RESEARCH ARTICLE

crossm Suppressor Mutations Linking gpsB with the First Committed Step of Peptidoglycan Biosynthesis in Listeria monocytogenes Jeanine Rismondo,a Jennifer K. Bender,b Sven Halbedela FG11 Division of Enteropathogenic Bacteria and Legionella, Robert Koch Institute, Wernigerode, Germanya; FG13 Nosocomial Pathogens and Antibiotic Resistances, Robert Koch Institute, Wernigerode, Germanyb

ABSTRACT The cell division protein GpsB is a regulator of the penicillin binding

protein A1 (PBP A1) in the Gram-positive human pathogen Listeria monocytogenes. Penicillin binding proteins mediate the last two steps of peptidoglycan biosynthesis as they polymerize and cross-link peptidoglycan strands, the main components of the bacterial cell wall. It is not known what other processes are controlled by GpsB. L. monocytogenes gpsB mutants are unable to grow at 42°C, but we observed that spontaneous suppressors correcting this defect arise on agar plates with high frequency. We here describe a first set of gpsB suppressors that mapped to the clpC and murZ genes. While ClpC is the ATPase component of the Clp protease, MurZ is a paralogue of the listerial UDP–N-acetylglucosamine (UDPGlcNAc) 1-carboxyvinyltransferase MurA. Both enzymes catalyze the enolpyruvyl transfer from phosphoenolpyruvate to UDP-GlcNAc, representing the first committed step of peptidoglycan biosynthesis. We confirmed that clean deletion of the clpC or murZ gene suppressed the ΔgpsB phenotype. It turned out that the absence of either gene leads to accumulation of MurA, and we show that artificial overexpression of MurA alone was sufficient for suppression. Inactivation of other UDP-GlcNAcconsuming pathways also suppressed the heat-sensitive growth of the ΔgpsB mutant, suggesting that an increased influx of precursor molecules into peptidoglycan biosynthesis can compensate for the lack of GpsB. Our results support a model according to which PBP A1 becomes misregulated and thus toxic in the absence of GpsB due to unproductive consumption of cell wall precursor molecules.

Received 12 May 2016 Accepted 16 October 2016 Accepted manuscript posted online 24 October 2016 Citation Rismondo J, Bender JK, Halbedel S. 2017. Suppressor mutations linking gpsB with the first committed step of peptidoglycan biosynthesis in Listeria monocytogenes. J Bacteriol 199:e00393-16. https://doi.org/ 10.1128/JB.00393-16. Editor Piet A. J. de Boer, Case Western Reserve University School of Medicine Copyright © 2016 American Society for Microbiology. All Rights Reserved. Address correspondence to Sven Halbedel, [email protected].

IMPORTANCE The late cell division protein GpsB is important for cell wall biosyn-

thesis in Gram-positive bacteria. GpsB of the human pathogen L. monocytogenes interacts with one of the key enzymes of this pathway, penicillin binding protein A1 (PBP A1), and influences its activity. PBP A1 catalyzes the last two steps of cell wall biosynthesis, but it is unknown how GpsB controls PBP A1. We observed that a L. monocytogenes gpsB mutant forms spontaneous suppressors and have mapped their mutations to genes mediating and influencing the first step of cell wall biosynthesis, likely stimulating the influx of metabolites into this pathway. We assume that GpsB is important to ensure productive incorporation of cell wall precursors into the peptidoglycan sacculus by PBP A1. KEYWORDS GpsB, MurA, UDP-N-acetylglucosamine, PBP A1, peptidoglycan, UDP-N-acetylglucosamine

T

he cell wall represents the outmost layer of the bacterial envelope in Gram-positive bacteria. It confers rigidity and shape to their cells and provides a platform for incorporation of many molecules, e.g., proteins and wall teichoic acids, which need to be presented on the bacterial surface (1–3). The Gram-positive cell wall consists of a January 2017 Volume 199 Issue 1 e00393-16

Journal of Bacteriology

jb.asm.org 1

Rismondo et al.

Journal of Bacteriology

multilayered mesh of peptidoglycan strands, which are polymers of disaccharide units composed of N-acetylglucosamine and N-acetylmuramic acid connected to short oligopeptide side chains. Neighboring peptidoglycan chains are cross-linked with each other via these peptide chains (1, 4). The peptidoglycan disaccharides with the peptide side chains represent the basic building block during bacterial peptidoglycan synthesis. They are produced in the cytoplasm and are later translocated out of the cell by enzymes called flippases (5, 6). Incorporation of the precursor molecules into growing peptidoglycan chains and chain cross-linking is then mediated by high-molecularweight penicillin binding proteins (HMW PBPs) on the extracellular side (7). HMW PBPs are transmembrane proteins composed of short cytosolic N-terminal tails, a single transmembrane domain, and large extracellular regions that fold into separate domains. While class A HMW PBPs are bifunctional enzymes that have a transglycosylase domain for incorporation of disaccharide units into peptidoglycan chains and a transpeptidase domain for chain cross-linking, class B HMW PBPs are monofunctional enzymes that are transpeptidases (7). The human pathogen Listeria monocytogenes expresses two bifunctional PBPs (PBP A1 and PBP A2) and three monofunctional HMW PBPs (PBP B1 to B3) (8, 9). We have recently shown that an interaction with the GpsB cell division protein is required for activity of PBP A1 (10). However, it is not known how GpsB controls PBP A1 activity. GpsB is a DivIVA-like cell division protein that consists of an N-terminal lipid binding domain fused to a C-terminal coiled coil domain (11). GpsB interacts with the membrane and accumulates at the site of cell division and at the lateral parts of Bacillus subtilis, L. monocytogenes, and Streptococcus pneumoniae cells (10–14). Both membrane and PBP A1 binding sites of L. monocytogenes GpsB are located in the N-terminal GpsB domain. This domain is a coiled coil dimer, the N-terminal extensions of which cross each other at the tip of the molecule and fold back onto the dimeric structure (10). Membrane binding of this structure is achieved by hydrophobic and electrostatic interactions of surface-exposed amino acid side chains with the plasma membrane (10, 15). Among the most conserved regions in the N-terminal GpsB domain is a surface groove that is present twice per N-terminal domain dimer, and this region was identified as the PBP A1 interaction site (10). The C-terminal GpsB domain forms a parallel three-helix bundle. Full-length GpsB is a tripod-like hexamer in which two such C-terminal domain trimers interact with each other and form the tripod base, whereas three dimeric N-terminal domains are arranged as the arms of the tripod (10, 16). Six PBP A1 binding sites are present in such a GpsB hexamer, which has stimulated speculations that GpsB may help in PBP A1 clustering or may link PBP A1 with other proteins (10). An L. monocytogenes ΔgpsB mutant is unable to grow at all at 42°C (10), whereas a mutant lacking pbpA1 has only a slight growth defect under this condition (9). This suggests that GpsB is likely involved in processes beyond PBP A1-dependent peptidoglycan biosynthesis in L. monocytogenes. This assumption is in good agreement with observations made in B. subtilis and S. pneumoniae, where GpsB contributes to the control of serine threonine kinases that phosphorylate cell division proteins (13, 17). Here we tried to identify new GpsB-dependent factors in L. monocytogenes and made use of the fact that viable suppressors arise with high frequency when a L. monocytogenes ΔgpsB mutant is streaked on agar plates at 42°C, under which conditions the ΔgpsB mutant cannot grow (10). We isolated a set of such suppressor mutants and mapped their mutations to the clpC and murZ genes. The ClpC protein is a component of the ClpCP protease and is involved in protein degradation upon exposure to heat stress (18, 19). In addition to MurA (encoded by the lmo2526 gene), MurZ (lmo2552) is one of the two UDP-N-acetylglucosamine 1-carboxyvinyltransferases that mediate the transfer of an enolpyruvate moiety from phosphoenolpyruvate to UDP-GlcNAc. This reaction is the first committed step of peptidoglycan biosynthesis (20). The clpC and murZ genes were deleted from the ΔgpsB chromosome, and this confirmed that the inactivation of either gene is sufficient to suppress the heat-sensitive ΔgpsB phenotype. In contrast, deletion of the murA gene, encoding the paralogue of murZ, was not January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 2

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

FIG 1 Suppression of the ΔgpsB phenotype by shg suppressors. Shown is growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), shg4 (ΔgpsB clpC R254S), shg7 (ΔgpsB murZ1–99), and shg9 (ΔgpsB murZ1–253) in BHI broth at 37°C (A) and 42°C (B). Experiments were performed twice, and results of one representative experiment are shown.

possible, and experiments with a conditional murA mutant confirmed the importance of murA for growth of L. monocytogenes. We noticed that artificial overexpression of MurA was sufficient to suppress the ΔgpsB phenotype during these experiments, and we discovered that MurA levels were elevated in clpC and murZ mutant strains, which explains the suppressing effect of mutations in these genes. Our results suggest that MurA is a substrate of ClpC and that the MurA levels respond to the availability of the MurZ protein. More importantly, they also indicate that increased influx of precursor molecules into peptidoglycan biosynthesis suppresses the heat-sensitive phenotype of the ΔgpsB mutant. The observation that genetic inactivation of other UDP-GlcNAcconsuming pathways also suppressed the heat-sensitive growth of the ΔgpsB strain is in good agreement with this idea. Our results show that the ΔgpsB phenotype, which is at least in part due to misregulation of PBP A1, mediating the last two steps in peptidoglycan biosynthesis, can be suppressed by two different mechanisms, both acting on the first committed step of this pathway. RESULTS Mutations that restore the growth defects of the L. monocytogenes ⌬gpsB mutant. Previous work has shown that the L. monocytogenes ΔgpsB mutant has a growth defect in brain heart infusion (BHI) broth at 37°C and is unable to grow at all at 42°C (10). Consequently, this strain is unable to form colonies at 42°C when streaked on solid BHI agar plates; however, it readily forms suppressors that overcome this growth defect with high frequency. Several suppressor strains (shg4, shg7, and shg9 [where “shg” represents suppression of heat-sensitive growth]) were isolated. These isolates stably maintained the ability to compensate for the growth defect of the ΔgpsB mutant at 37°C and even grew as normally as the wild type at 42°C in liquid BHI medium (Fig. 1). In order to identify the suppressing mutations, genomes of all three suppressor strains were sequenced using the Illumina sequencing technology and the resulting reads were mapped to the reference genome sequence of EGD-e (21). As a control, the genome of the parental ΔgpsB mutant was included in this analysis. This identified one mutation in each clone that was absent from the parental ΔgpsB strain. Strain shg4 had an R254S exchange in the clpC gene (lmo0232; 74-fold coverage, 98.6% allele frequency), coding for the ATPase subunit of the Clp protease. Strain shg7 had two additional nucleotides inserted into the murZ gene (lmo2552; 153-fold coverage, 98.7% allele frequency), which encodes one of the two UDP-N-acetylglucosamine 1-carboxyvinyltransferases present in L. monocytogenes. This insertion occurred after nucleotide 298 of the murZ gene and caused a frameshift that led to formation of a truncated MurZ peptide composed of the first 99 MurZ codons fused to 39 additional amino acids before the new stop codon. In strain shg9, the C757 murZ nucleotide was January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 3

Rismondo et al.

Journal of Bacteriology

changed into T757, causing a premature stop codon at position 253 (120-fold coverage, 99.2% allele frequency). This truncation removed most of the C-terminal domain of MurZ. Suppression of the ⌬gpsB growth defects by murZ mutations. As a first way to test the biological relevance of the identified shg mutations, we tested their possible dominance over the ΔgpsB phenotype. For this purpose, the clpC R254S, murZ1–99, and murZ1–253 alleles were reintroduced into ΔgpsB mutant LMJR19 (still containing the chromosomal clpC and murZ genes, respectively) to facilitate their ectopic expression. Growth of the resulting strains was then analyzed in BHI broth containing 1 mM IPTG (isopropyl-␤-D-thiogalactopyranoside) at 37 and 42°C. This demonstrated that ectopic expression of clpC R254S does not alter the growth pattern of ΔgpsB mutant strain LMJR89 (ΔgpsB clpC R254S) at either temperature in comparison to the ΔgpsB LMJR19 mutant (see Fig. S1A and B in the supplemental material). Likewise, expression of the murZ1–99 allele did not suppress the growth defects of ΔgpsB mutant strain LMJR94 (ΔgpsB murZ1–99) at all (Fig. S1A and B). In contrast, expression of murZ1–253 in ΔgpsB mutant strain LMJR95 (ΔgpsB murZ1–253) partially corrected the growth defects associated with deletion of gpsB (Fig. S1A and B). A control experiment showed that ectopic expression of the wild-type murZ allele in strain LMJR107 (ΔgpsB murZ) did not change the growth pattern of the ΔgpsB mutant (Fig. S1C and D). This shows that the presence of the murZ1–253 mutation at an ectopic site exerts a dominant effect over the wild-type murZ allele. MurA proteins such as MurZ consist of N-terminal and C-terminal globular domains connected by a linker region, and the substrate binding site lies in a cavity between them (22). The premature stop codon in the murZ1–253 gene causes loss of most of the C-terminal domain and thus should render the protein catalytically inactive. It seems possible that the presence of the MurZ1–253 peptide interferes with the function of wild-type MurZ through a physical but unproductive interaction. This consideration and the isolation of the murZ1–99 mutation suggested that the complete removal of murZ would also suppress the ΔgpsB-associated growth defects. In order to test this hypothesis, the murZ gene was deleted in wild-type and ΔgpsB mutant backgrounds. The murZ gene is the last open reading frame of the tetracistronic lmo2555 lmo2554 lmo2553 murZ operon (23); thus, murZ mutations should be without polar effects on downstream genes. The ΔmurZ single mutant (strain LMJR104) grew as fast as the wild type at 37°C and at 42°C (Fig. 2A and B). As expected, introduction of the ΔmurZ deletion into the ΔgpsB background led to almost wild-type-like growth patterns of the resulting LMJR103 ΔgpsB ΔmurZ double mutant strain at both temperatures (Fig. 2A and B). Taken together, the results of these experiments show that inactivation of murZ suppresses the growth defects associated with the ΔgpsB deletion. Growth of the ⌬gpsB mutant is sensitive to levels of MurA. The other UDP-Nacetylglucosamine 1-carboxyvinyltransferase of L. monocytogenes, MurA, is encoded by the lmo2526 gene and equivalent to the essential MurAA enzyme of B. subtilis (72% identity). Note that the name “MurA” has been assigned to two L. monocytogenes gene products. The UDP-N-acetylglucosamine 1-carboxyvinyltransferase MurA (lmo2526), which was studied here, is different from the peptidoglycan hydrolase MurA (NamA), which is encoded by the lmo2691 gene (24). Hence, the name MurA always refers to the UDP-N-acetylglucosamine 1-carboxyvinyltransferase in the context of the current article. We were unable to delete murA from the L. monocytogenes EGD-e genome, suggesting that murA may represent an essential gene in L. monocytogenes as well. In order to test whether MurA depletion suppresses the ΔgpsB growth defect, strains allowing IPTG-dependent murA expression were constructed. Strain LMJR123 (ImurA; “I” denotes an IPTG-inducible allele) was pregrown in the presence of IPTG and used to inoculate a fresh culture without IPTG. Absence of the inducer clearly retarded growth at 37°C and prevented multiplication at 42°C. In contrast, no growth defects were observed in the presence of IPTG (Fig. 3A and B). This is in good agreement with the idea of the essentiality of murA at 42°C, while background murA expression might account for the residual growth of the depleted LMJR123 culture at 37°C. In contrast, January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 4

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

FIG 2 Suppression of the ΔgpsB growth defect by murZ and clpC deletions. (A and B) Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR104 (ΔmurZ), and LMJR103 (ΔgpsB ΔmurZ) in BHI broth at 37°C (A) or 42°C (B). (C and D) Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR138 (ΔclpC), and LMJR139 (ΔgpsB ΔclpC) in BHI broth at 37°C (C) or 42°C (D). Experiments were repeated three times, and average values and standard deviations are shown.

depletion of MurA from LMJR122 cells (ΔgspB ImurA mutant) prevented growth at 37°C completely (Fig. 3A). This indicates that the ΔgpsB mutant is hypersensitive to depletion of MurA and may indicate a functional connection between the two proteins. MurA enzymes can be inhibited by fosfomycin, which covalently binds to a catalytic cysteine in the active center of the protein (22). The increased fosfomycin susceptibility of the ΔgpsB mutant confirmed that the ΔgpsB mutant strain is hypersensitive to reduction of MurA activity (Fig. 3C). In contrast, the susceptibility of the ΔgpsB mutant to cycloserine, inhibiting formation and dimerization of D-alanine, and to bacitracin, interfering with recycling of bactoprenol, was only slightly and nonsignificantly increased (Fig. 3C). Remarkably, addition of IPTG enabled strain LMJR122 (ΔgspB ImurA mutant) to grow again at 42°C (Fig. 3B). This was completely unexpected, since the ΔgpsB mutant cannot grow under this condition. We reasoned that this phenomenon might be explained by overexpression of MurA from the inducible Phelp promoter in the presence of IPTG and tested this hypothesis by Western blotting. The results clearly showed that MurA levels in strains LMJR123 (ImurA mutant) and LMJR122 (ΔgspB ImurA mutant) exceeded the endogenous MurA levels considerably during growth at 37°C (9.5-fold ⫾ 5.2-fold and 4.2-fold ⫾ 2.4-fold, respectively) when their MurA expression was induced with 1 mM IPTG (Fig. 3D). At the same time, the amount of MurA was not significantly reduced in the ΔgpsB mutant (0.7-fold ⫾ 0.2-fold, P ⬎ 0.05) (Fig. 3D). The minimal IPTG concentration required for suppression in strain LMJR122 (ΔgpsB ImurA mutant) was 0.05 mM (Fig. S2A). MurA accumulated to approximately one-third of its maximal induction level at this IPTG concentration during growth at 37°C, but its level was similar to that of the wild type at 42°C (Fig. S2B and C). These data suggest that enhanced MurA levels can suppress the growth defects of the ΔgpsB mutant, even though smaller MurA induction ratios are sufficient at higher temperature. In order to show that MurA overexpression is sufficient to cause this effect, an IPTG-inducible allele of MurA was introduced into the attB tRNAArg site of the ΔgpsB January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 5

Rismondo et al.

Journal of Bacteriology

FIG 3 The ΔgpsB mutant is hypersensitive to depletion of MurA. (A and B) Effect of MurA depletion on growth of the L. monocytogenes ΔgpsB mutant. Strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR123 (ImurA [IPTG-inducible murA strain; this syntax is used throughout the article to designate conditional mutants that lack the chromosomal murA gene but have an IPTG-controlled murA allele at an ectopic site elsewhere in the chromosome]), and LMJR122 (ΔgpsB ImurA) were grown in BHI broth with or without 1 mM IPTG at 37°C (A) and 42°C (B). Experiments were repeated three times, and average values and standard deviations are indicated. (C) Sensitivity of the ΔgpsB mutant to antibiotics acting on cell wall biosynthesis during growth at 37°C. Diameters of growth inhibition zones formed around filter discs soaked with fosfomycin (10 mg/ml), cycloserine (10 mg/ml), and bacitracin (20 mg/ml) solutions are expressed as average values from an experiment performed in triplicate (n. s., not statistically significant). Standard deviations are indicated. (D) Western blot showing MurA expression levels in the same set of strains as described for panels A and B. Bacteria were cultivated in BHI broth with or without 1 mM IPTG at 37°C to an OD600 of 1.0, total cellular proteins were isolated, and MurA was visualized by immunostaining after Western blotting. Equal amounts of total protein were loaded onto the gel. Quantification of the signal intensities is shown in the diagram above the blot. Average values and standard deviations were calculated from experiments repeated three times. The wild-type value was arbitrarily set to 1.

mutant that still contained the endogenous murA gene (strain LMJR117). This strain showed the typical growth pattern of a ΔgpsB mutant at 37°C and 42°C in the absence of IPTG (Fig. 4A and B). When expression of the ectopic MurA was induced, these growth defects were suppressed, albeit not completely (Fig. 4A and B). In contrast, overexpression of MurA in a wild-type background (LMJR116) was without effect (Fig. 4A and B) and Western blotting confirmed IPTG-dependent overexpression of MurA (11.7-fold ⫾ 7.1-fold for LMJR116 and 10.8-fold ⫾ 6.7-fold for LMJR117) in these strains (Fig. 4C). As expected, MurA overexpression considerably reduced the sensitivity of both strains to fosfomycin, confirming the role of MurA in fosfomycin resistance (Fig. S3). Remarkably, suppression of the ΔgpsB growth defect was less efficient in strain LMJR117 (ΔgpsB⫹murA) (Fig. 4B) than in strain LMJR122 (ΔgpsB ImurA) (Fig. 3B) despite stronger induction of MurA (10.8-fold ⫾ 6.7-fold for LMJR117 versus 4.2-fold ⫾ 2.4-fold for LMJR122). Possibly, MurA overproduction has negative effects on growth when it exceeds certain induction ratios. Also, in this experiment, no decrease of the MurA level in the ΔgpsB mutant was detected (1.1-fold ⫾ 0.3-fold) (Fig. 4C). We conclude that overexpression of MurA is sufficient to suppress the ΔgpsB growth defect. January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 6

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

FIG 4 Overexpression of MurA is sufficient to suppress the L. monocytogenes ΔgpsB growth defect. (A) Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR116 (wt⫹murA), and LMJR117 (ΔgpsB⫹murA) in BHI broth with or without 1 mM IPTG at 37°C. (B) Growth of the same strains under identical conditions but at 42°C. Experiments were repeated three times, and average values and standard deviations are shown. (C) Western blot showing MurA expression levels in the same set of strains. Bacteria were cultivated in BHI broth with or without 1 mM IPTG at 37°C to an OD600 of 1.0, total cellular proteins were isolated, and MurA was visualized by immunostaining after Western blotting. Equal amounts of total protein were loaded onto the gel. Quantification of the signal intensities is shown in the diagram above the blot. Average values and standard deviations were calculated from three consecutive experiments. The wild-type value was arbitrarily set to 1.

Suppression of the ⌬gpsB phenotype by deletion of clpC. B. subtilis MurAA is a substrate of the ClpCP protease (25). Therefore, it seems likely that deletion of clpC or the clpC R254S mutation found in strain shg4 would cause accumulation of MurA in L. monocytogenes and thus suppression of the ΔgpsB growth defect. To test this hypothesis, the clpC gene was removed in the wild-type background and the ΔgpsB background and growth of the resulting strains was analyzed in BHI broth at 37°C and at 42°C. Growth of the ΔclpC mutant (strain LMJR138) was somewhat retarded compared to that of the wild type during cultivation at both temperatures (Fig. 2C and D). In contrast to the ΔgpsB strain, which cannot grow at 42°C, the ΔgpsB ΔclpC double mutant strain (LMJR139) could grow as fast as the ΔclpC single mutant and almost as fast as the wild type under this condition (Fig. 2D). That deletion of clpC restores growth of the ΔgpsB mutant strengthens the idea that MurA is a ClpC substrate in L. monocytogenes, too. In order to confirm accumulation of MurA in cells lacking the clpC gene, MurA levels were visualized in cell extracts of strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR138 (ΔclpC), and LMJR139 (ΔgpsB ΔclpC) and the shg4 suppressor strain (ΔgpsB clpC R254S) by Western blotting. As expected, increased MurA levels were detected in all clpC mutant strains, with induction values ranging from 7.2-fold ⫾ 2.3-fold (shg4) to 10.6-fold ⫾ 4.2-fold (LMJR138) (Fig. 5A). That MurA levels of the shg4 strain were increased similarly January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 7

Rismondo et al.

Journal of Bacteriology

FIG 5 MurA and ClpC expression in gpsB, clpC, and murZ mutants. (A and B) Western blot showing MurA levels (A) and ClpC levels (B) in shg suppressors with mutations in clpC (shg4) or murZ (shg7 and shg9) as well as in mutants lacking gpsB (LMJR19), clpC (LMJR138), or murZ (LMJR104) or combinations thereof (LMJR103 [ΔgpsB ΔmurZ] and LMJR139 [ΔgpsB ΔclpC]). Strain LMJR123 (ImurA) was included as a specificity control. All strains were cultivated in BHI broth (with or without 1 mM IPTG) at 37°C and harvested at an OD600 of 1.0. Total cellular proteins were separated by SDS-PAGE, and MurA and ClpC were visualized after blotting using polyclonal antisera against B. subtilis MurAA and ClpC, respectively. Equal amounts of total protein were loaded onto the gel. Quantifications of the signal intensities are shown in the diagrams below the two blots. Average values and standard deviations were calculated from experiments repeated three times. The wild-type values were arbitrarily set to 1. (C) Northern blot detecting murA transcript levels in the same set of strains. Total RNA was isolated and separated as described in Materials and Methods, and murA transcripts were visualized by hybridization with a murA-specific riboprobe. Signals were quantified as described above. (D) Transcriptional organization of the murA locus. According to transcriptome sequencing (RNA-Seq) data (23), the murA and lmo2527 genes are transcribed as monocistronic mRNAs, whereas the mbl and fabZ genes form a bicistronic operon. The murA mRNA is indicated, as well as the position of the murA riboprobe. January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 8

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

FIG 6 UDP–N-acetylglucosamine-consuming reactions in L. monocytogenes EGD-e according to data from the KEGG pathway database (http://www.genome.jp/kegg/pathway.html). Inactivation of the underlined enzymes suppresses the growth defects of the ΔgpsB mutant. The gene encoding UDP–Nacetylglucosamine 2-epimerase MnaA (lmo2537) is an essential gene and cannot be deleted (26). WTA, wall teichoic acids.

to those of the ΔclpC deletion strains indicates that the R254S mutation inactivates the ClpC protein. Remarkably, MurA levels were also increased in strains with mutations or deletions in murZ (Fig. 5A). Their MurA induction values ranged between 9.4-fold ⫾ 4.4-fold (ΔmurZ) and 11.7-fold ⫾ 4.9-fold (shg9) and were thus in the same range as those observed with the clpC mutants. Despite overexpression of MurA, fosfomycin sensitivity was not reduced or was reduced only partially in strains with clpC or murZ mutations, suggesting that the two mutations have reverse MurA-independent effects on fosfomycin resistance (Fig. S3). While MurA accumulation in the clpC mutants can be explained by ClpCP-dependent degradation of MurA, this seems not to be the case for the murZ mutants, as their ClpC levels had not changed from the wild-type levels at all (Fig. 5B). To test the possibility that accumulation of MurA in ΔclpC and ΔmurZ mutant strains is due to transcriptional induction of the murA gene, a Northern blot experiment was performed with the same set of strains. This revealed the existence of a murA transcript at the expected size of 1.5 kb. Expression of murA was slightly (1.4-fold ⫾ 0.2-fold) induced in the ΔgpsB mutant and modestly (0.6-fold to 0.8-fold) reduced in all other tested strains (Fig. 5C). This shows that MurA accumulation cannot be the result of induced murA transcription in these mutants and rather results from posttranscriptional effects such as reduced degradation rates, at least in strains where clpC is defective. Increased UDP-GlcNAc levels are sufficient for suppression of the ⌬gpsB phenotype. Overexpression of MurA through inactivation of clpC and murZ may cause stimulation of cell wall biosynthesis by increasing the metabolic flux into the peptidoglycan biosynthetic pathway. Similarly, cell wall biosynthesis may also be stimulated by increased concentrations of UDP-GlcNAc, which is the initial metabolite of this pathway. In addition to MurA and MurZ, there are three more UDP-GlcNAcconsuming enzymes present in L. monocytogenes (Fig. 6): (i) the essential MnaA protein (encoded by the lmo2537 gene) for the conversion of UDP-GlcNAc into UDP-N-acetylmannosamine, which is part of the teichoic acid linkage unit (26, 27); (ii) the wall teichoic acid glycosylation protein GtcA (encoded by lmo2549) (28, 29); and (iii) the glycosyltransferase encoded by the lmo2550 gene which is—as GtcA— also required for decoration of wall teichoic acids with GlcNAc (29). We assumed that—for the reasons described above— deletion of gtcA or lmo2550 possibly suppresses the ΔgpsB growth defects as well. To test this idea, both genes were deleted in wild-type and ΔgpsB mutant backgrounds and growth of the resulting strains was analyzed in BHI broth at 37°C and at 42°C. As can be seen in Fig. 7A, deletion of gtcA in the wild type had no effect on growth of strain LMJR174 (ΔgtcA) at 37°C but compensated for the growth defect associated with deletion of gpsB in strain LMJR170 (ΔgpsB ΔgtcA) almost completely. Deletion of gtcA in the wild-type background also did not impair growth of strain LMJR174 (ΔgtcA) at 42°C but partially restored growth of ΔgpsB ΔgtcA double mutant strain LMJR170 (Fig. 7B). Likewise, deletion of the lmo2550 gene in the ΔgpsB backJanuary 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 9

Rismondo et al.

Journal of Bacteriology

FIG 7 Suppression of the L. monocytogenes ΔgpsB phenotype by deletion of gtcA and lmo2550. (A and B) Suppression of the L. monocytogenes ΔgpsB phenotype by deletion of the gtcA gene. Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR174 (ΔgtcA), and LMJR170 (ΔgpsB ΔgtcA) in BHI broth was performed at 37°C (A) and 42°C (B). (C and D) Suppression of the L. monocytogenes ΔgpsB phenotype by deletion of the lmo2550 gene. Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR156 (Δlmo2550), and LMJR157 (ΔgpsB Δlmo2550) in BHI broth was performed at 37°C (C) and 42°C (D). All experiments were repeated three times, and average values and standard deviations are shown. (E) MurA expression in ΔgtcA and Δlmo2550 mutant strains of L. monocytogenes. Total cellular proteins of strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR174 (ΔgtcA), LMJR170 (ΔgpsB ΔgtcA), LMJR156 (Δlmo2550), and LMJR157 (ΔgpsB Δlmo2550) were subjected to Western blotting to detect expression of MurA. Strains LMS57 (ΔpbpA1) and LMJR38 (ΔgpsB ΔpbpA1) were also included. Equal amounts of total protein were loaded onto the gel. Quantification of the signal intensities is shown in the diagram below the blot. Average values and standard deviations were determined from experiments repeated three times. The wild-type value was arbitrarily set to 1.

ground (LMJR157) caused partial suppression of the growth defects of the ΔgpsB mutant at 37°C and at 42°C (Fig. 7C and D), even though these effects were less prominent than those observed with gtcA. MurA levels are not elevated in mutants lacking gtcA or lmo2550 (P ⬎ 0.05) (Fig. 7E), demonstrating that these effects were MurA January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 10

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

independent and suggesting that increased UDP-GlcNAc levels per se could be sufficient to suppress the growth defects caused by gpsB deletion. Remarkably, the fosfomycin resistance of ΔgtcA or Δlmo2550 mutants was increased compared to the levels seen with wild-type or ΔgpsB mutant cells (Fig. S3). Raised UDP-GlcNAc levels should increase fosfomycin resistance; thus, this result is in good agreement with the assumption of UDP-GlcNAc accumulation upon deletion of gtcA or lmo2550. Simultaneous deletion of lmo2550 and gtcA in the ΔgpsB mutant (strain LMS202, ΔgpsB Δlmo2550gtcA) did not further restore growth of the ΔgpsB mutant compared to ΔgpsB ΔgtcA strain LMJR170, suggesting that the capacity of this suppression mechanism to cure the deleterious effects of the ΔgpsB deletion on growth is limited (Fig. S4A and B). It was shown earlier that deletion of pbpA1 suppresses the growth defect of the ΔgpsB mutant at 42°C as well (10). Presumably, PBP A1 is misregulated in the absence of GpsB and incorporates cell wall material at the wrong sites, causing toxicity. We have tested whether absence of pbpA1 causes MurA accumulation, but this is not the case (P ⬎ 0.05) (Fig. 7E). However, absence of pbpA1 reduced fosfomycin sensitivity in wild-type cells, possibly due to reduced metabolic flux through peptidoglycan biosynthesis. In contrast, the fosfomycin sensitivity of the ΔgpsB mutant was not affected by deletion of pbpA1 (Fig. S3). This was unexpected, but it may indicate that GpsB could also affect other lipid IIconsuming proteins such as PBP A2 or the FtsW proteins, which were recently shown to act as transglycosylases as well, at least in Escherichia coli (30). Taken together, three modes of suppression of the gpsB phenotype exist: (i) mutations causing MurA accumulation (murZ and clpC), (ii) mutations affecting the UDP-GlcNAc pool without accumulation of MurA (gtcA and lmo2550), and (iii) mutations in pbpA1 itself. DISCUSSION Mutations affecting an enzymatic reaction which is part of a multistep biosynthetic or signaling pathway can sometimes be suppressed by compensatory mutations in the same pathway. This principle has been used to identify unknown components of biological pathways and to uncover genetic linkages between genes of interest and other cellular processes (31). Here we used such a suppressor screening approach to uncover genes whose function is linked to GpsB. According to genetic data, PBP A1, catalyzing the last two steps in peptidoglycan biosynthesis, is misregulated in the absence of GpsB (10). GpsB interacts with PBP A1, and this interaction is required for PBP A1 function (10). PBP A1 is one of two bifunctional penicillin binding proteins in L. monocytogenes (8, 32), and at least one of them, either PBP A1 or PBP A2, must be present for viability (9). PBP A1 seems to be important for cell wall biosynthesis during cell division, since deletion of the pbpA1 gene clearly caused cell elongation, whereas deletion of pbpA2 did not cause such an effect (9). GpsB binds the cytosolic N terminus of PBP A1 through a conserved groove. Thus, the GpsB hexamer is able to interact with up to six PBP A1 molecules, at least theoretically (10), but whether such dodecameric GpsB6:PBPA16 complexes really exist in vivo has not been clear to date. An interaction between GpsB and PBP A2 has not been described, and a ΔgpsB ΔpbpA2 double deletion is lethal, whereas a ΔgpsB ΔpbpA1 double mutant is viable (10). As at least PBP A1 or PBP A2 must be functional, this strongly indicates that PBP A2 does not require GpsB to be functional. Probably, GpsB dependence is one major difference between these two homologues. The results reported here further support the idea of a role of GpsB in cell wall biosynthesis. One set of gpsB suppressor mutations, i.e., mutations in clpC and murZ, causes overexpression of MurA, catalyzing the first step of peptidoglycan biosynthesis (33, 34). ClpC is an ATPase and part of the ClpCP protease complex that degrades various substrates in response to changing growth conditions (19). Among the substrates of the B. subtilis ClpCP protease is MurAA (25, 35), which is one of two paralogous UDP-GlcNAc 1-carboxyvinyltransferase enzymes in B. subtilis and is equivalent to L. monocytogenes MurA, while its paralogue (MurAB) is equivalent to L. monocytogenes MurZ. During entry into stationary phase, a B. subtilis clpC mutant accumulates MurAA that normally would be degraded in wild-type cells (25, 35). MurA January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 11

Rismondo et al.

Journal of Bacteriology

strongly accumulates in L. monocytogenes clpC mutants, indicating that MurA is a ClpCP substrate in L. monocytogenes as well. ClpCP substrates other than MurA are not required for clpC-mediated suppression of the ΔgpsB growth defect, since artificial overexpression of MurA alone was sufficient for suppression of this ΔgpsB phenotype. First-committed-step enzymes of many different biosynthetic pathways are typically degraded by Clp proteases, at least in B. subtilis (35). Thus, it does not seem very likely that overexpression of other cell wall biosynthetic enzymes would also rescue the ΔgpsB growth defect. Interestingly, deletion of murZ causes a similar degree of MurA overexpression and this cannot be explained by transcriptional induction of the murA gene. The underlying regulatory mechanism is unclear. MurA and MurZ supposedly catalyze the same reaction, but they cannot compensate for each other, as indicated by the essentiality of murA at 42°C. Likewise, overexpression of MurZ does not cure the ΔgpsB growth defect (see Fig. S1 in the supplemental material), whereas overexpression of MurA clearly does. The two B. subtilis MurA enzymes also cannot replace each other (25), even though their counterparts are interchangeable in other Gram-positive bacteria such as S. pneumoniae or Staphylococcus aureus (36, 37). The physiological reaction of L. monocytogenes cells in response to murZ deletion is overexpression of MurA. This suggests that the two enzymes in fact mediate the same reactions and implies the possibility that there is a sensing mechanism that adjusts the cellular MurA amount to precursor and/or metabolite levels in the peptidoglycan biosynthesis pathway. This sensing mechanism likely acts on the posttranscriptional level, since the amounts of murA mRNA are not increased in ΔmurZ mutants. That MurZ does not compensate for the absence of MurA could have different reasons: (i) the murZ transcript or the MurZ enzyme might be stable only under specific conditions; (ii) MurZ could be unable to interact with the other cytosolic enzymes involved in peptidoglycan biosynthesis (MurB, MurC, MurD, MurE, and MurF), which might form a multiprotein complex with MurA; or (iii) MurZ might have a lower activity than MurA. With gtcA and lmo2550, we identified a second class of ΔgpsB suppressor genes. Inactivation of both genes suppressed the ΔgpsB growth defects, even though only partially. Both proteins consume UDP-GlcNAc for decoration of wall teichoic acids with GlcNAc (29), and their inactivation could cause an excess of intracellular UDP-GlcNAc. We assume that increased UDP-GlcNAc levels would have effects on peptidoglycan biosynthesis in ΔgpsB cells similar to those seen with induction of the UDP-GlcNAc 1-carboxyvinyltransferase MurA. In the end, both adjustments would increase the metabolite flux through the first reaction of this pathway. Thus, a defect at the end of cell wall biosynthesis can be corrected by activation of the first step of this pathway. How the levels of peptidoglycan precursor intermediates are changed in the ΔgpsB mutant is not known. The increased fosfomycin resistance of the ΔgpsB mutant indicates that the UDP-GlcNAc/UDP-MurNAc pool could be depleted in the absence of GpsB. However, increased susceptibilities of the ΔgpsB mutant to cycloserine or bacitracin were not observed, suggesting that the levels of later intermediates of peptidoglycan biosynthesis were unchanged. Possibly, the reaction mediated by MurA represents the rate-limiting step for the whole pathway. Moreover, MurA enzymes are subject to feedback inhibition by UDP-MurNAc, the product of the next reaction mediated by MurB (38). Massively increased MurA levels could relieve the firstcommitted-step reaction from negative-feedback control. Our results further support a model in which PBP A1 is misregulated in the absence of GpsB. Misregulated PBP A1 molecules could cause unproductive consumption of peptidoglycan precursors that are not incorporated or not correctly incorporated into the cell wall sacculus. This defect can either be suppressed by deletion of the pbpA1 gene itself, as we have shown earlier (10), or be compensated by mutations that increase the influx of precursor molecules into the peptidoglycan biosynthetic pathway, as suggested by the results shown here. At least five enzymes compete for UDP-GlcNAc in L. monocytogenes (Fig. 6), and all five are involved in either peptidoglycan formation (MurA and MurZ) or biosynthesis of January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 12

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

TABLE 1 Plasmids and strains used in this study Plasmid or strain Plasmids pIMK3 pMAD pSH246 pJR58 pJR63 pJR64 pJR67 pJR68 pJR71 pJR82 pJR127 pJR130 pJR144 pSH475

Relevant characteristics

Reference or sourcea

Phelp-lacO lacI neo bla erm bgaB bla erm bgaB ΔgpsB (lmo1888) Phelp-lacO-clpC R254S lacI neo Phelp-lacO-murZ1–99 lacI neo Phelp-lacO-murZ1–253 lacI neo bla erm bgaB ΔmurA (lmo2526) bla erm bgaB ΔmurZ (lmo2552) Phelp-lacO-murZ lacI neo Phelp-lacO-murA lacI neo bla erm bgaB ΔclpC (lmo0232) bla erm bgaB Δlmo2550 bla erm bgaB ΔgtcA (lmo2549) bla erm bgaB Δlmo2550-gtcA

39 40 10 This This This This This This This This This This This

L. monocytogenes strains EGD-e LMJR19 LMS57 LMJR38 shg4 shg7 shg9 LMJR89 LMJR94 LMJR95 LMJR103 LMJR104 LMJR107 LMJR116 LMJR117 LMJR122 LMJR123 LMJR138 LMJR139 LMJR156 LMJR157 LMJR170 LMJR174 LMS201 LMS202

Wild-type serovar 1/2a strain ΔgpsB (lmo1888) ΔpbpA1 (lmo1892) ΔgpsB ΔpbpA1 ΔgpsB clpC R254S ΔgpsB murZ1–99 ΔgpsB murZ1–253 ΔgpsB attB::Phelp-lacO-clpC R254S lacI neo ΔgpsB attB::Phelp-lacO-murZ1–99 lacI neo ΔgpsB attB::Phelp-lacO-murZ1–253 lacI neo ΔgpsB ΔmurZ ΔmurZ ΔgpsB attB::Phelp-lacO-murZ lacI neo attB::Phelp-lacO-murA lacI neo ΔgpsB attB::Phelp-lacO-murA lacI neo ΔgpsB ΔmurA attB::Phelp-lacO-murA lacI neo ΔmurA attB::Phelp-lacO-murA lacI neo ΔclpC ΔgpsB ΔclpC Δlmo2550 ΔgpsB Δlmo2550 ΔgpsB ΔgtcA ΔgtcA Δlmo2550-gtcA ΔgpsB Δlmo2550-gtcA

21 10 9 10 This work This work This work pJR58 ¡ LMJR19 pJR63 ¡ LMJR19 pJR64 ¡ LMJR19 pJR68 ↔ LMJR19 pJR68 ↔ EGD-e pJR71 ¡ LMJR19 pJR82 ¡ EGD-e pJR82 ¡ LMJR19 pJR67 ↔ LMJR117 pJR67 ↔ LMJR116 pJR127 ↔ EGD-e pJR127 ↔ LMJR19 pJR130 ↔ EGD-e pJR130 ↔ LMJR19 pJR144 ↔ LMJR19 pJR144 ↔ EGD-e pSH475 ↔ EGD-e pSH246 ↔ LMS201

work work work work work work work work work work work

aThe

arrow stands for a transformation event, and the double arrow indicates gene deletions obtained by chromosomal insertion and subsequent excision of pMAD plasmid derivatives (see Materials and Methods for details).

wall teichoic acids (MnaA, GtcA, and Lmo2550). Distribution of the available GlcNAc between these reactions must be balanced in a way that ensures the right ratio of peptidoglycan formation to wall teichoic acid production. As the two pathways share the same precursor, any change of metabolic flux through one of these pathways has the potential to affect metabolic flux through the other. It is tempting to speculate that teichoic acid synthesis is also affected in the ΔgpsB mutant, explained through this simple biochemical connection of the two pathways. MATERIALS AND METHODS Bacterial strains and growth conditions. All strains used in this study are listed in Table 1. Strains of L. monocytogenes were cultivated in BHI broth or on BHI agar plates. Generally, strains were cultured overnight in BHI broth at 37°C and used as the inoculum for experiments performed at various temperatures the next morning. Where required, antibiotics and supplements were added at the following concentrations: erythromycin at 5 ␮g/ml, kanamycin at 50 ␮g/ml, X-Gal (5-bromo-4-chloro-3indolyl-␤-D-galactopyranoside) at 100 ␮g/ml, and IPTG at different concentrations. E. coli TOP10 was used as standard cloning host (41). General methods, manipulation of DNA, and oligonucleotide primers. Standard methods were used for transformation of E. coli and isolation of plasmid DNA (41). Transformation of L. monocytogenes January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 13

Rismondo et al.

Journal of Bacteriology

TABLE 2 Oligonucleotides used in this study Oligonucleotide JR159 JR160 JR167 JR168 JR173 JR174 JR175 JR176 JR179 JR180 JR183 JR184 JR189 JR190 JR270 JR271 JR272 JR273 JR280 JR281 JR282 JR283 JR286 JR287 SHW662 SHW663 SHW664 SHW665 SHW742 SHW743

Sequence (5= ¡ 3=) GCGCCTGCAGGATGTTTGGACGATTTACGCAAAGAGCTC GCGCGTCGACTTATTTAGCTTTTACTTTTTTAGAGGTTGTTTTC GCGCCCATGGCTACGGATAGATTAATTATTCAAGGTGGC GCGCGTCGACTTAGATATTTGTTTCTGCTGTACTACTACG CGCGGGATCCCCACTAGTTGCTCCACTTAAAATCGAC GCGCCCATGGCTCCTTGACATGCAGTACCGATTG CGCGGGATCCGCGATGGTCGTGCTGAACTTTTTAG GCGCGGAATTCGGAACTGACTACATCCGCTTTTACAG TTGAATTTAGAAGTCGACCAAAAAGAACCCCTCCGCGTTAC GGGTTCTTTTTGGTCGACTTCTAAATTCAAATGTTGAAAACCGTATC TAATTATTAGATGTCGACCACAACGTACCCTTCTTTCTTGAAG GGTACGTTGTGGTCGACATCTAATAATTAGAGGCTGAGCGAAACAAC CGCGCCATGGAAAAAATTATTGTACGCGGTGG GCGCGTCGACTTAGAATAAAGACGCTAAGTTTGTTAC GCGCGGATCCGATGAATAAGAGTGAATATGGTGCGG GCGCGTCGACCATCATTGTTGTTTCCTCCTTATCG GCGCGTCGACTAAGTAGAAAGCCTTCCTTAATAAAAAGTTAAGG GCGCGGAATTCCGGTCCCGCAATAGCACCTTCC GCGCGGATCCGGATTTGGACAGCGTGGACTTATTG GCGCGTCGACCATTATCTTTCTCCTTTTCTTTTTTCCACTC GCGCGTCGACGTATGAACAAAATAAGAAAATGGTTAGAC GCGCCCATGGCGTTCGTTACATACAGTCTTATTTGAG GATGCGACAGGAGAAATTACTTCTG CTAATACGACTCACTATAGGGAGACAGCATTCATTCTGCGCATTTCTTC CGCGCGCCATGGGGTAGTAAGGATAAGACACTGG CGCGCGGTCGACGATCATCCAGTACATCAGACGG AGATTAGGATCCGTTCATACTATGTCTTCTTTCTCTC ATGAACGGATCCTAATCTTGCTTGTTTGCTTCAAC ATAATGGTCGACTAATCTTGCTTGTTTGCTTCAACATTG GCGCGCCCATGGGATCATCCAGTACATCAGACGG

was carried out as described by others (39). Restriction and ligation of DNA were performed according to the instructions of the manufacturers. All primer sequences are listed in Table 2. Antibiotic susceptibility assays were recorded using filter discs soaked with solutions of fosfomycin (10 mg/ml), cycloserine (10 mg/ml), or bacitracin (20 mg/ml). L. monocytogenes colonies grown on BHI agar plates were resuspended in BHI broth and used to swab inoculate BHI agar plates. Filter discs soaked with antibiotics were placed on top of the agar surface, and the plates were incubated at 37°C overnight. Construction of plasmids and L. monocytogenes strains. For experiments involving inducible expression of the clpC R254S allele, the mutated clpC gene of strain shg4 was amplified in a PCR using primer pair JR159/JR160 and ligated between the PstI and SalI sites of pIMK3, yielding plasmid pJR58. Plasmids pJR63, pJR64, and pJR71 were constructed for inducible expression of the murZ1–99, murZ1–253, and murZ alleles, respectively. They were obtained by amplification of the murZ loci of strains shg7, shg9, and EGD-e, respectively, using primer pair JR167/JR168 and cloning of the resulting fragments between the NcoI/SalI sites of pIMK3. Plasmid pJR82, allowing inducible expression of murA, was constructed by amplification of the murA gene using primer pair JR189/JR190 and ligation of the resulting fragment between the NcoI and SalI sites of pIMK3. Plasmid pJR67 was constructed for removal of the murA gene from the chromosome. Fragments flanking the murA gene up- and downstream were amplified with primer pairs JR173/JR179 and JR174/180, respectively, and used as the template in a splicing by overhang extension PCR (SOE-PCR) with primers JR173/JR174. The resulting fragment was cloned into pMAD using BamHI and NcoI. For removal of murZ, plasmid pJR68 was constructed. Fragments up- and downstream of murZ were amplified using primer pairs JR175/JR183 and JR176/JR184, respectively, and then used as the templates in a SOE-PCR with primer pair JR175/JR176. The resulting ΔmurZ fragment was cloned into pMAD using BamHI/EcoRI. Plasmid pJR127 was generated for deletion of clpC. Up- and downstream fragments were amplified using the primer combinations JR270/JR271 and JR272/JR273, respectively, cut with SalI, and fused together, by ligation. The desired ΔclpC fragment was amplified from the ligation mixtures in a second PCR using primer pair JR270/JR273 and cloned into pMAD using BamHI/EcoRI. Plasmid pJR130 was constructed to facilitate deletion of the lmo2550 gene. Regions flanking the lmo2550 open reading frame were amplified in PCRs using primer pairs JR280/JR281 and JR282/JR283. Both fragments were cut with SalI and ligated. The desired Δlmo2550 allele was amplified from the ligation mixture in another PCR using primer pair JR280/JR283 and cloned into pMAD using BamHI/NcoI. In order to remove gtcA from the chromosome, plasmid pJR144 was constructed. For this purpose, up- and downstream fragments flanking the gtcA gene were amplified using the primer combinations SHW662/SHW664 and SHW663/SHW665. Both fragments were then used as the templates in a SOE-PCR with primers SHW662/SHW663, and the resulting ΔgtcA fragment was cloned into pMAD using NcoI/SalI. January 2017 Volume 199 Issue 1 e00393-16

jb.asm.org 14

L. monocytogenes gpsB Suppressor Mutations

Journal of Bacteriology

Plasmid pSH475 was constructed for the deletion of lmo2550 and gtcA in a single step. For this purpose, the NcoI/SalI fragment of plasmid pJR130, covering the region directly downstream of lmo2550, was replaced with a fragment covering a region 800 bp immediately downstream of gtcA. This fragment had been generated by PCR using primer pair SHW742/SHW743 and was cloned using NcoI/SalI into the NcoI/SalI-cut backbone of pJR130. pIMK3 derivatives were introduced into L. monocytogenes strains by electroporation and selected on BHI agar plates containing kanamycin. Plasmid insertion at the attB site of the tRNAArg locus was verified by PCR. For the removal of gpsB, murA, murZ, clpC, lmo2550, gtcA, or lmo2550 and gtcA, plasmid pSH246, pJR67, pJR68, pJR127, pJR130, pJR144, or pSH475, respectively, was transformed into the respective L. monocytogenes recipient strain and genes were deleted as described elsewhere (40). All gene deletions were confirmed by PCR. Whole-genome sequencing of suppressor mutants. A total of 1 ng of genomic DNA was used for library generation with a Nextera XT DNA Library Prep kit according to the recommendations of the manufacturer (Illumina). Sequencing was carried out on a MiSeq benchtop sequencer and performed in paired-end modus (with two 300-bp ends) using a MiSeq Reagent kit v3 cartridge (600-cycle kit). By utilizing Geneious software (Biomatters Ltd.), sequencing reads were mapped to the L. monocytogenes EGD-e reference genome (NC_003210.1) (21). Variants, representing putative suppressor mutations, were identified using the Geneious single nucleotide polymorphism (SNP) finder tool. Isolation of proteins and Western blotting. L. monocytogenes strains were cultivated in BHI broth and harvested by centrifugation at an optical density at 600 nm (OD600) of 1.0. Cells were washed with ZAP buffer (10 mM Tris-HCl [pH 7.5] and 200 mM NaCl), resuspended in 1 ml ZAP buffer also containing 1 mM phenylmethylsulfonyl fluoride (PMSF), and disrupted by sonication. Cell debris was removed by centrifugation (performed at 1 min and 13,000 rpm in a tabletop centrifuge). The resulting supernatant was used as the total cellular protein extract. For protein detection by Western blotting, protein extracts were separated by standard SDSpolyacrylamide gel electrophoresis and transferred onto positively charged PVDF membranes using a semidry transfer unit. Proteins were immunostained using polyclonal rabbit antisera which had previously been raised against B. subtilis MurAA (25) and B. subtilis ClpC and cross-reacted with the L. monocytogenes proteins as the primary antibodies and anti-rabbit immunoglobulin G conjugated to horseradish peroxidase as the secondary antibody. The peroxidase conjugates were detected on the PVDF membrane using an ECL chemiluminescence detection system (Thermo Scientific). Isolation of RNA and Northern blotting. Bacterial strains were cultivated in BHI broth at 37°C, and total RNA was extracted using an RNeasy minikit (Qiagen). Northern blot analysis was performed as described by Wetzstein et al. (42). The murA-specific digoxigenin (DIG)-labeled RNA probe was obtained by in vitro transcription with T7 RNA polymerase (Roche Diagnostics) and a murA-internal PCR fragment generated with primer pair JR286/JR287 (the reverse primer introduced the T7 RNA polymerase recognition site). In vitro transcription was carried out using a DIG RNA labeling kit (Roche). Hybridization and signal detection were performed using a DIG wash and block buffer set, an anti-digoxigenin antibody conjugated to alkaline phosphatase, and CDP-Star reagent (all chemicals obtained from Roche) according to the manufacturer’s instructions.

SUPPLEMENTAL MATERIAL Supplemental material for this article may be found at https://doi.org/10.1128/ JB.00393-16. TEXT S1, PDF file, 0.1 MB. ACKNOWLEDGMENTS This work was supported by the DFG (HA 6830/1-1 to S.H.) and the Fonds der chemischen Industrie (to S.H.). We thank Ulf Gerth (University of Greifswald, Greifswald, Germany) and Kürsad Turgay (University of Hanover, Hanover, Germany) for their kind gifts of the antisera against B. subtilis MurAA and ClpC, respectively. Ulrich Nübel (Braunschweig) is acknowledged for help with some experiments.

REFERENCES 1. Silhavy TJ, Kahne D, Walker S. 2010. The bacterial cell envelope. Cold Spring Harb Perspect Biol 2:a000414. 2. Brown S, Santa Maria JP, Jr, Walker S. 2013. Wall teichoic acids of gram-positive bacteria. Annu Rev Microbiol 67:313–336. https://doi.org/ 10.1146/annurev-micro-092412-155620. 3. Dramsi S, Magnet S, Davison S, Arthur M. 2008. Covalent attachment of proteins to peptidoglycan. FEMS Microbiol Rev 32:307–320. https:// doi.org/10.1111/j.1574-6976.2008.00102.x. 4. Vollmer W, Blanot D, de Pedro MA. 2008. Peptidoglycan structure and architecture. FEMS Microbiol Rev 32:149 –167. https://doi.org/10.1111/ j.1574-6976.2007.00094.x. January 2017 Volume 199 Issue 1 e00393-16

5. Ruiz N. 2015. Lipid flippases for bacterial peptidoglycan biosynthesis. Lipid Insights 8:21–31. 6. Meeske AJ, Sham LT, Kimsey H, Koo BM, Gross CA, Bernhardt TG, Rudner DZ. 2015. MurJ and a novel lipid II flippase are required for cell wall biogenesis in Bacillus subtilis. Proc Natl Acad Sci U S A 112:6437– 6442. https://doi.org/10.1073/pnas.1504967112. 7. Sauvage E, Kerff F, Terrak M, Ayala JA, Charlier P. 2008. The penicillinbinding proteins: structure and role in peptidoglycan biosynthesis. FEMS Microbiol Rev 32:234 –258. https://doi.org/10.1111/j.1574 -6976.2008.00105.x. 8. Korsak D, Markiewicz Z, Gutkind GO, Ayala JA. 2010. Identification of the jb.asm.org 15

Rismondo et al.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

full set of Listeria monocytogenes penicillin-binding proteins and characterization of PBPD2 (Lmo2812). BMC Microbiol 10:239. https://doi.org/ 10.1186/1471-2180-10-239. Rismondo J, Möller L, Aldridge C, Gray J, Vollmer W, Halbedel S. 2015. Discrete and overlapping functions of peptidoglycan synthases in growth, cell division and virulence of Listeria monocytogenes. Mol Microbiol 95:332–351. https://doi.org/10.1111/mmi.12873. Rismondo J, Cleverley RM, Lane HV, Grosshennig S, Steglich A, Möller L, Mannala GK, Hain T, Lewis RJ, Halbedel S. 2016. Structure of the bacterial cell division determinant GpsB and its interaction with penicillin-binding proteins. Mol Microbiol 99:978 –998. https://doi.org/10.1111/mmi.13279. Claessen D, Emmins R, Hamoen LW, Daniel RA, Errington J, Edwards DH. 2008. Control of the cell elongation-division cycle by shuttling of PBP1 protein in Bacillus subtilis. Mol Microbiol 68:1029 –1046. https://doi.org/ 10.1111/j.1365-2958.2008.06210.x. Tavares JR, de Souza RF, Meira GL, Gueiros-Filho FJ. 2008. Cytological characterization of YpsB, a novel component of the Bacillus subtilis divisome. J Bacteriol 190:7096 –7107. https://doi.org/10.1128/ JB.00064-08. Fleurie A, Manuse S, Zhao C, Campo N, Cluzel C, Lavergne JP, Freton C, Combet C, Guiral S, Soufi B, Macek B, Kuru E, VanNieuwenhze MS, Brun YV, Di Guilmi AM, Claverys JP, Galinier A, Grangeasse C. 2014. Interplay of the serine/threonine-kinase StkP and the paralogs DivIVA and GpsB in pneumococcal cell elongation and division. PLoS Genet 10:e1004275. https://doi.org/10.1371/journal.pgen.1004275. Land AD, Tsui HC, Kocaoglu O, Vella SA, Shaw SL, Keen SK, Sham LT, Carlson EE, Winkler ME. 2013. Requirement of essential Pbp2x and GpsB for septal ring closure in Streptococcus pneumoniae D39. Mol Microbiol 90:939 –955. https://doi.org/10.1111/mmi.12408. Oliva MA, Halbedel S, Freund SM, Dutow P, Leonard TA, Veprintsev DB, Hamoen LW, Löwe J. 2010. Features critical for membrane binding revealed by DivIVA crystal structure. EMBO J 29:1988 –2001. https:// doi.org/10.1038/emboj.2010.99. Cleverley RM, Rismondo J, Lockhart-Cairns MP, Van Bentum PT, Egan AJ, Vollmer W, Halbedel S, Baldock C, Breukink E, Lewis RJ. 2016. Subunit arrangement in GpsB, a regulator of cell wall biosynthesis. Microb Drug Resist 22:446 – 460. https://doi.org/10.1089/mdr.2016.0050. Pompeo F, Foulquier E, Serrano B, Grangeasse C, Galinier A. 2015. Phosphorylation of the cell division protein GpsB regulates PrkC kinase activity through a negative feedback loop in Bacillus subtilis. Mol Microbiol 97:139 –150. https://doi.org/10.1111/mmi.13015. Rouquette C, Ripio MT, Pellegrini E, Bolla JM, Tascon RI, Vazquez-Boland JA, Berche P. 1996. Identification of a ClpC ATPase required for stress tolerance and in vivo survival of Listeria monocytogenes. Mol Microbiol 21:977–987. https://doi.org/10.1046/j.1365-2958.1996.641432.x. Molière N, Turgay K. 2009. Chaperone-protease systems in regulation and protein quality control in Bacillus subtilis. Res Microbiol 160: 637– 644. https://doi.org/10.1016/j.resmic.2009.08.020. Barreteau H, Kovac A, Boniface A, Sova M, Gobec S, Blanot D. 2008. Cytoplasmic steps of peptidoglycan biosynthesis. FEMS Microbiol Rev 32:168 –207. https://doi.org/10.1111/j.1574-6976.2008.00104.x. Glaser P, Frangeul L, Buchrieser C, Rusniok C, Amend A, Baquero F, Berche P, Bloecker H, Brandt P, Chakraborty T, Charbit A, Chetouani F, Couvé E, de Daruvar A, Dehoux P, Domann E, Domínguez-Bernal G, Duchaud E, Durant L, Dussurget O, Entian KD, Fsihi H, García-del Portillo F, Garrido P, Gautier L, Goebel W, Gómez-López N, Hain T, Hauf J, Jackson D, Jones LM, Kaerst U, Kreft J, Kuhn M, Kunst F, Kurapkat G, Madueno E, Maitournam A, Vicente JM, Ng E, Nedjari H, Nordsiek G, Novella S, de Pablos B, Pérez-Diaz JC, Purcell R, Remmel B, Rose M, et al. 2001. Comparative genomics of Listeria species. Science 294:849 – 852. Skarzynski T, Mistry A, Wonacott A, Hutchinson SE, Kelly VA, Duncan K. 1996. Structure of UDP-N-acetylglucosamine enolpyruvyl transferase, an enzyme essential for the synthesis of bacterial peptidoglycan, complexed with substrate UDP-N-acetylglucosamine and the drug fosfomycin. Structure 4:1465–1474. https://doi.org/10.1016/ S0969-2126(96)00153-0. Toledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, Balestrino D, Loh E, Gripenland J, Tiensuu T, Vaitkevicius K, Barthelemy M, Vergassola M, Nahori MA, Soubigou G, Regnault B, Coppee JY, Lecuit M, Johansson J, Cossart P. 2009. The Listeria transcriptional landscape from saprophytism to virulence. Nature 459:950 –956. https://doi.org/10.1038/ nature08080. Carroll SA, Hain T, Technow U, Darji A, Pashalidis P, Joseph SW,

January 2017 Volume 199 Issue 1 e00393-16

Journal of Bacteriology

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Chakraborty T. 2003. Identification and characterization of a peptidoglycan hydrolase, MurA, of Listeria monocytogenes, a muramidase needed for cell separation. J Bacteriol 185:6801– 6808. https://doi.org/10.1128/ JB.185.23.6801-6808.2003. Kock H, Gerth U, Hecker M. 2004. MurAA, catalysing the first committed step in peptidoglycan biosynthesis, is a target of Clp-dependent proteolysis in Bacillus subtilis. Mol Microbiol 51:1087–1102. https://doi.org/ 10.1046/j.1365-2958.2003.03875.x. Dubail I, Bigot A, Lazarevic V, Soldo B, Euphrasie D, Dupuis M, Charbit A. 2006. Identification of an essential gene of Listeria monocytogenes involved in teichoic acid biogenesis. J Bacteriol 188:6580 – 6591. https:// doi.org/10.1128/JB.00771-06. Soldo B, Lazarevic V, Pooley HM, Karamata D. 2002. Characterization of a Bacillus subtilis thermosensitive teichoic acid-deficient mutant: gene mnaA (yvyH) encodes the UDP-N-acetylglucosamine 2-epimerase. J Bacteriol 184:4316 – 4320. https://doi.org/10.1128/ JB.184.15.4316-4320.2002. Promadej N, Fiedler F, Cossart P, Dramsi S, Kathariou S. 1999. Cell wall teichoic acid glycosylation in Listeria monocytogenes serotype 4b requires gtcA, a novel, serogroup-specific gene. J Bacteriol 181: 418 – 425. Eugster MR, Haug MC, Huwiler SG, Loessner MJ. 2011. The cell wall binding domain of Listeria bacteriophage endolysin PlyP35 recognizes terminal GlcNAc residues in cell wall teichoic acid. Mol Microbiol 81: 1419 –1432. https://doi.org/10.1111/j.1365-2958.2011.07774.x. Meeske AJ, Riley EP, Robins WP, Uehara T, Mekalanos JJ, Kahne D, Walker S, Kruse AC, Bernhardt TG, Rudner DZ. 2016. SEDS proteins are a widespread family of bacterial cell wall polymerases. Nature 537: 634 – 638. https://doi.org/10.1038/nature19331. Prelich G. 1999. Suppression mechanisms: themes from variations. Trends Genet 15:261–266. https://doi.org/10.1016/S0168 -9525(99)01749-7. Bierne H, Cossart P. 2007. Listeria monocytogenes surface proteins: from genome predictions to function. Microbiol Mol Biol Rev 71:377–397. https://doi.org/10.1128/MMBR.00039-06. Marquardt JL, Siegele DA, Kolter R, Walsh CT. 1992. Cloning and sequencing of Escherichia coli murZ and purification of its product, a UDP-N-acetylglucosamine enolpyruvyl transferase. J Bacteriol 174: 5748 –5752. Brown ED, Vivas EI, Walsh CT, Kolter R. 1995. MurA (MurZ), the enzyme that catalyzes the first committed step in peptidoglycan biosynthesis, is essential in Escherichia coli. J Bacteriol 177:4194 – 4197. Gerth U, Kock H, Kusters I, Michalik S, Switzer RL, Hecker M. 2008. Clp-dependent proteolysis down-regulates central metabolic pathways in glucose-starved Bacillus subtilis. J Bacteriol 190:321–331. https:// doi.org/10.1128/JB.01233-07. Du W, Brown JR, Sylvester DR, Huang J, Chalker AF, So CY, Holmes DJ, Payne DJ, Wallis NG. 2000. Two active forms of UDP-N-acetylglucosamine enolpyruvyl transferase in gram-positive bacteria. J Bacteriol 182:4146 – 4152. https://doi.org/10.1128/JB.182.15.4146-4152.2000. Blake KL, O’Neill AJ, Mengin-Lecreulx D, Henderson PJ, Bostock JM, Dunsmore CJ, Simmons KJ, Fishwick CW, Leeds JA, Chopra I. 2009. The nature of Staphylococcus aureus MurA and MurZ and approaches for detection of peptidoglycan biosynthesis inhibitors. Mol Microbiol 72: 335–343. https://doi.org/10.1111/j.1365-2958.2009.06648.x. Mizyed S, Oddone A, Byczynski B, Hughes DW, Berti PJ. 2005. UDP-Nacetylmuramic acid (UDP-MurNAc) is a potent inhibitor of MurA (enolpyruvyl-UDP-GlcNAc synthase). Biochemistry 44:4011– 4017. https://doi.org/10.1021/bi047704w. Monk IR, Gahan CG, Hill C. 2008. Tools for functional postgenomic analysis of Listeria monocytogenes. Appl Environ Microbiol 74: 3921–3934. https://doi.org/10.1128/AEM.00314-08. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70:6887– 6891. https:// doi.org/10.1128/AEM.70.11.6887-6891.2004. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Wetzstein M, Volker U, Dedio J, Lobau S, Zuber U, Schiesswohl M, Herget C, Hecker M, Schumann W. 1992. Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis. J Bacteriol 174: 3300 –3310.

jb.asm.org 16