crossmark

Suppression of MicroRNA 200 Family Expression by Oncogenic KRAS Activation Promotes Cell Survival and Epithelial-Mesenchymal Transition in KRAS-Driven Cancer Xiaomin Zhong,a Lan Zheng,b Jianfeng Shen,b Dongmei Zhang,b Minmin Xiong,a Youyou Zhang,b Xinhong He,b,c Janos L. Tanyi,d Feng Yang,e Kathleen T. Montone,f Xiaojun Chen,g Congjian Xu,g Andy P. Xiang,a Qihong Huang,h Xiaowei Xu,f Lin Zhangb,d Center for Stem Cell Biology and Tissue Engineering, Department of Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, Chinaa; Center for Research on Reproduction & Women’s Health, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USAb; Beijing Friendship Hospital, Capital Medical University, Beijing, Chinac; Department of Obstetrics and Gynecology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USAd; Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, USAe; Department of Pathology and Laboratory Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USAf; Obstetrics and Gynecology Hospital of Fudan University, Shanghai, Chinag; The Wistar Institute, Philadelphia, Pennsylvania, USAh

Oncogenic KRAS contributes to malignant transformation, antiapoptosis, and metastasis in multiple human cancers, such as lung, colon, and pancreatic cancers and melanoma. MicroRNAs (miRNAs) are endogenous 18- to 25-nucleotide noncoding small RNAs that regulate gene expression in a sequence-specific manner via the degradation of target mRNAs or inhibition of protein translation. In the present study, using array-based miRNA profiling in IMR90 and MCF10A cells expressing oncogenic KRAS, we identified that the expression of the microRNA 200 (mir-200) family was suppressed by KRAS activation and that this suppression was mediated by the transcription factors JUN and SP1 in addition to ZEB1. Restoration of mir-200 expression compromised KRAS-induced cellular transformation in vitro and tumor formation in vivo. In addition, we found that enforced expression of mir-200 abrogated KRAS-induced resistance to apoptosis by directly targeting the antiapoptotic gene BCL2. Finally, mir-200 was able to antagonize the epithelial-mesenchymal transition (EMT) driven by mutant KRAS. Collectively, our results suggest that repression of endogenous mir-200 expression is one of the important cellular responses to KRAS activation during tumor initiation and progression.

T

he cellular oncogene KRAS encodes two splice isoforms, KRAS4A and the predominant form KRAS4B (here referred to as KRAS), which is a small GTPase that links extracellular stimuli to intracellular signaling pathways regulating developmental processes and diseases, especially cancers (1–5). KRAS protein has been widely reported to bear activating mutations (e.g., G12D, G13D, and Q61L) in cancers derived from lung, colon, and pancreas (1–5). These mutations impair the GTPase activity of KRAS and enable constitutive activation of downstream pathways independent of exogenous regulatory signals. The abnormal activation of downstream effectors in KRAS pathways, such as RAF– extracellular signal-regulated kinase (ERK) and phosphatidylinositol 3-kinase (PI3K)/AKT, had been found to contribute to KRASdriven tumorigenesis, which is characterized by cellular transformation, resistance to apoptosis, and metastasis (1–6). Moreover, downstream transcription factors of KRAS pathways, such as FOS, JUN, nuclear factor ␬B (NF-␬B), and Fra1, are required for cancer cell survival, proliferation, migration, and invasion (7–10). Although the molecular mechanisms dictating how the aberrant activation of KRAS pathways affects transformed phenotypes and tumorigenesis have been well studied, the role of noncoding genes in mediating KRAS function is still largely unknown (11). MicroRNAs (miRNAs) are endogenous 18- to 25-nucleotide noncoding small RNAs that regulate gene expression in a sequence-specific manner via the degradation of target mRNAs or inhibition of protein translation (12–14). MicroRNA 200 (mir-200) is a well-characterized, highly conserved miRNA family, consisting of five members that are located in two miRNA gene clusters (mir-200b/a/429 and mir-200c/141) on different chromosomes. Each cluster is transcribed into a single pri-

2742

mcb.asm.org

mary miRNA transcript (pri-miRNA) and processed by the Drosha/ DGCR8 complex into individual precursor transcripts (premiRNA), which are further sliced by Dicer into mature miRNAs. The five mature miRNAs of the family contain highly similar seed sequences, which leads them to share a wide range of biological functions, such as regulation of development (15–17), cellular senescence (18), apoptosis (19), tumor metastasis (20–27), angiogenesis (28), and immunosuppression of lymphocytes (29). These biological functions of mir-200 were disclosed by the discovery of its target genes, such as those coding for ZEB1/2 (21, 22, 24–26), SEC23 (30), CXCL1/IL-8 (28), and PD-L1 (29), in different cellular contexts. Similar to other miRNAs involved in tumorigenesis (31), the expression levels of mir-200 family members were deregulated in cancer cells by different mechanisms, implying their crit-

Received 11 February 2016 Returned for modification 28 March 2016 Accepted 13 August 2016 Accepted manuscript posted online 22 August 2016 Citation Zhong X, Zheng L, Shen J, Zhang D, Xiong M, Zhang Y, He X, Tanyi JL, Yang F, Montone KT, Chen X, Xu C, Xiang AP, Huang Q, Xu X, Zhang L. 2016. Suppression of microRNA 200 family expression by oncogenic KRAS activation promotes cell survival and epithelial-mesenchymal transition in KRAS-driven cancer. Mol Cell Biol 36:2742–2754. doi:10.1128/MCB.00079-16. Address correspondence to Xiaomin Zhong, [email protected], or Lin Zhang, [email protected]. X. Zhong and L. Zheng contributed equally to this article. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /MCB.00079-16. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

ical roles in normal physiological processes. For example, repressive epigenetic markers were present in the promoter regions of mir-200 gene clusters in cancers (32–34). In addition, mir-200 was suppressed by ZEB1/2 in mesenchymal cancer cells (21, 22, 26, 35). These results, taken together, indicate that mir-200 functions as a tumor suppressor in multiple cancer types. Restoring the expression of mir-200 was sufficient to rescue the transformed phenotypes (20, 24, 25), implicating a novel strategy for cancer therapy by targeting mir-200. The present study aimed to identify novel miRNA factors regulating KRAS functions by using arraybased miRNA profiling in cells expressing oncogenic KRAS. The expression of the mir-200 family was revealed potently suppressed by KRAS activation, and mir-200 represents a novel suppressor of KRAS oncogenic functions. MATERIALS AND METHODS Plasmids. KRASG12D/pBabe vector was used for enforced KRAS overexpression (Addgene plasmid 58902). The shKRAS/pLKO construct was generated by inserting a short hairpin RNA (shRNA) with sequences targeting KRAS (GACGAATATGATCCAACAATA) into pLKO.1 vector (Addgene). The luciferase reporter plasmid containing the mir-200b/a/ 429 promoter region was kindly provided by Gregory J. Goodall. mir200c.Cre was generated by replacing the luciferase gene in Luc.Cre empty vector (Addgene plasmid 20905) with a cDNA fragment encoding primary mir-200c from the mir-200c/pLV expression vector (a gift from Qihong Huang). Wild-type and mutant BCL2-3= untranslated region (UTR)/psiCHECK2 were constructed by inserting DNA sequences containing wild-type (WT) (GCCCCAGAACTGTACAGTATTG) or mutant (GCCCCAGAACTGTAACTCGCCG) mir-200 binding sites in triplicate from the human BCL2 gene 3= UTR into psiCHECK2 vector (Promega) (italic letters represent the artificially mutated binding site of mir-200 in the BCL2 3= UTR). Cell culture. IMR90 cells were cultured in Eagle’s minimum essential medium (ATCC) supplemented with 10% fetal bovine serum (FBS) (GIBCO), and 1% penicillin-streptomycin (GIBCO). MCF10A cells were cultured in Dulbecco’s modified Eagle’s medium–F-12 (DMEM–F-12) (GIBCO) with 5% horse serum (GIBCO), 10 ␮g/ml epidermal growth factor (Sigma), 10 mg/ml insulin (Sigma), 0.1 mg/ml cholera toxin (Sigma), 2 mg/ml hydrocortisone (Sigma). The 293T, PT67, and cancer cell lines were maintained in RPMI 1640 medium (Cellgro) with 10% FBS (GIBCO) and 1% penicillin-streptomycin (GIBCO). The reporter cell line DF1-Z/EG used for the titration of Cre lentivirus was maintained in DMEM with 10% FBS (GIBCO) and 1% penicillin-streptomycin (GIBCO). Antibodies. Antibodies against KRAS, p-ERK, t-ERK, p-AKT, t-AKT, P21, total and cleaved caspase 3/7/9, total and cleaved poly(ADP-ribose) polymerase (PARP), P53, and phospho-P53(Ser15), and BCL2 were all purchased from Cell Signaling Technology. E-cadherin and vimentin antibodies were from BD Pharmingen. For chromatin immunoprecipitation (ChIP), JUN antibody was obtained from Active Motif and SP1 antibody was from Millipore. The Ago2 antibody (2A8) was a gift from Zissimos Mourelatos. Western blotting. Cells were lysed in mammalian protein extraction reagent (Pierce). After quantification using a bicinchoninic acid (BCA) protein assay kit (Pierce), 15 ␮g total protein was separated by 10% SDSPAGE under denaturing conditions and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). Membranes were blocked in 5% nonfat milk (Bio-Rad) and then incubated with primary antibodies, followed by incubation with an anti-rabbit secondary antibody conjugated with horseradish peroxidase (HRP) (1:10,000; Amersham Biosciences) together with an HRP-conjugated primary antibody for ␤-actin (1:10,000; Sigma). Immunoreactive proteins were visualized using the LumiGLO chemiluminescent substrate (Cell Signaling).

November 2016 Volume 36 Number 21

Cell transfection. For transient transfections, cells were plated 24 h before transfection at 50% confluence. Plasmid transfections and miRNA mimic/inhibitor transfections were performed with the FuGENE6 transfection reagent (Roche Applied Science) and Lipofectamine RNAiMAX (Invitrogen), respectively. TaqMan miRNA profiling microfluidic cards. Total RNA was extracted with TRIzol reagent (Invitrogen). Seven hundred nanograms of total RNA was subjected to reverse transcription (RT) using the Megaplex RT primer pool (Applied Biosystems) and the TaqMan microRNA reverse transcription kit (Applied Biosystems) according to the manufacturer’s instructions. cDNA was loaded to the microfluidic card of TaqMan miRNA panel A (Applied Biosystems), and quantitative PCR (qPCR) was performed following the manufacturer’s instructions. Relative expression level of miRNAs were calculated by threshold cycle (⌬⌬CT) method and normalized to the average expression level of all miRNAs. TaqMan miRNA assay. Expression of mature miRNAs was analyzed using the TaqMan miRNA assay (Applied Biosystems) under conditions defined by the supplier. Briefly, single-stranded cDNA was synthesized from 5 ng total RNA in a 15-␮l reaction volume, using the TaqMan microRNA reverse transcription kit (Applied Biosystems). The reaction mixtures were incubated first at 16°C for 30 min and then at 42°C for 30 min and then inactivated by incubation at 85°C for 5 min. Each cDNA generated was amplified by quantitative PCR using sequence-specific primers from the TaqMan microRNA assays on an Applied Biosystems 7900HT sequence detection system (Applied Biosystems). Each 20-␮l PCR mixture included 10 ␮l of 2⫻ Universal PCR master mix (without AmpErase UNG), 1 ␮l of 20⫻ TaqMan microRNA assay mix, and 2 ␮l of reverse transcription product. The reaction mixtures were incubated in a 384-well plate at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. qRT-PCR. Total RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed using a high-capacity RNA-to-cDNA kit (Applied Biosystems) under conditions provided by the supplier. cDNA and genomic DNA were quantitated by quantitative real-time RT-PCR (qRT-PCR) on an ABI Prism 7900 sequence detection system (Applied Biosystems) using the primers listed in Table S1 in the supplemental material. PCR was performed using SYBR green PCR core reagents (Applied Biosystems) according to the manufacturer’s instructions. siRNA screening. Cells were plated 24 h before transfection at a density of 50% confluence. Small interfering RNA (siRNA) transfection was performed with Lipofectamine RNAiMAX (Invitrogen) at a final concentration of 60 nM. Forty-eight hours posttransfection, cells were harvested and total RNA was extracted according to the manufacturer’s instructions of TRIzol reagent (Invitrogen). Reverse transcription for microRNA was performed with TaqMan microRNA reverse transcription kit (Applied Biosystems). TaqMan microRNA assay for mir-200b and TaqMan Universal PCR master mix (Applied Biosystems) were used to perform qPCR on ABI Prism 7900 Sequence detection system (Applied Biosystems). The customized siRNA library (see Table S2 in the supplemental material) was purchased from Qiagen. Other siRNAs were predesigned and synthesized by IDT. ChIP assay. A total of 1 ⫻ 106 cells were cross-linked in 1% formaldehyde for 10 min, and the cross-linking was terminated with 0.125 M glycine. The nuclear protein and fragmented chromatin were extracted by sequential incubation in cell lysis buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 3 mM MgCl2, 0.5% IGEPAL, 1 mM phenylmethylsulfonyl fluoride [PMSF]) and nuclear lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS, and protease inhibitor cocktail), followed by optimized sonication. The nuclear extract was subjected to immunoprecipitation with JUN or SP1 antibody, respectively. The immunoprecipitate was washed sequentially in dialysis buffer (50 mM Tris-HCl [pH 8.0], 2 mM EDTA, 0.2% Sarkosyl) and wash buffer (100 mM Tris-HCl [pH 9.0], 500 mM LiCl, 1% NP-40, 1% deoxycholic acid). The cross-linking of chromatin was reversed, and then DNA was purified with a gel purifica-

Molecular and Cellular Biology

mcb.asm.org

2743

Zhong et al.

tion kit (Qiagen). qPCR was performed to detect the relative amount of interest chromatin regions in the immunoprecipitate. Soft agar assay. The Millipore cell transformation detection assay (Millipore) was used to assess the in vitro transformation efficiency of MCF10A cell lines. Procedures were performed according to the manufacturer’s instructions. Lentivirus production and titration. Lentivirus vector and packaging vectors were transfected into the packaging cell line 293T (ATCC) using the FuGENE6 transfection reagent (Roche Applied Science). The medium was changed 8 h posttransfection, and the medium containing lentivirus was collected 48 h later. Luc.Cre and mir-200c.Cre lentiviruses were titrated by infecting the reporter cell line DF1-Z/EG, which harbors a Cre-activated green fluorescent protein locus (GFP), and analyzing GFP fluorescence by flow cytometry 72 h postinfection. Animal manipulation. Heterozygous transgenic KRASloxP-stop-loxP G12D/⫹ mice were purchased from Jackson Laboratory (008179). Luc.Cre and mir-200c.Cre lentiviruses were delivered into the mouse lungs (10 animals per group) by a method previously established in Tyler Jacks’ laboratory (36). Three months after lentivirus delivery, mice were sacrificed and examined for tumor formation and mir-200b/c expression in the lung tumors. Apoptosis induction and detection. MCF10A cells and cancer cells were plated at 50% confluence 24 h before treatment. Camptothecin was added to cells at a final concentration of 2 ␮M for 8 h. The protein levels of caspases were detected by Western blotting, and caspase activity was quantitated with a Promega caspase 3/7 activity detection kit according to the manufacturer’s instructions. For the apoptosis protein array, MCF10A cells were plated at 50% confluence and treated with 2 ␮M camptothecin for 8 h. Cell lysate was collected and apoptosis proteins were detected according to the instructions of the (R&D Systems human apoptosis array kit. For annexin V analysis, MDA-MB-231 cells were transfected with 30 ␮M mir-200b/c mimics 48 h before 2 ␮M camptothecin treatment for 8 h. Annexin V-positive cells were analyzed by flow cytometry with an annexin V-FLUOS staining kit (Roche) following the manufacturer’s instructions. Reporter assay. Cells were plated on a 24-well plate and transfected with 0.125 ␮g reporter vector together with 0.25 ␮g miRNA expression plasmid using the FuGENE6 transfection reagent. Forty-eight hours after reporter vector transfection, cells were harvested, and reporter assays were performed using a Promega Dual-Luciferase reporter assay system according to the manufacturer’s instructions. Reporter activity was measured on the Fluoroskan ascent FL fluorometer (Thermo Fisher Scientific). Ago2 IP. The protocol of Ago2 immunoprecipitation (IP) was adapted from the Z. Mourelatos lab with minor modifications. Briefly, protein A beads were preincubated with Ago2 Ab (1:40) in 0.1 M Naphosphate (pH 8.0). MDA-MB-231 cells overexpressing mir-200c or control vector were lysed in 1⫻ phosphate-buffered saline (PBS) supplemented with 0.1% SDS, 0.5% deoxycholate, and 0.5% NP-40. The pretreated protein A beads and the cell lysate were incubated with rotation at 4°C, overnight. The immunoprecipitate was then washed sequentially in 1⫻ PXL wash buffer (1⫻ PBS, 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40) and in 5⫻ PXL high-salt wash buffer (5⫻ PBS, 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40) twice, respectively. The RNA species associated with Ago2 were directly purified with TRIzol reagent and detected by qPCR. Fluorescence immunostaining. Sections were sequentially incubated in 5% normal serum and primary antibodies overnight at 4°C, followed by Alexa Fluor 594 – goat anti-rabbit IgG (Invitrogen) at 1:150 for 1.5 h at room temperature. Sections were counterstained with DAPI (4=,6-diamidino-2-phenylindole) (Vector). The image was collected using an Axiovert 200 M inverted microscope (Zeiss). Three-dimensional culture of MCF10A cells. The protocol for 3D culture on Matrigel with MCF10A cells was adapted from Brugge lab (37) with minor modifications. Briefly, the single-cell suspension of MCF10A (concentration of 25,000 cells/ml) was mixed with Matrigel and epider-

2744

mcb.asm.org

mal growth factor (EGF)-containing medium in a 1:1 ratio. Four hundred microliters of this mixture was then plated per well on top of the solidified Matrigel in each well of the chamber slide. This corresponds to a final overlay solution of 5,000 cells/well in medium containing 2% Matrigel and 5 ng/ml EGF. The cells were allowed to grow in a 5% CO2 humidified incubator at 37°C. The cells should form clusters by day 5 or 6 of 3D cultures and subsequently form a hollow lumen. Statistics. Statistical analysis was performed using the SPSS statistics software package (SPSS, Chicago, IL). All results are expressed as means ⫾ standard deviation (SD) and with significance at P of ⬍0.05.

RESULTS

Oncogenic KRAS suppresses the expression of the mir-200 family. To gain insight into the dynamic changes of miRNA expression induced by oncogenic KRAS activation in cells, we used a miRNA microfluidic low-density array, which simplifies the detection technology compared to the oligonucleotide microchip (38) and profiles the expression of 381 miRNA species, to identify the differentially expressed miRNA species in cells expressing mutant KRAS and control cells. A normal human cell line, IMR90 (lung fibroblast), and an immortalized, nontransformed human cell line, MCF10A (mammary gland epithelium), were used for the initial profiling study. First, the activity of exogenously expressed mutant KRASG12D was confirmed by the detection of the upregulation of its downstream targets p-AKT (in both IMR90 and MCF10A) and p-ERK (in MCF10A) (Fig. 1A). Interestingly, members of the mir-200 family, which were among the 381 mature miRNAs on the low-density array, were downregulated significantly by oncogenic KRAS expression in both IMR90 and MCF10A cells (Fig. 1B; see Table S1 in the supplemental material). The mir-200 family consists of two miRNA clusters (cluster 1 with mir-200b/a/429 and cluster 2 with mir-200c/141) on chromosomes 1 and 12, respectively (Fig. 1C). To examine whether mutant KRAS regulates the mir-200 family at the transcriptional or posttranscriptional (e.g., miRNA processing) level, we detected both pri/pre-mir-200 and mature mir-200 in MCF10A cells expressing mutant KRAS. As shown in Fig. 1D, the pri/pre-miRNA transcripts of both clusters 1 and 2 decreased upon mutant KRAS overexpression (left panel), as well as the mature forms of the mir-200 family (right panel). This suggests that oncogenic KRAS activity suppresses mir-200 expression at the transcriptional level. We also forced the expression of mutant KRAS in two colorectal cancer cell lines, HT29 and RKO, with endogenous wild-type KRAS alleles. A similar suppression of mir-200 expression by oncogenic KRAS activity was observed in these cancer cells (Fig. 1E). The above results indicated that the regulation of mir-200 family expression by oncogenic KRAS activity was ubiquitous in both nontransformed and transformed cells with wild-type KRAS alleles. Finally, we asked whether endogenously expressed KRAS (either wild type or mutant) also functions as a suppressor of the mir-200 family. siRNA was employed to knock down endogenous KRAS in the HCT116, OVCAR5, SW620, and SW480 cell lines (all with mutant KRAS), as well as the T47D cell line (with wild-type KRAS). The expression of mature mir-200b and mir-200c was significantly increased in all of these cancer cell lines (Fig. 1F), which suggests that endogenous KRAS activity per se suppressed mir-200 expression as well as exogenous oncogenic KRAS activity. Collectively, we conclude that activation of KRAS potently suppresses mir-200 expression in different cellular contexts. KRAS suppresses mir-200 family expression through its downstream effectors JUN and SP1. KRAS is a GTPase that pos-

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

FIG 1 Oncogenic KRAS suppresses the expression of the mir-200 family. (A) Western blotting detected protein levels of KRAS and its downstream targets in IMR90 and MCF10A cells expressing vector control or mutant KRAS. p-, phospho-; t-, total-. (B) Results of miRNA low-density arrays with IMR90 (top) and MCF10A cells (bottom) are shown by dot plot. The x axis shows individual miRNA species, and the y axis indicates the normalized expression level of each miRNA. mir-200 family members are highlighted in red. (C) The mir-200 family consists of two miRNA clusters on different chromosomes. (D) The expression levels of the primary/precursor forms (left) and mature forms (right) of the mir-200 family in MCF10A cells expressing mutant KRAS compared to vector control were detected by qRT-PCR. *, P ⬍ 0.05. (E) The expression levels of the primary/precursor forms (left) and mature forms (right) of the mir-200 family in HT29 and RKO cells (both KRAS wild type) expressing mutant KRAS compared to vector control were detected by qRT-PCR. *, P ⬍ 0.05. (F) The expression levels of mature mir-200b and mir-200c in HCT116, OVCAR5, SW620, SW480 (all KRAS mutated), and T47D (KRAS wild type) with siRNA control or siKRAS were detected by qRT-PCR. *, P ⬍ 0.05.

sesses an intrinsic GTP hydrolysis activity that switches it from an active to an inactive state. In response to extracellular growth signals, activated KRAS switches on downstream signaling pathways, such as the PI3K/AKT and mitogen-activated protein kinase (MAPK) pathways, and subsequently a group of transcription factors induced by these pathways (Fig. 2A). Because oncogenic KRAS activity regulates mir-200 expression at the transcriptional level, we hypothesized that the transcription factors downstream of KRAS signaling mediated the suppressive function of KRAS. To test this hypothesis, we used a screening method consisting of a customized siRNA library (targeting 23 genes with two siRNAs, respectively), which targeted the key kinases and transcription factors in KRAS pathways (see Table S2 in the supplemental material). Individual siRNAs were transfected into SW620 and T47D cells, and the expression level of mature mir-200b was quantitated by qRT-PCR and compared to that of negative controls 48 h posttransfection. As a positive control, knocking down KRAS and the well-known mir-200 suppressors ZEB1/2 increased mir-200b ex-

November 2016 Volume 36 Number 21

pression to a relatively high level in both cancer cell lines (Fig. 2B). The siRNAs targeting AKTs and mitogen-activated protein kinases (MAPKs) also enhanced mir-200b expression to various levels, indicating that both the PI3K/AKT and MAPK pathways were involved in the regulation of mir-200. Among the transcription factors examined, knocking down JUN or SP1 consistently increased mir-200b expression in both cancer cell lines (Fig. 2B). The results of the siRNA library screen were validated by transfecting siRNAs targeting AKT2 and ERK2 (Fig. 2C), as well as targeting JUN and SP1 (Fig. 2D), all of which resulted in an increase in mir-200b and mir-200c expression. To further test whether the suppression of mir-200 expression by JUN and SP1 was a direct effect of transcriptional control, a reporter assay was employed. A mir-200b/a/429 promoter-driven luciferase reporter gene was cotransfected with siRNAs targeting KRAS, ERK2, JUN, SP1, or ZEB1 into SW620 cells. We found that downregulation of JUN and SP1 activated the mir-200b/a/429 promoter, to half the effect of knocking down KRAS and ZEB1, implying that JUN and

Molecular and Cellular Biology

mcb.asm.org

2745

Zhong et al.

FIG 2 KRAS suppresses mir-200 family expression through its downstream effectors JUN and SP1. (A) Downstream signaling pathways and effectors activated by KRAS. (B) Screening for effectors responsible for the suppressive function on mir-200 expression with an siRNA library targeting KRAS downstream signaling pathways (46 siRNAs for 23 genes) in SW620 and T47D cells. The expression level of mature mir-200b was quantitated by qRT-PCR and is presented as a heat

2746

mcb.asm.org

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

SP1 directly modulate the transcriptional activity of the mir-200b/ a/429 promoter (Fig. 2E). Furthermore, we found conserved binding sites for JUN and SP1 in both the mir-200b/a/429 and mir-200c/141 promoter regions by bioinformatic prediction (Fig. 2F), indicating that the transcriptional control of mir-200 by JUN and SP1 might involve the direct binding of these transcription factors to the promoter regions. Finally, chromatin immunoprecipitation (ChIP) was performed to examine the interaction between the mir-200 cluster promoter regions and JUN and SP1. As shown in Fig. 2G, the ChIP assay demonstrated that both JUN and SP1 were associated with their conserved binding sites on the mir200b/a/429 and mir-200c/141 promoters in MDA-MB-231 cells. Furthermore, when the endogenous mutant KRAS was knocked down in MDA-MB-231 cells, a significant decrease in the efficiency of binding of JUN and SP1 to the mir-200b/a/429 and mir200c/141 promoters was observed (Fig. 2H). Consistently, ectopic expression of oncogenic KRAS, which functionally enhanced the transcriptional activity of its downstream effectors, as proven by an AP-1-responsive reporter (see Fig. S1 in the supplemental material), led to an increase in the binding of JUN and SP1 to the mir-200b/a/429 and mir-200b/141 promoters in MCF10A cells (Fig. 2I). The negative effect of JUN and SP1 on mir-200 expression and the binding of these two factors to the mir-200 promoter regions led us to the conclusion that JUN and SP1 are the major transcriptional regulators downstream of KRAS that are involved in repressing mir-200 transcription. mir-200 antagonizes oncogenic KRAS-induced malignant transformation in vitro and in vivo. Mutant KRAS exerts its oncogenic function by inducing cellular transformation, preventing cell death, and promoting metastasis. Transformation of normal cells to malignant cells is the initial step of KRAS-driven tumorigenesis. To explore the functional role of mir-200 in KRASinduced tumorigenesis, we restored mir-200 expression in KRASdriven transformation models in vitro and in vivo. First, we performed a colony formation assay to evaluate anchorage-independent growth in vitro using immortalized mammary gland epithelial cells of the line MCF10A. As an immortalized but nontransformed cell line, control MCF10A cells could not form colonies on soft agar, either with or without overexpressed mir200. However, mutant KRAS efficiently induced the anchorageindependent growth of MCF10A to over 300 colonies per well (338 ⫾ 97). Importantly, overexpression of mir-200 in KRAS cells significantly reduced the number of transformed colonies to less than 50% (141 ⫾ 38) (Fig. 3A and B). This result indicated mir200 was able to suppress mutant KRAS-induced cellular transformation in vitro. Next, we aimed to test whether restoration of mir-200 is able to repress KRAS-induced malignant transformation in vivo. To this end, a genetically engineered mouse strain with a heterozygous loxP-stop-loxP-KRASG12D allele to analyze lung tumor formation was employed. Expression of the KRASG12D gene is blocked by the

presence of a loxP-flanked stop codon in the 5= upstream region. Cre-mediated recombination at the loxP sites results in the excision of the stop codon and expression of oncogenic KRASG12D, which potentiates lung tumor formation in animals. First, we analyzed the expression of endogenous mir-200 after oncogenic KRAS activation was induced by Cre lentivirus infection. Consistent with our in vitro results (Fig. 1B), the expression levels of both mir-200b and mir-200c were significantly reduced in the lungs of Cre-treated (KRAS-activated) animals compared to control mice (Fig. 3C). This result provided further in vivo evidence for repression of mir-200 expression by oncogenic KRAS. Next, by taking advantage of a lentiviral system developed by Jacks’ group (39), we constructed a lentivirus vector to simultaneously express Cre and primary mir-200c cDNAs from separate promoters, which allowed the coexpression of mutant KRAS and mir-200c in animals (Fig. 3D). The efficacies of control Cre (Luc.Cre) and mir200c.Cre lentiviruses were carefully titrated to ensure identical performance of the two virus species in vivo (Fig. 3E). Then the same doses of Luc.Cre and mir-200c.Cre lentiviruses were injected into the lungs of animals, and the efficiency of tumor formation was compared after 3 months of viral infection. We found that Cre treatment alone consistently induced a large number of adenomas and hyperplasia areas to form in the lungs, which was similar to phenotypes previously reported by other groups (36). Notably, coexpression of mir-200c with Cre significantly reduced the number of tumors formed (Fig. 3F and G). These results suggest that mir-200 antagonizes oncogenic KRAS-induced transformation in vivo, highlighting the pathological importance of the repressed expression of the mir-200 family during oncogenic KRAS-induced transformation. mir-200 abrogates oncogenic KRAS-induced resistance to apoptosis. Cancer cells bearing mutant KRAS resist apoptosis (40–43), which contributes to KRAS-driven tumorigenesis. Because mir-200 efficiently compromised KRAS-induced cellular transformation both in vitro and in vivo (Fig. 3), it raised an interesting question: whether mir-200 inhibited KRAS-driven tumor growth by abrogating resistance to apoptosis. To address this question, MCF10A cells were transduced with an oncogenic KRAS, leading to the transformation of epithelial MCF10A cells to a fibroblast-like cell type. Subsequently, a primary mir-200c cDNA fragment was simultaneously overexpressed in KRAStransformed cells. Then the modified MCF10A cell lines were challenged with camptothecin to induce apoptosis. Control cells underwent apoptosis within 8 h of treatment, as confirmed by the induction of cleaved caspase 3/7 and cleaved PARP (Fig. 4A). Similar to the results by other groups implying KRAS might trigger resistance to apoptosis (40–44), mutant KRAS overexpression reduced the sensitivity to camptothecin, and the cells displayed a much lower expression level of cleaved caspase 3/7 and cleaved PARP. However, cells expressing KRAS plus mir-200c were more sensitive to apoptosis induction than cells expressing only KRAS,

map. Each effector was targeted by two independent siRNA sequences. Yellow, increased; blue, decreased. (C) Mature mir-200b and mir-200c expression levels were detected in SW620 and T47D cells transfected with specific siRNAs targeting AKT2 and ERK2 by qRT-PCR. *, P ⬍ 0.05. (D) Mature mir-200b and mir-200c expression levels were detected in SW620, HCT116, and T47D cells transfected with specific siRNAs targeting JUN and SP1. *, P ⬍ 0.05. (E) mir-200b promoter activity was determined by reporter assays in SW620 cells transfected with siRNAs targeting KRAS, ERK2, JUN, SP1, and ZEB1. *, P ⬍ 0.05. (F) Diagram of the predicted binding sites of JUN (blue) and SP1 (red) in the promoter regions of the mir-200 gene clusters. (G) The binding of JUN and SP1 to the mir-200 cluster promoters was detected by ChIP assays in MDA-MB-231 cells. The three SP1 sites in cluster 2 were designated cluster 2-1 (⫺1416 to ⬃⫺1402), 2-2 (⫺1277 to ⬃⫺1263), and 2-3 (⫺799 to ⬃⫺785). *, P ⬍ 0.05. (H and I) Changes in the binding efficiency of JUN and SP1 to the mir-200 cluster promoters were detected by ChIP assays in MDA-MB-231 cells after knocking down KRAS with shRNA (H) or in MCF10A cells ectopically expressing a KRASG12D cDNA (I). *, P ⬍ 0.05.

November 2016 Volume 36 Number 21

Molecular and Cellular Biology

mcb.asm.org

2747

Zhong et al.

FIG 3 mir-200 antagonizes oncogenic KRAS-induced malignant transformation in vitro and in vivo. (A and B) Anchorage-independent growth assay of MCF10A cells transduced with control, mir-200, KRAS, or KRAS⫹mir-200. (A) Photograph of colonies formed. (B) Statistical analysis of colony numbers. *, P ⬍ 0.05. (C) The expression levels of mature mir-200b (left panel) and mir-200c (right panel) were detected by qRT-PCR in the lungs from the KRASloxP-stop-loxP G12D/⫹ animal model treated with Cre lentivirus. WT, control animals; KRAS⫹Cre, KRASG12D-expressing transgenic animals. *, P ⬍ 0.05 (n ⫽ 4). (D) Diagrams depicting the structures of Luc.Cre and mir-200c.Cre lentivirus plasmids. (E) GFP fluorescence was detected by FACS to show identical titers of Luc.Cre and mir-200c.Cre lentivirus used in the in vivo experiment. Experimental details are described in Materials and Methods. (F) Hematoxylin and eosin staining of lung sections and photographs of intact lungs from KRASloxP-stop-loxP G12D/⫹ animals infected by Luc.Cre or mir-200c.Cre lentivirus. (G) The number of tumor nodules on the surface of lungs from KRASloxP-stop-loxP G12D/⫹ animals infected by Luc.Cre and mir-200c.Cre lentivirus.

indicating that mir-200 functionally suppressed KRAS activity in inducing resistance to apoptosis. We also employed another method, namely, caspase 3/7 enzymatic activity detection, to verify the results. By measuring the excised fluorescent groups from caspase 3/7 substrates, the efficiency of apoptosis induction was evaluated and compared with that of MCF10A cell lines. Once again, mir-200 displayed potent activity in abrogating oncogenic KRAS-induced resistance to apoptosis (Fig. 4B). Next, we asked whether restoring mir-200 expression could induce apoptosis in KRAS-driven cancer cells, which always express low levels of mir-200. To this end, we chose a breast cancer cell line, MDA-MB-231, which harbors KRASG13D and expresses low levels of mir-200. We found that overexpression of mir-200c in MDA-MB-231 cells induced apoptosis, which was detected by cleaved PARP and cleaved caspase 3 protein levels (Fig. 4C), as well as caspase 3/7 activity (Fig. 4D). This result was further confirmed by fluorescence-activated cell sorter (FACS) analysis using an annexin V assay (Fig. 4F and G). Finally, we asked whether blocking endogenous mir-200 expression in KRAS wild-type cells, which always express high levels of mir-200, could decrease apoptosis. To this end, we chose a breast cancer cell line, T47D, and suppressed endogenous mir-200c by a specific locked nucleic acid (LNA) inhibitor. Consistent with our previous results, we found that inhibition of mir-200 dramatically decreased the induction of

2748

mcb.asm.org

apoptosis by camptothecin (Fig. 4E), indicating that the proapoptotic activity was intrinsic to mir-200. Collectively, our results suggest that the proapoptotic factor mir-200 can antagonize oncogenic KRAS-induced resistance to apoptosis, which may be one of the mechanisms for mir-200 suppression of KRAS-driven cellular transformation and tumor growth. mir-200 regulates the expression levels of apoptosis-associated genes in cancer. In order to define the function of mir-200 in KRAS-induced resistance to apoptosis, we analyzed the effect of mir-200 on the expression levels of apoptosis-associated proteins using a human apoptosis protein array. By comparing MCF10A cells overexpressing KRAS to cells overexpressing KRAS plus enforced mir-200c expression, we found certain proapoptotic factors, including cleaved caspase 3, p-P53(Ser15) and TNFRI, were upregulated significantly in cells expressing KRAS plus mir-200c. On the contrary, many apoptosis inhibitors (BCL2, cIAP2, clusterin, heat shock protein 60 [HSP60] and livin) were downregulated upon mir-200c overexpression in KRAS cells (Fig. 5A). The result was validated by Western blotting for p-P53(Ser15) and BCL2 (Fig. 5B), and p-ERK and p-AKT were used as positive controls to indicate the activity of the KRAS pathway. We further investigated whether mir-200 directly regulates the above antiapoptotic genes by a miRNA mechanism. Using the TargetScan algorithm, we predicted a conserved mir-200 binding site in the

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

FIG 4 mir-200 abrogates oncogenic KRAS-induced resistance to apoptosis. (A) Western blots were used to detect the expression levels of apoptosis-associated proteins in MCF10A cells, which were infected with control, KRAS, KRAS⫹mir-200c, or mir-200c lentivirus. Apoptosis was induced by treatment with 2 ␮M camptothecin for 8 h. (B) Caspase 3/7 activity was measured in MCF10A cells subjected to the same treatment as in panel A using a caspase 3/7 activity assay. *, P ⬍ 0.05. (C) Western blots were used to detect the expression levels of apoptosis-associated proteins in MDA-MB-231 cells, which were infected with control or mir-200c lentivirus. Apoptosis was induced by treatment with 2 ␮M camptothecin for 8 h. (D) Caspase 3/7 activity was measured in MDA-MB-231 cells subjected to the same treatment as in panel C using a caspase 3/7 activity assay. *, P ⬍ 0.05. (E) Caspase 3/7 activity was measured in T47D cells transfected with mir-200c LNA inhibitor. Apoptosis was induced by treatment with 2 ␮M camptothecin for 8 h. *, P ⬍ 0.05. (F) The percentage of apoptotic cells was measured using an annexin V assay in MDA-MB-231 cells, which were infected with control, mir-200b, and mir-200c lentivirus and subjected to the same treatment as in panel C. (G) Statistical analysis of the percentage of apoptotic cells in (F). *, P ⬍ 0.05.

November 2016 Volume 36 Number 21

Molecular and Cellular Biology

mcb.asm.org

2749

Zhong et al.

FIG 5 mir-200 regulates the expression of apoptosis-associated genes in cancer. (A) Expression levels of apoptosis factors in MCF10A cells overexpressing KRAS and KRAS⫹mir-200c were compared using a human apoptosis protein array. The normalized signal intensities comparing KRAS⫹mir-200c cells to KRAS cells are shown as a heat map (top). The antibodies used in the array are listed in the table (bottom). Red, upregulated proteins; green, downregulated proteins. (B) Protein levels of total P53, p-P53(Ser15), BCL2, p-ERK, and p-AKT in MCF10A cells subjected to camptothecin treatment were detected by Western blotting. MCF10A cell lines used were infected with control, KRAS, KRAS⫹mir-200c, or mir-200c lentivirus. (C) Sequences of the mir-200 family binding sites within the BCL2 3= UTRs of different species. ORF, open reading frame. (D) The protein level of BCL2 in MDA-MB-231 and HCT116 cells overexpressing mir-200c and control vector was detected by Western blotting. (E) Cartoon showing a conceptual representation of the Ago2 IP method. (F) mRNA levels of ZEB1 and BCL2 in Ago2 IP samples and inputs from MDA-MB-231 cells overexpressing mir-200c and control vector were detected by qPCR. *, P ⬍ 0.05. (G) Reporter assays using a wild-type (WT) or mutant mir-200 family binding site in the BCL2 3= UTR were conducted in HEK293 cells overexpressing mir-200c and control vector. *, P ⬍ 0.05.

BCL2 3= UTR (Fig. 5C). To validate the in vivo interaction of mir-200 and BCL2 mRNA, an Argonaute 2 protein immunoprecipitation (Ago2 IP) method was used with MDA-MB-231 cell lines overexpressing mir-200c and control vector. This method allows for the capture and enrichment of Ago2 complexes containing mir-200c and its target mRNAs, followed by detection of the target mRNAs by qPCR (Fig. 5E). As shown in Fig. 5F, the

2750

mcb.asm.org

expression levels of BCL2 and ZEB1 (our positive control) in both the IP sample (Ago2 IP) and the cell lysate sample (input) from mir-200c-overexpressing cells were compared to those of control cells. In the Ago2 IP complex, both ZEB1 and BCL2 mRNAs were enriched with statistical significance in mir-200c-overexpressing cells. Importantly, ZEB1 and BCL2 were downregulated in the inputs upon mir-200c-overexpression. Taken together, these re-

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

FIG 6 mir-200 represses the KRAS-induced EMT process. (A) Bright-field photographs showing the morphology of stable MCF10A cell lines transfected with

control vector, KRAS, KRAS⫹mir-200c, and mir-200c. Bar, 100 ␮m. (B) Immunofluorescence staining of E-cadherin (E-CAD [green]) and vimentin (VIM [red]) in MCF10A cell lines (control, KRAS, KRAS⫹mir-200c, and mir-200c). Bar, 100 ␮m. (C) mRNA levels of E-cadherin and vimentin in the MCF10A cell lines were detected by qPCR. P ⬍ 0.05. (D) Protein levels of E-cadherin, vimentin, phospho- and total ERK, and phospho- and total AKT in the MCF10A cell lines were detected by Western blotting. (E) Bright-field photographs show the morphology of mammospheres formed by MCF10A cell lines (control, KRAS, KRAS⫹mir-200c, and mir-200c). Fluorescence staining detected the expression of E-cadherin (green) in mammospheres. Bar, 100 ␮m. (F) Statistical analysis of acinus-like (blue) and branching (red) mammospheres shown in panel E. P ⬍ 0.01.

sults imply that BCL2 mRNA is targeted to Ago2/RISC for degradation by mir-200 —i.e., BCL2 is a direct target of mir-200. Subsequently, the repression of BCL2 expression by mir-200 was confirmed by Western blotting in MDA-MB-231 and HCT116 cells overexpressing mir-200 (Fig. 5D). Finally, reporter assays using a wild-type (WT) or mutant mir-200 binding site in the BCL2 3= UTR demonstrated that the binding site is essential in mediating the regulation of BCL2 by mir-200 (Fig. 5G). Collectively, we found that mir-200 directly targets BCL2 and modulates the expression of other apoptosis factors, which might be responsible for compromising KRAS-induced resistance to apoptosis and inhibiting tumor cell growth and transformation. mir-200 represses the KRAS-induced EMT process. In addition to inducing resistance to apoptosis, epithelial-mesenchymal transition (EMT) is one of the remarkable phenotypes triggered by oncogenic KRAS during the cellular transformation process. Because mir-200 is a well-known epithelial marker and EMT inhibitor (20–26), an intriguing question is whether mir-200 has any effect on the KRAS-induced EMT process. To this end, we first compared the cell morphologies and levels of expression of EMT markers in MCF10A cell lines (control vector, KRAS, KRAS plus mir-200c [here KRAS⫹mir-200c], and mir-200c). As shown in Fig. 6A, control and mir-200c cells displayed typical epithelium

November 2016 Volume 36 Number 21

morphologies. However, KRAS cells were fibroblast-like, indicating the cells had undergone EMT in response to oncogenic KRAS. Furthermore, the fibroblast-like morphology was rescued to an epithelium-like type by simultaneously overexpressing mir-200c (KRAS⫹mir-200c). Correspondingly, the epithelial marker E-cadherin was highly expressed in the control and mir-200c cells detected by immunostaining. In contrast, the mesenchymal marker vimentin was only expressed in KRAS cells. Simultaneous overexpression of mir-200c in KRAS cells restored the expression of E-cadherin, although to a lower level than that in control cells, and potently suppressed vimentin expression (Fig. 6B). The differences in mRNA and protein levels of E-cadherin and vimentin, as well as the mRNA levels of other mesenchymal markers such as N-cadherin, ZEB1, SNAIL, SLUG, and TWIST, also supported the immunostaining results (Fig. 6C and D; see Fig. S2 in the supplemental material). To evaluate whether the counteraction of KRAS and mir-200 in the EMT process had any physiological effect, we performed a three-dimensional culture assay with MCF10A cell lines. Three-dimensional culture on Matrigel is an in vitro assay that only allows mammary epithelial cells to form polarized spheroids (mammospheres) recapitulating in vivo mammary glandular architecture. This method could functionally identify epithelial cells from mesenchymal cells (37, 45, 46). As expected, control

Molecular and Cellular Biology

mcb.asm.org

2751

Zhong et al.

FIG 7 The signaling network connecting RAS and mir-200 regulates apoptosis and EMT in cancer cells. Through the signaling pathway RAF/MEK/ERK and transcription factors JUN and SP1, RAS suppresses mir-200 and hence stabilizes the expression level of BCL2 and ZEB1/2 to inhibit apoptosis and promote EMT, respectively.

and mir-200c cells formed acinus-like spheroids with E-cadherin expression limited to the cytoplasmic membrane. However, KRAS cells formed irregularly shaped aggregates with branches instead of compacted spheres, and E-cadherin was dispersed to both the cell membrane and cytoplasm. mir-200c overexpression in KRAS cells reduced the number of branching spheroids but did not rescue the aberrant subcellular localization of E-cadherin (Fig. 6E). Quantitative data indicated that overexpression of KRAS increased the number of branching spheroids from less than 10% in control cells to over 80% in KRAS cells. The overexpression of mir-200c in KRAS cells reduced the number of branching spheroids to about 50% (Fig. 6F). Considering all of the above results, we conclude that mir-200 can repress the EMT-inducing activity of KRAS, and rescue the epithelial phenotype of MCF10A cells. This repressive activity of mir-200 on KRAS-induced EMT could contribute to the inhibition of tumor cell transformation elicited by oncogenic KRAS.

tumorigenesis by regulating cancer cell apoptosis and EMT. We identified that JUN and SP1, which act downstream of KRAS, are two major transcriptional repressors inhibiting mir-200 expression, which is consistent with the functional importance of JUN and SP1 in the KRAS pathways described previously (51–54). Our findings added additional miRNA targets regulated by JUN and SP1 in response to KRAS activation, which helped to elucidate the mechanism of JUN and SP1 in mediating KRAS functions. Interestingly, SP1 has been reported to activate mir-200 expression only in epithelial cells but not in mesenchymal cell types (55), strongly suggesting that SP1 may cooperate with different cofactors to affect mir-200 expression differently in distinct cellular contexts. We demonstrated that mir-200 abrogates KRAS-induced resistance to apoptosis in MCF10A cells by direct repression of the antiapoptotic factor BCL2. Consistent with our results, BCL2 was also identified as a mir-200 target in gastric and lung cancer cells by an independent group (56). Interestingly, BCL2 was previously shown to be upregulated by KRAS (44) and suppressed by P53 (57, 58). Collectively, our observations suggest that mir-200 may serve as an important noncoding mediator in this signaling pathway, and the interaction among KRAS, mir-200, P53, and BCL2 may comprise a regulatory network controlling apoptosis of cancer cells (Fig. 7). In addition to directly targeting BCL2, mir-200 may also promote apoptosis by activating the proapoptosis factor P53 through unknown mechanisms. Given that each miRNA may directly regulate hundreds of protein-coding genes, a comprehensive profile of the mir-200 targets that are involved in cell death and the predominant targets in different cellular contexts still remain largely unknown. For example, mir-200 has been shown to elicit apoptosis through CD95 by targeting FAP-1 or by oxidative stress-induced activation (18, 19). Collectively, the proapoptosis activities of mir-200 may be important to antagonize oncogenic KRAS function and to suppress tumor growth during tumor initiation and progression. The EMT process is important for tumor cell invasion, metastasis, and cancer stem cell renewal (59). Oncogenic KRAS is sufficient to induce EMT during cellular transformation (10), which has been proposed as one of the major mechanisms for promoting tumorigenesis by KRAS. In contrast, mir-200 is a well-known inhibitor of EMT (20–26). Our results connected mir-200 and KRAS in regulating the EMT process. We found that mir-200 suppresses KRAS-induced EMT, which could serve as one of the mechanisms for mir-200 suppression of malignant transformation triggered by the oncogene KRAS. Our results provide insight into a KRAS-centered miRNA regulatory network during tumor initiation and progression.

DISCUSSION

The oncogene KRAS controls a multilayered signaling network regulating cancer cell transformation, proliferation, survival, apoptosis and EMT (1–5). In the present study, we reported that the tumor suppressor miRNA mir-200 was one of the noncoding RNA modulators in the KRAS pathways. Partially mediated by repression of mir-200 expression, mutant KRAS induces resistance to apoptosis and EMT in cancer cells, which may promote tumor formation in vivo (Fig. 7). Previous studies have revealed that oncogenic KRAS cooperates with the inactivation of proteincoding tumor suppressor genes, such as P53 (47), PTEN (48), P14/ARF (49, 50), as well as miRNA mir-143/145 (11), to promote cellular transformation. Here, we reported that KRAS potently suppresses mir-200, which has a prominent role in suppressing

2752

mcb.asm.org

ACKNOWLEDGMENTS We thank Gregory J. Goodall for kindly providing the reporter vector with mir-200b/a/429 promoter. We also thank Zissimos Mourelatos for sharing the Ago2 antibody.

FUNDING INFORMATION This work was supported, in whole or in part, by grants from the National Natural Science Foundation of China (81302262) and Guangdong Province Science and Technology Project (2015A020212019) to Xiaomin Zhong, by the Basser Center for BRCA, by the Harry Fields Professorship, and by NIH grants (R01CA142776, R01CA190415) to Lin Zhang; the NIH grant (R01CA148759) to Qihong Huang. Lan Zheng and Dongmei Zhang were supported by the China Scholarship Council.

Molecular and Cellular Biology

November 2016 Volume 36 Number 21

KRAS Represses the Expression of MicroRNA 200

REFERENCES 1. Malumbres M, Barbacid M. 2003. RAS oncogenes: the first 30 years. Nat Rev Cancer 3:459 – 465. http://dx.doi.org/10.1038/nrc1097. 2. Karnoub AE, Weinberg RA. 2008. Ras oncogenes: split personalities. Nat Rev Mol Cell Biol 9:517–531. http://dx.doi.org/10.1038/nrm2438. 3. Pylayeva-Gupta Y, Grabocka E, Bar-Sagi D. 2011. RAS oncogenes: weaving a tumorigenic web. Nat Rev Cancer 11:761–774. http://dx.doi.org/10 .1038/nrc3106. 4. Samatar AA, Poulikakos PI. 2014. Targeting RAS-ERK signalling in cancer: promises and challenges. Nat Rev Drug Discov 13:928 –942. http://dx .doi.org/10.1038/nrd4281. 5. Cox AD, Fesik SW, Kimmelman AC, Luo J, Der CJ. 2014. Drugging the undruggable RAS: mission possible? Nat Rev Drug Discov 13:828 – 851. http://dx.doi.org/10.1038/nrd4389. 6. Yuan D, Xia H, Zhang Y, Chen L, Leng W, Chen T, Chen Q, Tang Q, Mo X, Liu M, Bi F. 2014. P-Akt/miR200 signaling regulates epithelialmesenchymal transition, migration and invasion in circulating gastric tumor cells. Int J Oncol 45:2430 –2438. http://dx.doi.org/10.3892/ijo.2014 .2644. 7. Stacey DW, Watson T, Kung HF, Curran T. 1987. Microinjection of transforming ras protein induces c-fos expression. Mol Cell Biol 7:523– 527. http://dx.doi.org/10.1128/MCB.7.1.523. 8. Westwick JK, Cox AD, Der CJ, Cobb MH, Hibi M, Karin M, Brenner DA. 1994. Oncogenic Ras activates c-Jun via a separate pathway from the activation of extracellular signal-regulated kinases. Proc Natl Acad Sci U S A 91:6030 – 6034. http://dx.doi.org/10.1073/pnas.91.13.6030. 9. Finco TS, Westwick JK, Norris JL, Beg AA, Der CJ, Baldwin AS, Jr. 1997. Oncogenic Ha-Ras-induced signaling activates NF-kappaB transcriptional activity, which is required for cellular transformation. J Biol Chem 272:24113–24116. http://dx.doi.org/10.1074/jbc.272.39.24113. 10. Shin S, Dimitri CA, Yoon SO, Dowdle W, Blenis J. 2010. ERK2 but not ERK1 induces epithelial-to-mesenchymal transformation via DEF motifdependent signaling events. Mol Cell 38:114 –127. http://dx.doi.org/10 .1016/j.molcel.2010.02.020. 11. Kent OA, Chivukula RR, Mullendore M, Wentzel EA, Feldmann G, Lee KH, Liu S, Leach SD, Maitra A, Mendell JT. 2010. Repression of the miR-143/145 cluster by oncogenic Ras initiates a tumor-promoting feedforward pathway. Genes Dev 24:2754 –2759. http://dx.doi.org/10.1101 /gad.1950610. 12. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. 2001. Identification of novel genes coding for small expressed RNAs. Science 294:853– 858. http://dx.doi.org/10.1126/science.1064921. 13. Lee RC, Feinbaum RL, Ambros V. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843– 854. http://dx.doi.org/10.1016/0092-8674(93)90529-Y. 14. Lau NC, Lim LP, Weinstein EG, Bartel DP. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858 – 862. http://dx.doi.org/10.1126/science.1065062. 15. Cao H, Jheon A, Li X, Sun Z, Wang J, Florez S, Zhang Z, McManus MT, Klein OD, Amendt BA. 2013. The Pitx2:miR-200c/141:noggin pathway regulates Bmp signaling and ameloblast differentiation. Development 140:3348 –3359. http://dx.doi.org/10.1242/dev.089193. 16. Hasuwa H, Ueda J, Ikawa M, Okabe M. 2013. miR-200b and miR-429 function in mouse ovulation and are essential for female fertility. Science 341:71–73. http://dx.doi.org/10.1126/science.1237999. 17. Morante J, Vallejo DM, Desplan C, Dominguez M. 2013. Conserved miR-8/miR-200 defines a glial niche that controls neuroepithelial expansion and neuroblast transition. Dev Cell 27:174 –187. http://dx.doi.org/10 .1016/j.devcel.2013.09.018. 18. Magenta A, Cencioni C, Fasanaro P, Zaccagnini G, Greco S, SarraFerraris G, Antonini A, Martelli F, Capogrossi MC. 2011. miR-200c is upregulated by oxidative stress and induces endothelial cell apoptosis and senescence via ZEB1 inhibition. Cell Death Differ 18:1628 –1639. http://dx .doi.org/10.1038/cdd.2011.42. 19. Schickel R, Park SM, Murmann AE, Peter ME. 2010. miR-200c regulates induction of apoptosis through CD95 by targeting FAP-1. Mol Cell 38: 908 –915. http://dx.doi.org/10.1016/j.molcel.2010.05.018. 20. Gibbons DL, Lin W, Creighton CJ, Rizvi ZH, Gregory PA, Goodall GJ, Thilaganathan N, Du L, Zhang Y, Pertsemlidis A, Kurie JM. 2009. Contextual extracellular cues promote tumor cell EMT and metastasis by regulating miR-200 family expression. Genes Dev 23:2140 –2151. http: //dx.doi.org/10.1101/gad.1820209.

November 2016 Volume 36 Number 21

21. Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, Vannier C, Darling D, zur Hausen A, Brunton VG, Morton J, Sansom O, Schuler J, Stemmler MP, Herzberger C, Hopt U, Keck T, Brabletz S, Brabletz T. 2009. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol 11:1487–1495. http://dx.doi.org/10.1038/ncb1998. 22. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. 2008. A double-negative feedback loop between ZEB1SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res 68:7846 –7854. http://dx.doi.org/10.1158/0008 -5472.CAN-08-1942. 23. Bracken CP, Li X, Wright JA, Lawrence DM, Pillman KA, Salmanidis M, Anderson MA, Dredge BK, Gregory PA, Tsykin A, Neilsen C, Thomson DW, Bert AG, Leerberg JM, Yap AS, Jensen KB, KhewGoodall Y, Goodall GJ. 2014. Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion. EMBO J 33:2040 –2056. http://dx.doi.org/10.15252/embj.201488641. 24. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y, Goodall GJ. 2008. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 10:593– 601. http://dx.doi.org/10.1038/ncb1722. 25. Park SM, Gaur AB, Lengyel E, Peter ME. 2008. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the Ecadherin repressors ZEB1 and ZEB2. Genes Dev 22:894 –907. http://dx .doi.org/10.1101/gad.1640608. 26. Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, Spaderna S, Brabletz T. 2008. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep 9:582–589. http://dx.doi.org/10.1038/embor.2008.74. 27. Ungewiss C, Rizvi ZH, Roybal JD, Peng DH, Gold KA, Shin DH, Creighton CJ, Gibbons DL. 2016. The microRNA-200/Zeb1 axis regulates ECM-dependent beta1-integrin/FAK signaling, cancer cell invasion and metastasis through CRKL. Sci Rep 6:18652. http://dx.doi.org/10.1038 /srep18652. 28. Pecot CV, Rupaimoole R, Yang D, Akbani R, Ivan C, Lu C, Wu S, Han HD, Shah MY, Rodriguez-Aguayo C, Bottsford-Miller J, Liu Y, Kim SB, Unruh A, Gonzalez-Villasana V, Huang L, Zand B, MorenoSmith M, Mangala LS, Taylor M, Dalton HJ, Sehgal V, Wen Y, Kang Y, Baggerly KA, Lee JS, Ram PT, Ravoori MK, Kundra V, Zhang X, Ali-Fehmi R, Gonzalez-Angulo AM, Massion PP, Calin GA, LopezBerestein G, Zhang W, Sood AK. 2013. Tumour angiogenesis regulation by the miR-200 family. Nat Commun 4:2427. http://dx.doi.org /10.1038/ncomms3427. 29. Chen L, Gibbons DL, Goswami S, Cortez MA, Ahn YH, Byers LA, Zhang X, Yi X, Dwyer D, Lin W, Diao L, Wang J, Roybal JD, Patel M, Ungewiss C, Peng D, Antonia S, Mediavilla-Varela M, Robertson G, Jones S, Suraokar M, Welsh JW, Erez B, Wistuba II, Chen L, Peng D, Wang S, Ullrich SE, Heymach JV, Kurie JM, Qin FX. 2014. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun 5:5241. http://dx.doi.org/10.1038/ncomms6241. 30. Korpal M, Ell BJ, Buffa FM, Ibrahim T, Blanco MA, Celia-Terrassa T, Mercatali L, Khan Z, Goodarzi H, Hua Y, Wei Y, Hu G, Garcia BA, Ragoussis J, Amadori D, Harris AL, Kang Y. 2011. Direct targeting of Sec23a by miR-200s influences cancer cell secretome and promotes metastatic colonization. Nat Med 17:1101–1108. http://dx.doi.org/10.1038 /nm.2401. 31. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM. 2002. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99:15524 –15529. http://dx.doi.org/10.1073/pnas .242606799. 32. Vrba L, Jensen TJ, Garbe JC, Heimark RL, Cress AE, Dickinson S, Stampfer MR, Futscher BW. 2010. Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells. PLoS One 5:e8697. http://dx.doi.org/10.1371/journal.pone .0008697. 33. Lim YY, Wright JA, Attema JL, Gregory PA, Bert AG, Smith E, Thomas D, Lopez AF, Drew PA, Khew-Goodall Y, Goodall GJ. 2013. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state. J Cell Sci 126:2256 –2266. http://dx.doi.org/10 .1242/jcs.122275.

Molecular and Cellular Biology

mcb.asm.org

2753

Zhong et al.

34. Attema JL, Bert AG, Lim YY, Kolesnikoff N, Lawrence DM, Pillman KA, Smith E, Drew PA, Khew-Goodall Y, Shannon F, Goodall GJ. 2013. Identification of an enhancer that increases miR-200b⬃200a⬃429 gene expression in breast cancer cells. PLoS One 8:e75517. http://dx.doi.org/10 .1371/journal.pone.0075517. 35. Liu Y, Sanchez-Tillo E, Lu X, Huang L, Clem B, Telang S, Jenson AB, Cuatrecasas M, Chesney J, Postigo A, Dean DC. 2014. The ZEB1 transcription factor acts in a negative feedback loop with miR200 downstream of Ras and Rb1 to regulate Bmi1 expression. J Biol Chem 289:4116 – 4125. http://dx.doi.org/10.1074/jbc.M113.533505. 36. DuPage M, Dooley AL, Jacks T. 2009. Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc 4:1064 –1072. http://dx.doi.org/10.1038/nprot.2009.95. 37. Debnath J, Muthuswamy SK, Brugge JS. 2003. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in threedimensional basement membrane cultures. Methods 30:256 –268. http: //dx.doi.org/10.1016/S1046-2023(03)00032-X. 38. Liu CG, Calin GA, Meloon B, Gamliel N, Sevignani C, Ferracin M, Dumitru CD, Shimizu M, Zupo S, Dono M, Alder H, Bullrich F, Negrini M, Croce CM. 2004. An oligonucleotide microchip for genomewide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 101:9740 –9744. http://dx.doi.org/10.1073/pnas.0403293101. 39. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, Jacks T. 2008. Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci U S A 105:3903–3908. http://dx.doi.org/10.1073/pnas.0712321105. 40. Fenton RG, Hixon JA, Wright PW, Brooks AD, Sayers TJ. 1998. Inhibition of Fas (CD95) expression and Fas-mediated apoptosis by oncogenic Ras. Cancer Res 58:3391–3400. 41. Guerrero S, Casanova I, Farre L, Mazo A, Capella G, Mangues R. 2000. K-ras codon 12 mutation induces higher level of resistance to apoptosis and predisposition to anchorage-independent growth than codon 13 mutation or proto-oncogene overexpression. Cancer Res 60:6750 – 6756. 42. Khwaja A, Rodriguez-Viciana P, Wennstrom S, Warne PH, Downward J. 1997. Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J 16:2783–2793. http://dx.doi.org/10.1093/emboj/16.10.2783. 43. Peli J, Schroter M, Rudaz C, Hahne M, Meyer C, Reichmann E, Tschopp J. 1999. Oncogenic Ras inhibits Fas ligand-mediated apoptosis by downregulating the expression of Fas. EMBO J 18:1824 –1831. http: //dx.doi.org/10.1093/emboj/18.7.1824. 44. Kinoshita T, Yokota T, Arai K, Miyajima A. 1995. Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoietic cells. Oncogene 10:2207–2212. 45. Bates RC, Edwards NS, Yates JD. 2000. Spheroids and cell survival. Crit Rev Oncol Hematol 36:61–74. http://dx.doi.org/10.1016/S1040 -8428(00)00077-9. 46. O’Brien LE, Zegers MM, Mostov KE. 2002. Opinion. Building epithelial architecture: insights from three-dimensional culture models. Nat Rev Mol Cell Biol 3:531–537. 47. Jackson EL, Olive KP, Tuveson DA, Bronson R, Crowley D, Brown M, Jacks T. 2005. The differential effects of mutant p53 alleles on advanced murine lung cancer. Cancer Res 65:10280 –10288. http://dx.doi.org/10 .1158/0008-5472.CAN-05-2193.

2754

mcb.asm.org

48. Mulholland DJ, Kobayashi N, Ruscetti M, Zhi A, Tran LM, Huang J, Gleave M, Wu H. 2012. Pten loss and RAS/MAPK activation cooperate to promote EMT and metastasis initiated from prostate cancer stem/ progenitor cells. Cancer Res 72:1878 –1889. http://dx.doi.org/10.1158 /0008-5472.CAN-11-3132. 49. Wang Z, Ali S, Banerjee S, Bao B, Li Y, Azmi AS, Korc M, Sarkar FH. 2013. Activated K-Ras and INK4a/Arf deficiency promote aggressiveness of pancreatic cancer by induction of EMT consistent with cancer stem cell phenotype. J Cell Physiol 228:556 –562. http://dx.doi.org/10.1002/jcp .24162. 50. Wang Z, Banerjee S, Ahmad A, Li Y, Azmi AS, Gunn JR, Kong D, Bao B, Ali S, Gao J, Mohammad RM, Miele L, Korc M, Sarkar FH. 2011. Activated K-ras and INK4a/Arf deficiency cooperate during the development of pancreatic cancer by activation of Notch and NF-kappaB signaling pathways. PLoS One 6:e20537. http://dx.doi.org/10.1371/journal .pone.0020537. 51. Johnson R, Spiegelman B, Hanahan D, Wisdom R. 1996. Cellular transformation and malignancy induced by ras require c-jun. Mol Cell Biol 16:4504 – 4511. http://dx.doi.org/10.1128/MCB.16.8.4504. 52. Smeal T, Binetruy B, Mercola DA, Birrer M, Karin M. 1991. Oncogenic and transcriptional cooperation with Ha-Ras requires phosphorylation of c-Jun on serines 63 and 73. Nature 354:494 – 496. http://dx.doi.org/10 .1038/354494a0. 53. Kivinen L, Tsubari M, Haapajarvi T, Datto MB, Wang XF, Laiho M. 1999. Ras induces p21Cip1/Waf1 cyclin kinase inhibitor transcriptionally through Sp1-binding sites. Oncogene 18:6252– 6261. http://dx.doi.org/10 .1038/sj.onc.1203000. 54. Ye J, Xu RH, Taylor-Papadimitriou J, Pitha PM. 1996. Sp1 binding plays a critical role in Erb-B2- and v-ras-mediated downregulation of alpha2integrin expression in human mammary epithelial cells. Mol Cell Biol 16:6178 – 6189. http://dx.doi.org/10.1128/MCB.16.11.6178. 55. Kolesnikoff N, Attema JL, Roslan S, Bert AG, Schwarz QP, Gregory PA, Goodall GJ. 2014. Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: implications for epithelialmesenchymal transition. J Biol Chem 289:11194 –11205. http://dx.doi.org /10.1074/jbc.M113.529172. 56. Zhu W, Xu H, Zhu D, Zhi H, Wang T, Wang J, Jiang B, Shu Y, Liu P. 2012. miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol 69:723–731. http://dx.doi.org/10.1007/s00280-011-1752-3. 57. Budhram-Mahadeo V, Morris PJ, Smith MD, Midgley CA, Boxer LM, Latchman DS. 1999. p53 suppresses the activation of the Bcl-2 promoter by the Brn-3a POU family transcription factor. J Biol Chem 274:15237– 15244. http://dx.doi.org/10.1074/jbc.274.21.15237. 58. Wu Y, Mehew JW, Heckman CA, Arcinas M, Boxer LM. 2001. Negative regulation of bcl-2 expression by p53 in hematopoietic cells. Oncogene 20:240 –251. http://dx.doi.org/10.1038/sj.onc.1204067. 59. Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J, Weinberg RA. 2008. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133:704 –715. http://dx.doi .org/10.1016/j.cell.2008.03.027.

Molecular and Cellular Biology

November 2016 Volume 36 Number 21