV2CATGEM4), in all other cell types the activities of these constructs were very similar to that of pAlOCATGEM4 (Table 1). Analogous results have been obtained for several other cultured cells of hepatic and nonhepatic tissue origin (data not shown). These results indicate that the hepatocyte-specific enhancer activity of the -238 to -41 apoAI gene fragment (50) is mediated by sequences within the -222 to -110 DNA region and, together with the results presented in the previous section, suggest that the sequences directing liverspecific expression of the apoAl gene are colocalized with the sequences mediating hepatocyte-specific enhancer activity. Furthermore, the observation that the enhancer activities of the -256 to -41, -256 to -80, and -222 to -110 DNA fragments are greater than the sum of the activities of the -256 to -133 and -133 to -41 fragments suggests that DNA elements 5' and 3' to nucleotide position -133 function together to generate this enhancer activity. Moreover, the observation that two copies of the -222 to -110 fragment mediate twice the enhancer activity of a single copy raises the possibility that transcription factors in HepG2 cells interact with sequences within this fragment and that the local concentration of these factors influences the rate of transcription initiation of the apoAI gene. The absence of enhancer activity of the -222 to -110 DNA fragment in intestinal carcinoma Caco-2 cells, which express high levels of apoAl mRNA (50), indicates that the enhancer activity of this fragment is strictly hepatocyte cell specific and suggests that transcription activation of the apoAI gene in the intestine is most likely mediated by alternative transcriptionactivating pathways (see also references 50 and 60).

681

Nuclear proteins in HepG2 cells bind to distinct sites within the apoAl gene enhancer. The transcriptional activity of the -222 to -110 apoAI gene fragment in hepatocytes raises the possibility that these cells contain transcriptional factors that bind to sequences within this fragment and increase the rate of productive transcription initiation events on the apoAl gene promoter. A search for these factors was initially carried out by gel retardation assays using HepG2 cell nuclear extracts and the -222 to -110 DNA fragment as a probe. Incubation of these extracts with the probe resulted in formation of retardation complexes (Fig. 3A, lane 1) that were competed for by a 50-fold or greater molar excess of unlabeled -222 to -110 DNA fragment (lanes 2 to 4) but not by a 500-fold molar excess of HindIII-digested bacteriophage XDNA (XdIII; lane 5) or several DNA fragments, including the SV40 and cytomegalovirus enhancers, the Rous sarcoma virus long terminal repeat, and a fragment containing the entire human apoAI gene from nucleotide position -42 to the 314th nucleotide 3' to its polyadenylation signal (data not shown). Control experiments indicated that treatment of the extracts with 0.1% SDS or 50 ,ug of proteinase K per ml completely eliminated formation of these complexes, while heating of the extracts at 65°C for 10 min resulted in complexes with greater electrophoretic mobility (data not shown). Thus, it appears that multiple nuclear proteins, some of which are heat resistant, bind to the apoAI gene enhancer. Gel retardation assays using as probes three restriction fragments spanning the -222 to - 189, - 188 to - 146, and - 145 to - 110 regions showed that each of these fragments formed sequence-specific retardation complexes with HepG2 cell nuclear extracts (Fig. 3A, lanes 6 to 14). More precise mapping of the nucleotide sequences involved in these DNA-protein interactions was carried out by DNase I protection assays using the -256 to -80 apoAl gene fragment as a probe. HepG2 cell nuclear proteins protected the following nucleotide regions from digestion by DNase I: -214 to -192, -169 to -146, and -134 to -119 in the coding (upper) strand and -219 to -193, -167 to -151, and -134 to -118 in the noncoding (lower) strand (Fig. 3B). It is also noticeable that these extracts induced DNase I-hypersensitive sites in the upper strand at nucleotide positions -139, -153, and -166 and in the lower strand at positions -160 and -176 (Fig. 3B). Further confirmation of these results was obtained by using three double-stranded synthetic oligos corresponding to the -214 to -192 (oligo A), -178 to -148 (oligo B), and -136 to -114 (oligo C) regions of the apoAl enhancer as probes for gel retardation assays with HepG2 cell nuclear extracts. Each of these oligos formed retardation complexes (Fig. 3D, lanes 1, 8, 15) that were competed for by the corresponding homologous oligos (lanes 2, 11, and 20) but not by two oligos corresponding to the -196 to -174 (oligo E) and -155 to -133 (oligo F) regions which are located between the DNase I protection regions (lanes 3, 5, 10, 12, 17, and 19) or by XdIII or salmon sperm DNA (data not shown). Interestingly, while the retardation complex formed with oligo B was not competed for by either oligo A or C (lanes 9 and 13), the complex formed with oligo A was competed for by oligo C (lane 6) and the complex formed with oligo C was competed for by oligo A (lane 16). Crosscompetition between oligos A and C was also observed in DNase I protection assays. Both DNase I protection regions corresponding to oligos A and C in the -256 to -80 DNA fragment were abolished by excess amounts of either oligo A (Fig. 3C, lane 1) or C (lane 5), while only the protection

682

MOL. CELL. BIOL.

WIDOM ET AL.

A.

-c222 -110

Probe

-189

-110

-NE +NE

Competitor

+ + + -

-

Fold Molar Excess

00

o u

-

00o o L

Ln

-

o a o 0o' _

-

¢,

.

.

,+

+

.

.

. -,

-

C. Lower Strand

Lower Strand

B. Upper Strand

-145/

-188/ -146

-222;

Oligo

-NE +NE

Competitor

A E B F C

+...

00o a

Om

I:* APw

-

A

f

_A

Ic

-R

1...I

.-*d

A

a

S.

B

X. is

so.o..

..,

_- ...

4# -1

4] 2 3 4 5

1

6 7 8

-

D. Probe

I A OLIGO

&|

9 10 11 1213 14

OLIGO B

OLIGO C

a -9

,

I

..

-

Oligo Competitor

-

*

* siS_.

E E E E BFC< - A EB FCm -AEBFCo .

-

,.

___

a

.-

.. A

-

_L ,

4

_

_00

4% 1

2 3 4 5

b (

Am

_.,

..

-

_

am*

_

*

1 2 3 4 5

9Y1U1112131411b516171819U01

E. -22 0

-210

-200

-170

-180

-; 90 I.

-1 60

-140

-150 .

-130

-120

-11 0

.*

7

CCGCCCCCACTGAACCCTTGACCCC_GCCCTWC_C_AGCC_C_CGCAGCTT_TGTTTGCCCACTCTATTGCCA;CCCCAGGACAGAGTGATCCTTGAACTCTTAAGTTCCAC GGCGCGTGACTTG:GAACTGGGACGGAi-- TC 5GGGGCGT.CGAACGACAAACGGGTGAGATAAACGGGTCGGGGTCCCTGTCTCGAC TAGGAACTTGAGAATTCAAGGTG ---

OLIGO A

---

..... .

....A

.

A.

_

OLIGO B

I...................................._ -.......... ..........

OLIGO C

m

OLIGO F OLIGO E FIG. 3. Binding of nuclear proteins in HepG2 cells to distinct sites in the apoAI gene enhancer. (A) Autoradiographs of assays in which several DNA fragments (probes) spanning different sequences in the apoAl gene enhancer (indicated) were end labeled and used for gel retardation assays with HepG2 cell nuclear extracts as described in Materials and Methods. Radioactive bands migrating more slowly than the probes represent DNA-protein complexes (16). The nucleotide sequence specificity for the formation of these complexes was determined by carrying out the DNA-protein binding reactions (see Materials and Methods) in the presence of excess amounts of either the corresponding unlabeled fragment used to prepare each probe or HindlIl-digested bacteriophage X DNA (XdIII) (competitors). The amount of each competitor used is indicated as fold molar excess over the corresponding probe. The amount of XdIII used is equivalent to a 500-fold molar excess of each unlabeled fragment over the corresponding probe. (B) Autoradiographs of assays in which a DNA fragment containing the -256 to -80 apoAl gene 5'-flanking sequences was labeled at the 5' end of either the coding (upper) or noncoding (lower) strand and used for DNase I protection experiments without (-NE) or with (+NE) HepG2 nuclear extracts as described in Materials and Methods. Sites protected by DNase I digestion (A, B, and C) are bracketed and DNase I sites induced by the extracts (DNase I-hypersensitive sites) are indicated by arrowheads. (C) DNase I protection patterns of the -256 to -80 apoAl gene fragment labeled at the 5' end of the lower strand (probe; see panel B) in the presence of a 500-fold molar excess over the probe of various oligo competitors. The sequences in the apoAl gene enhancer spanned by these oligos are indicated in panel E (see also Materials and Methods). (D) Gel retardation assay. Each of the oligos A, B, and C (see panel E and Materials and Methods) was end labeled (probes) and used for gel retardation assays with HepG2 nuclear extracts as described for panel A in the presence of a 100-fold molar excess over the probe of the indicated oligo competitors (see below and Materials and Methods). (E) Nucleotide sequence of the apoAI gene enhancer (region -222 to -110) and summary of the DNase I protection patterns (bracketed) and DNase I-hypersensitive sites (V). Oligos used for the experiments in panels C and D are shown by filled bars under the nucleotide sequence.

VOL. 11, 1991

APOLIPOPROTEIN Al GENE REGULATION IN LIVER CELLS

Site A

-1 -1 90 -200 -210

-220

Site B -170

-180

Site C -150

-160

-130

-140

ActUYtU -110

-120

CcCAmGCCCAG;CCTGCWAcTTGAC ??AAGTTCCAC

CCGcCCCCACTGACCCTTGACCCCCCCOGCCCCcGCAGCTTGCTGTGCCCACc

683

----

-.-

------------CC--------___________________________________________________________________,

----

100.0 28.6 23.8 23.8 5.7 12.3

-

---

11.4

9.5 pA1OC&TGOn4 FIG. 4. Demonstration that nucleotide substitutions in the apoAl gene enhancer reduce its activity in hepatoma HepG2 cells. Plasmid constructs with the CAT gene under the control of the SV40 early promoter (see legend to Fig. 2) and either a fragment containing the -222 to -110 apoAl 5'-flanking region (its nucleotide sequence is shown) or several identical fragments containing nucleotide substitutions (indicated) that eliminate nuclear protein binding (see Fig. 3D) to the corresponding binding sites (indicated; see Fig. 3B) were tested for CAT activity by transfection into HepG2 cells as described in the legend to Fig. 1. All of these fragments were cloned adjacent to and in the same transcriptional orientation with the SV40 early promoter. The CAT/P-gal enzymatic activity ratio of each construct is expressed as a percentage of that obtained with the construct containing the -222 to -110 DNA fragment which has no nucleotide substitutions and is the average of at least three independent experiments.

region corresponding to oligo B was abolished by excess amounts of oligo B (lane 3). As expected, excess amounts of either oligo E or F did not alter the DNase I protection pattern (Fig. 3C, lanes 2 and 4). These results indicate that nuclear proteins in HepG2 cells bind to sequences within three distinct sites, A (-214 to -192), B (-169 to -146), and C (-134 to -119), in the apoAl gene enhancer (Fig. 3E) and that protein binding to each of these sites is independent of protein binding to the others. Furthermore, these results suggest that the same or very similar proteins bind to sites A and C while a different protein binds to site B. Synergistic interactions between nuclear proteins mediate the transcriptional activity of the apoAI enhancer. To determine whether nuclear protein binding mediates the transcriptional activity of the apoAI gene enhancer, nucleotides within each binding site were mutated so that protein binding

is prevented. The activity of enhancer fragments with different combinations of these mutations was then determined by inserting them adjacent to the SV40 promoter in the vector pA1OCATGEM4 and using the resulting constructs for CAT expression assays in HepG2 cells. The choice of nucleotides altered by mutagenesis (Fig. 4) was based on the observations that they are highly conserved in the corresponding nucleotide positions of the rat and chicken apoAl genes (Fig. 5) and that double-stranded oligos similar to oligos A, B, and C containing these mutations (oligos Amut, Bmut, and Cmut, respectively) do not form retardation complexes with HepG2 nuclear extracts (data not shown) and do not compete for binding of nuclear proteins with the corresponding apoAI enhancer sites in either gel retardation (Fig. 3D, lanes 7, 14, and 21) or DNase I protection (data not shown) assays. The results from the CAT expression assays showed that mutagenesis of any single site reduced CAT SITE A

-250 HUMAN RAT

-240

-230

-210

-220

SITE B

-200

CCCGGGAGACCTGCAAGCCTGCAGACACTCCCCTCCCGCCCC

-180

-190

-170

CCTCCCTGCAGCCCCCGCAGC TGCTGTTTGCCA

CCTGGGGACCCTTGGAGTCTGCAGCTACTCCCCGCTGCCCCCAC¶G CCCTTCCA3CTCTGCAGCCCCCGCAGClTCCTGTTTGCCCAICHICKEN CGAGGGGCCCCGGCCGGGCCGGAATTTGGGTCACCCGCAGCGTAAACATCTCCTCGGCCAACGCCGCATCCCCGGGGAGC- CCTG1TTCTo SITE

SITE

B

-160

-150

-140

-130

"CCAAT-BOX"

C -120

-110

-100

-90

RAT CNICICXN

TCTATTTGC -CCCCCAGGGACAGAGCTGATCCTTGAACTCTAAGTCCACATGCCAGGCCAGTGAGCAGC CTCTGTTTGC------------ -CTA- CCTCGGGAACAGAGC- TGATCCTTGAACTCT -AAGT7 CCACAT CGCCAGCAAAAGTAAGCAGT G;CTCTGCAAAGCGGCG;CTCCTTGGCCG;GCTCTCCCGGGGCCGTGCGC*GATCCTTACTCT -ACGCG CACT GCCCGCG;CCGGGAGTGATT

HUMAN RAT

-70 -60 -80 -50 -40 -30 -20 -10 +1 AACAGGGCC--GGGGCTGG BAT CTCCCAGCCCAGACCCTG-GCTGCAGTAATAGGCCCTGCAAGAGCTGGCTGCTTAGAG GACAGGGCC---AGCCGA CTCCAGCCCAGGCCCTG-CCCACACA4ATATATAGGTCAGGGAAGAAGACCTGGACACCCAGACT

HUMAN

*TATA-BOX

CHICKEN TCTTGGGCTGCGGCGCTG

-C STATC ITATGCGGCGGGGGAACCGCGGGCT TCCT-GCGGGGAACTGCCCCTCCT

FIG. 5. Alignment and comparison of the apoAI gene 5'-flanking sequences from different species. The human and rat sequences have been previously reported (22, 50); the chicken sequence was recently determined in our laboratory (32a). Optimal alignments were generated by the NUCALN computer program as described previously (50). Numbers indicate nucleotide positions relative to the human apoAl gene transcription start site (+ 1). Dashes indicate nucleotide deletions introduced to achieve maximal homology. Conserved nucleotide sequence motifs are boxed. Protein-binding sites in the human sequence (sites A, B, and C; see text) are indicated. Arrows indicate direct nucleotide repeats within each of the conserved regions. The typical eukaryotic gene TATA box and a variant form of the CCAAT box are indicated.

684

WIDOM ET AL.

activity to approximately one-third of that of the nonmutated enhancer, while mutagenesis of two sites in any combination resulted in CAT activity similar to that of the vector pA1OCATGEM4 (Fig. 4). Control experiments indicated that mutagenesis of nucleotides between these sites resulted in CAT activity not significantly different than that of the nonmutated enhancer (data not shown). It is therefore clear that binding of nuclear proteins to all three A, B, and C sites in the apoAl gene enhancer is essential for maximal transcriptional activity in HepG2 cells and that binding of any of these proteins to a single site in the absence of binding of the others is not sufficient to generate transcriptional activity. Indeed, the CAT activities of constructs containing multiple copies of oligo A, B, or C either proximal to the SV40 promoter in the vector pA1OCATGEM4 or 41 nucleotides upstream from the transcription start site of the apoAl gene in the vector -41AL.CAT were not significantly different from those of the vectors lacking these oligos in HepG2 cells (data not shown). These results suggest that the transcriptional activity of the apoAl gene enhancer is strongly dependent on synergistic interactions between nuclear proteins bound to its sites A, B, and C in HepG2 cells. In addition, these results indicate that binding of nuclear proteins to any two of these sites results in partial synergism, generating low levels of transcriptional activity, and that binding of nuclear protein(s) to the remaining third site further potentiates this synergism, leading to maximal levels of transcriptional activity. DISCUSSION By its role in cholesterol homeostasis, apoAl may influence diverse cellular processes, including cholesterol synthesis and growth control (reviewed in reference 18). Thus, the mechanisms that generate the diverse patterns of expression of the apoAI gene (see introduction) may be ultimately linked to the mechanisms that regulate these processes. The aim of this study was to delineate the mechanisms that determine the transcriptional activity of the apoAI gene in liver cells. The results show that nearly all of this activity is mediated by a powerful hepatocyte-specific transcriptional enhancer located between nucleotides -222 to -110 in the apoAl gene 5'-flanking region. This enhancer contains three sites, A (-214 to -192), B (-169 to -146), and C (-134 to -119), each of which binds one or more nuclear proteins in HepG2 cells. Proteins bound to these sites act synergistically to stimulate enhancer activity. Occupation of all three of these sites by proteins is essential for maximal activity. Occupation of two sites, in any combination, results in dramatically reduced activity. Occupation of any single site alone is not sufficient for activity. Organization of the apoAI gene enhancer. Alignment and comparison of the apoAl gene 5' flanking sequences in different species (human, rat, and chicken) indicates that several sequence motifs are highly conserved (Fig. 5). In addition to the conservation centered on the typical eucaryotic gene TATA box and a variant form of the CCAAT box, there is a remarkable conservation of sequences contained within sites B and C. Site A, although highly conserved in the human and rat genes, is absent from the corresponding position in the chicken gene. Whether this is related to the different pattern of tissue-specific expression of the apoAl gene in chicken compared with mammals (48) is currently under investigation. These comparisons also reveal that all three sites A, B, and C are structurally bipartite, consisting

MOL. CELL. BIOL.

of two nearly perfect direct tandem repeats (Fig. 5). This structural organization is reminiscent of enhancer modules or protoenhancer elements which are also structurally bipartite, consisting of short DNA sequences, the so-called enhansons (17, 44). Enhansons appear to be the basic units of complex viral and cellular enhancers, and although it has not been proven in every case, they correspond to individual binding sites for transcription factors (reviewed in reference 12). The results in this report do not indicate whether any of sites A, B, and C binds more than one protein. However, in a different series of experiments, we have recently cloned the gene for a protein that binds to sites A and C as a dimer (30). Thus, it seems that these two sites contain at least two enhansons each. Sites A, B, and C have no significant activity on their own even when they are individually multimerized (data not shown). However, their combination, as it occurs in the apoAI gene enhancer, results in very high levels of activity. It therefore appears that the enhansons within each of these sites can function only in combination with a different enhanson. The observation that none of these sites can function in combination with the binding sites for the transcriptional factor Spl, which are present in the SV40 early promoter in the pA1OCATGEM4 vector, suggests that the enhansons in the apoAl gene enhancer are selective with regard to their active combinations with other enhansons. In this context, it is interesting that a regulatory element essential for hepatocyte-specific expression of the apolipoprotein CIII and B genes that shares extensive sequence similarity with sites A and C and competes with them for binding of nuclear proteins stimulates transcription from the adenovirus major late promoter in HepG2 cells (8, 33, 43). Thus, it is possible that the enhansons within sites A and C can combine productively with enhansons present within this promoter. Clearly, determination of productive combinations of the enhansons in the apoAl gene enhancer with other enhansons would require systematic functional studies similar to those used for the glucocorticoid-responsive element enhanson (see, for example, reference 58). Combination of different transcription factors determines the activity of the apoAI gene enhancer in hepatocytes. Recent studies with several liver-specific genes have led to the general concept that a common set of liver-specific transcriptional activators is responsible for coordinate expression of genes in hepatocytes. For example, binding of the transcription factor HNF-1 (7) (also called LF-B1 in reference 23) to the regulatory regions of several liver-specific genes is essential and in certain cases sufficient to drive liver-specific transcription (reviewed in reference 42). It is therefore interesting that a previously identified transcription factor called LF-A1, which is involved in activation of the alantitrypsin gene, binds to site A in the apoAl gene enhancer (23). Since LF-A1 is enriched in liver extracts, it is possible that it plays an important role in the hepatocyte-specific expression of the apoAl gene enhancer. However, several observations argue against this possibility. First, in contrast to site A, the LF-Al-binding site of the al-antitrypsin gene in conjunction with an Spl-binding site is sufficient to stimulate liver-specific expression from heterologous promoters (41). Second, gel retardation and DNase I protection assays indicate that in addition to LF-A1, site A binds other nuclear proteins present in a wide variety of nonhepatic tissues; in fact, it binds several distinct members of a subfamily of the steroid/thyroid hormone receptor superfamily of transcription factors present in liver cells (30). Finally, the sequence 5'-TGAACCCTTGACCCCTG-3' present in

VOL . 1 l, 1991

APOLIPOPROTEIN Al GENE REGULATION IN LIVER CELLS

site A shows extensive similarity to the sequence 5'TGAACCTTGCCTAGGG-3' present in the binding site of HNF-4, a hepatocyte-enriched factor that plays a critical role in transthyretin gene expression (6). Indeed, in preliminary experiments we have determined that the recently cloned HNF-4 (53) binds to site A, and in cotransfection experiments HNF-4 activates constructs containing one or multiple copies of site A (60a). Thus, the heterogeneity of proteins that bind to site A suggests that this site may be an important target for modulation of expression of the apoAl gene by diverse signals. This interpretation, however, obscures the identity of the protein or proteins that by binding to this site contribute to the activation of the apoAl gene in liver cells. The nucleotide sequence of site C is very similar to that of site A (see Fig. 5), and the cross-competition experiments in Fig. 3 suggest that identical or very similar proteins in HepG2 cells bind to both of these sites. However, DNase I protection experiments indicate that in contrast to site A, which binds nuclear proteins present in both hepatic and nonhepatic cells, site C binds proteins present only in hepatic cells (30). It is therefore not clear whether these sites bind the same or different proteins in HepG2 cells. It is noteworthy that in cotransfection experiments, increasing amounts of site C, but not site A, reduce the expression of apoAl gene constructs in HepG2 cells (data not shown). This finding may suggest that in these cells the proteins that bind to site C are different from those that bind to site A. It is possible that liver-specific expression of the apoAI gene is mediated, at least in part, by the protein(s) that binds to site B. Indeed, nuclear extracts from nonhepatic tissues do not protect site B from digestion by DNase I (30). Interestingly, as mentioned previously, site B is composed of two tandem repeats -174-CTG1TTGCCCA-164 and -161-CTAJT1'GCCCA-151 (see Fig. 5), each of which differs by only one or two nucleotides (underlined) from a sequence 5'-CTGATTGCCCA-3' present within an avid binding site for the transcription factor C/EBP, a liverenriched factor involved in expression of several liverspecific genes (2, 25, 27, 52). In addition to this homology and despite the observation that Cos-1 cell-produced C/EBP binds to an oligonucleotide spanning site B, DNase I protection experiments indicate that C/EBP does not protect site B from digestion by DNase I and that competition with excess amounts of an oligonucleotide containing the C/EBP-binding site does not eliminate DNase I protection of site B by HepG2 nuclear extracts (unpublished results). Thus, although it is possible that C/EBP plays a role in determination of the liver-specific expression of the apoAl gene enhancer, it appears that additional factors that bind to site B, either alone or in combination with C/EBP (see, for example, reference 38), are involved. It should also be noted that although there is a limited sequence similarity between sites B and C and the binding site for HNF-3, a family of hepatocyte-enriched factors involved in the expression of transthyretin, al-antitrypsin, and a-fetoprotein genes (6, 31), it is unlikely that the protein that binds to site B or site C is HNF-3. This argument is based on the observation that in contrast to sites B and C, the HNF-3-binding site stimulates transcription in HepG2 cells (6). Clearly then, as with many other genes, hepatocyte-specific expression of the apoAl gene is determined not by a single cell-specific transcription factor but rather by multiple factors, some of which appear to be cell specific. In conclusion, transcription factors bound to sites A, B, and C in the apoAl gene enhancer function synergistically to

685

stimulate transcription. It is unlikely that this synergism results from interaction of these proteins with each other facilitating binding to DNA because each binds independently of the others. It is possible that synergism results from direct interactions of each of these proteins with the basal transcription machinery or from indirect interactions involving non-DNA-binding proteins (see, for example, references 5, 46, and 47). Since it seems that multiple proteins can bind to each of sites A, B, and C, several different combinations of these proteins on the apoAl gene enhancer are possible. It is therefore conceivable that alterations in the intracellular concentration of one or more of these proteins would favor one combination over the others, which could alter the transcriptional activity of the enhancer. For example, overexpression of a gene coding for one of the proteins that bind to both sites A and C dramatically depresses transcription of the apoAl gene in HepG2 cells but has no effect on the transcriptional activity of the thymidine kinase promoter even when site A is linked in cis proximal to this protomer (30). The involvement of a complex network of multiple proteins that bind to apoAl gene enhancer could generate at least a part of the versatility of transcriptional control required for the diversity of expression of the apoAl gene during development and in response to dietary and hormonal factors. ACKNOWLEDGMENTS We thank Demetrios Demopulos for carrying out certain transient expression experiments presented in this report. We also thank Frances Sladek and James Darnell, Jr. for providing an HNF-4 cDNA clone, Steven L. McKnight for providing a C/EBP clone used for some of the experiments, Bernado Nadal-Ginard and Vijak Mahdavi for critically reviewing the manuscript, and Emily FlynnMcIntosh for the artwork. This work was supported by the Public Health Service grant HL32032 from the National Institutes of Health. S.K.K. is an Established Investigator of the American Heart Association. REFERENCES 1. Apostolopoulos, J. J., G. J. Howlett, and N. Fidge. 1987. Effects of dietary cholesterol and hypothyroidism on rat apolipoprotein mRNA metabolism. J. Lipid Res. 28:642-648. 2. Birkenmeier, E. H., B. Gwynn, S. Howard, J. Jerry, J. I. Gordon, W. H. Landschultz, and S. L. McKnight. 1989. Tissuespecific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev. 3:1146-1156. 3. Breslow, J. L. 1989. Familial disorders of high density lipoprotein metabolism, p. 1251-1266. In C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle (ed.), The metabolic basis of inherited disease. McGraw-Hill Book Co., New York. 4. Brown, M. S., and J. L. Goldstein. 1983. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annu. Rev. Biochem. 52:223-261. 5. Carey, M., Y.-S. Lin, M. R. Green, and M. Ptashne. 1990. A mechanism for synergistic activation of a mammalian gene by GAL4 derivatives. Nature (London) 345:361-364. 6. Costa, R. H., D. R. Grayson, and J. E. Darnell, Jr. 1989. Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and al-antitrypsin genes. Mol. Cell. Biol. 9:1415-1425. 7. Courtois, G., J. G. Morgan, L. A. Campbell, G. Fourel, and G. R. Crabtree. 1987. Interaction of a liver-specific nuclear factor with the fibrinogen and al-antitrypsin promoters. Science 238:688-692. 8. Das, H. K., T. Leff, and J. L. Breslow. 1988. Cell type-specific expression of the human apoB gene is controlled by two

686

WIDOM ET AL.

cis-acting regulatory regions. J. Biol. Chem. 263:11452-11458. 9. Davidson, N. O., R. C. Carlos, M. J. Drewek, and T. G. Parmer. 1988. Apolipoprotein gene expression in the rat is regulated in a tissue-specific manner by thyroid hormone. J. Lipid Res. 29: 1511-1522. 10. Dickson, P. W., G. J. Howlett, and G. Schreiber. 1985. Rat transthyretin (prealbumin) molecular cloning, nucleotide sequence and gene expression in liver and brain. J. Biol. Chem. 260:8214-8219. 11. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract isolated from mammalian nuclei. Nucleic Acids Res. 11:1475-1489. 12. Dynan, W. S. 1989. Modularity in promoters and enhancers. Cell 58:1-4. 13. Edlund, T., M. D. Walker, P. J. Barr, and W. J. Rutter. 1985. Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements. Science 230:912-916. 14. Elshourbagy, N. A., M. S. Boguski, W. S. L. Liao, L. S. Jefferson, J. I. Gordon, and J. M. Taylor. 1985. Expression of rat apolipoprotein A-IV and A-I genes: mRNA induction during development and in response to glucocorticoids and insulin. Proc. Natl. Acad. Sci. USA 82:8242-8246. 15. Ertel Miller, J. C., R. K. Barth, P. H. Shaw, R. W. Elliott, and N. D. Hastie. 1983. Identification of a cDNA clone for mouse apolipoprotein A-I (apoA-I) and its use in characterization of apo A-I mRNA expression in liver and small intestine. Proc. Natl. Acad. Sci. USA 80:1511-1515. 16. Fried, M., and D. M. Crothers. 1981. Equilibria and kinetics of Lac repressor operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res. 9:6505-6525. 17. Fromental, C., M. Kanno, H. Nomiyama, and P. Chambon. 1988. Cooperativity and hierarchical levels of functional organization in the SV40 enhancer. Cell 54:943-953. 18. Goldstein, J. L., and M. S. Brown. 1990. Regulation of the mevalonate pathway. Nature (London) 343:425-430. 19. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 20. Gotto, A. M., H. J. Pownall, and R. J. Havel. 1986. Introduction to the plasma lipoproteins. Methods Enzymol. 128:3-41. 21. Graham, F. L., and A. J. van der Eb. 1973. A new technique for assay of infectivity of human adenovirus 5 DNA. Virology 52:456-467. 22. Haddad, I. A., J. M. Ordovas, T. Fitzpatrick, and S. K. Karathanasis. 1986. Linkage, evolution and expression of the rat apolipoprotein A-I, C-IlI, and A-IV genes. J. Biol. Chem.

261:13268-13277. 23. Hardon, E. M., M. Frain, G. Paonessa, and R. Cortese. 1988. Two distinct factors interact with the promoter regions of several liver-specific genes. EMBO J. 7:1711-1719. 24. Havel, R. J., and J. P. Kane. 1989. Structure and metabolism of plasma lipoproteins, p. 1129-1138. In C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle (ed.), The metabolic basis of inherited disease. McGraw-Hill Book Co., New York. 25. Herbst, R. S., N. Friedman, J. E. Darnell, Jr., and L. E. Babiss. 1989. Positive and negative regulatory elements in the mouse albumin enhancer. Proc. Natl. Acad. Sci. USA 86:1553-1557. 26. Higuchi, K., S. W. Law, J. M. Hoeg, U. K. Schumacher, N. Meglin, and H. B. Brewer, Jr. 1988. Tissue-specific expression of apolipoprotein A-I (apoAl) is regulated by the 5'-flanking region of the human apoA-I gene. J. Biol. Chem. 263:1853018536. 27. Howell, B. W., M. Lagace, and G. C. Shore. 1989. Activity of the carbamyl phosphate synthetase I promoter in liver nuclear extracts is dependent on a cis-acting C/EBP recognition element. Mol. Cell. Biol. 9:2928-2933. 28. Johnson, P. F., and S. L. McKnight. 1989. Eukaryotic transcriptional regulatory proteins. Annu. Rev. Biochem. 58:799-839. 29. Karlsson, O., T. Edlund, J. B. Moss, W. J. Rutter, and M. D. Walker. 1987. A mutational analysis of the insulin gene transcriptional control region: expression in beta cells is dependent on two related sequences within the enhancer. Proc. Natl.

MOL. CELL. BIOL. Acad. Sci. USA 84:8819-8823. 30. Ladias, J. A. A., and S. K. Karathanasis. Science, in press. 31. Lai, E., V. R. Prezioso, E. Smith, 0. Litvin, R. H. Costa, and J. E. Darnell, Jr. 1990. HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev. 4:1427-1436. 32. Laimins, L. A., G. Khoury, C. Gorman, B. Howard, and P. Gruss. 1982. Host specific activation of transcription by tandem repeats from simian virus 40 and Moloney murine sarcoma virus. Proc. Natl. Acad. Sci. USA 79:6453-6457. 32a.Lamon-Fava, S., et al. Unpublished data. 33. Leff, T., K. Reue, A. Melian, H. Culver, and J. L. Breslow. 1989. A regulatory element in the apoCIII promoter that directs hepatic specific transcription binds to proteins in expressing and nonexpressing cell types. J. Biol. Chem. 264:16132-16137. 34. Lowry, 0. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275. 35. Maniatis, T., S. Goodbourn, and J. A. Fischer. 1987. Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1245. 36. Maxam, A., and W. Gilbert. 1980. Sequencing end-labeled DNA. Methods Enzymol. 65:499-560. 37. Meehan, R. R., D. P. Barlow, R. E. Hill, B. L. M. Hogan, and N. D. Hastie. 1984. Pattern of serum protein gene expression in mouse visceral yolk sac and foetal liver. EMBO J. 3:1881-1885. 38. Metzger, S., T. Leff, and J. L. Breslow. 1990. Nuclear factors AF-1 and C/EBP bind to the human apoB gene promoter and modulate its transcriptional activity in hepatic cells. J. Biol. Chem. 265:9978-9983. 39. Miller, E. M. 1987. Associations of high-density lipoprotein subclasses and apolipoproteins with ischemic heart disease and coronary atherosclerosis. Am. Heart J. 113:589-597. 40. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371-378. 41. Monaci, P., A. Nicosia, and R. Cortese. 1988. Two different liver-specific factors stimulate in vitro transcription from the human al-antitrypsin promoter. EMBO J. 7:2075-2087. 42. Nicosia, A., P. Monaci, L. Tomei, R. De Francesco, M. Nuzzo, H. Stunnenberg, and R. Cortese. 1990. A myosin-like dimerization helix and an extra-large homeodomain are essential elements of the tripartite DNA binding structure of LFB1. Cell 61:12251236. 43. Ogami, K., M. Hadzopoulou-Cladaras, C. Cladaras, and V. I. Zannis. 1990. Promoter elements and factors required for hepatic and intestinal transcription of the human apoCIII gene. J. Biol. Chem. 265:9808-9815. 44. Ondek, B., L. Gloss, and W. Herr. 1988. The SV40 enhancer contains two distinct levels of organization. Nature (London) 333:40-45. 45. Panduro, A., F. Shalaby, and D. A. Shafritz. 1987. Changing patterns of transcriptional and post-transcriptional control of liver-specific gene expression during rat development. Genes Dev. 1:1172-1182. 46. Ptashne, M. 1988. How eukaryotic transcriptional activators work. Nature (London) 335:683-689. 47. Pugh, B. F., and R. Tjian. 1990. Mechanism of transcriptional activation by Spl: evidence for coactivators. Cell 61:1187-1197. 48. Rajavashisth, T. B., P. A. Dawson, D. L. Williams, J. E. Shackelford, H. Lebherz, and A. J. Lusis. 1987. Structure, evolution, and regulation of chicken apolipoprotein A-I. J. Biol. Chem. 262:7058-7065. 49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 50. Sastry, K. N., U. Seedorf, and S. K. Karathanasis. 1988. Different cis-acting DNA elements control expression of the human apolipoprotein Al gene in different cell types. Mol. Cell. Biol.

8:605-614. 51. Schaefer, E. J. 1984. Clinical, biochemical, and genetic features in familial disorders of high density lipoprotein deficiency. Arteriosclerosis 4:303-322.

VOL. 11, 1991

APOLIPOPROTEIN Al GENE REGULATION IN LIVER CELLS

52. Sierra, F., F. Taimone, C. R. Mueler, and U. Schibler. 1990. Differential in vitro transcription from the promoter of a rat alpha 2u globulin gene in liver and spleen nuclear extracts. Mol. Biol. Med. 7:131-146. 53. Sladek, F. M., W. Zhong, E. Lai, and J. E. Darneil, Jr. Genes Dev., in press. 54. Sorci-Thomas, M., M. M. Prack, N. Dashti, F. Johnson, L. L. Rudel, and D. L. Williams. 1988. Apolipoprotein (Apo) A-I production and mRNA abundance explain plasma apoA-I and high density lipoprotein differences between two nonhuman primate species with high and low susceptibilities to dietinduced hypercholesterolemia. J. Biol. Chem. 263:5183-5189. 55. Sorci-Thomas, M., M. M. Prack, N. Dashti, F. Johnson, L. L. Rudel, and D. L. Williams. 1989. Differential effects of dietary fat on the tissue-specific expression of the apolipoprotein A-I gene: relationship to plasma concentration of high density lipoproteins. J. Lipid Res. 30:1397-1403. 56. Spiegelberg, T., and J. 0. Bishop. 1988. Tissue-specific gene

687

hepatocytes cultured in growth-restricting medium. Mol. Cell. Biol. 8:3338-3344. 57. Staels, B., J. Auwerx, L. Chan, A. van Tol, M. Rosseneu, and G. Verhoeven. 1989. Influence of development, estrogens, and food intake on apolipoprotein A-I, A-Il, and E mRNA in rat liver and intestine. J. Lipid Res. 30:1137-1145. 58. Strahle, U., W. Schmid, and G. Shutz. 1988. Synergistic action of the glucocorticoid receptor with transcription factors. EMBO J. 7:3389-3395. 59. Strobl, W., N. L. Gorder, Y.-C. Lin-lee, A. M. Gotto, Jr., and W. Patsch. 1990. Role of thyroid hormones in apolipoprotein A-I gene expression in rat liver. J. Clin. Invest. 85:659-667. 60. Walsh, A., Y. Ito, and J. L. Breslow. 1989. High levels of human apolipoprotein A-I in transgenic mice result in increased plasma levels of small high density lipoprotein (HDL) particles comparable to human HDL3. J. Biol. Chem. 264:6488-6494. 60a.Yamashita, Y., et al. Unpublished data. expression in mouse