Original Papers
Suppression of Inducible Nitric Oxide Synthase Pathway by 7-Deacetylgedunin, a Limonoid from Xylocarpus sp.
Authors
Chanin Sarigaputi 1, Nuanpan Sangpech 2, Tanapat Palaga 3, Khanitha Pudhom 4
Affiliations
1 2 3 4
Key words " gedunin l " limonoid l " anti‑inflammatory effect l " nitric oxide l " iNOS l
received revised accepted
June 27, 2014 January 6, 2015 January 7, 2015
Bibliography DOI http://dx.doi.org/ 10.1055/s-0034-1396308 Published online February 25, 2015 Planta Med 2015; 81: 312–319 © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0032‑0943 Correspondence Khanitha Pudhom Department of Chemistry Faculty of Science Chulalongkorn University Payatai Road, Patumwan Bangkok 10330 Thailand Phone: + 66 22 18 76 41 Fax: + 66 22 54 13 09 [email protected] Correspondence Tanapat Palaga Department of Microbiology Faculty of Science Chulalongkorn University Payatai Road, Patumwan Bangkok10330 Thailand Phone: + 66 22 18 50 70 Fax: + 66 22 52 75 76 [email protected]
Program in Biotechnology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand Medical Microbiology Interdisciplinary Program, Graduate School, Chulalongkorn University, Bangkok, Thailand Department of Microbiology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand Department of Chemistry, Faculty of Science, Chulalongkorn University, Bangkok, Thailand
Abstract !
In this study, limonoids isolated from Xylocarpus plants were tested for their in vitro anti-inflammatory effects. The results demonstrated that only 7-deacetylgedunin (1), a gedunin-type limonoid, significantly inhibited lipopolysaccharideand interferon-γ-stimulated production of nitric oxide in murine macrophage RAW 264.7 cells. The suppression of nitric oxide production by 1 was correlated with the downregulation of mRNA
Introduction !
Inflammation is a critical process in the host defense system response to stimuli such as pathogens or irritants. However, long-lasting chronic inflammation is known to directly or indirectly contribute to various diseases, including cancer, rheumatoid arthritis, atherosclerosis, asthma, and Alzheimerʼs and Parkinsonʼs diseases [1–6]. Upon inflammatory stimulation, macrophages play an important role and produce inflammatory mediators, such as nitric oxide (NO), and proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), interferon-γ (IFNγ), and interleukins [7, 8]. The high-output of NO sustainably produced by inducible nitric oxide synthase (iNOS) in activated macrophages has been found to play a major role in many inflammatory diseases [9]. Inflammatory stimuli, lipopolysaccharides (LPS) or a combination with IFN-γ, trigger NO production and upregulate iNOS expression in stimulated macrophages via nuclear factor (NF)-κB and mitogen-activated protein kinases (MAPKs) signaling pathways [10]. Therefore, the effective blockade of NO production might be an essential approach for the development of therapeutic agents [11]. Limonoids are tetranortriterpene derivatives from a precursor with a 4,4,8-trimethyl-17-fu-
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
and protein expression of inducible nitric oxide synthase. Mechanistic studies revealed that the transcriptional activity of nuclear factor-κB, IκBα degradation, and the activation of mitogen-activated protein kinases, stimulated with lipopolysaccharide and interferon-γ, were suppressed by 1. Supporting information available online at http://www.thieme-connect.de/products
ranylsteroid skeleton. The genus Xylocarpus (Meliaceae) has proved to be a rich source of an array of structurally diverse limonoids [12–17], some of which display interesting biological properties, including insecticidal, antifeedant, anticancer, and anti-inflammatory activities [18–21]. All species of Xylocarpus plants provide similar traditional usages [22]. The bark has been used in dysentery, diarrhea, other abdominal troubles, and as a febrifuge, while the root is used for treating cholera. The seeds are used as a poultice for swelling, and the seed ash is applied as a treatment for itching. Additionally, the bark pressings of both Xylocarpus granatum and Xylocarpus moluccensis are utilized to treat cholera and fever, including that caused by malaria. Recently we reported the isolation and identification of a number of limonoids from the seeds of three Thai mangroves in this genus, X. granatum, X. moluccensis, and X. rumphii [23–26]. As part of an ongoing program to search for anti-inflammatory agents from Thai natural products and based on the activity of the extracts of the Xylocarpus plants, the present study was undertaken to evaluate the effects of isolated limonoids on inflammatory responses and to investigate the molecular mechanism of action of selected limonoids.
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
312
Results and Discussion !
Thirty-one known limonoids obtained from seeds of Xylocarpus " Fig. 1), including phragmalins, mexicanolides, gedunins, sp. (l andirobins, and protolimonoids, were examined for anti-inflammatory activities by monitoring their inhibition of NO production in RAW 264.7 murine macrophages co-stimulated with LPS and IFNγ. Cells were pretreated with tested limonoids at a single dose of 25 µM for 2 h, then activated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for an additional 24 h. In addition, the cell viability " Fig. 2. was determined by the MTT assay. Results are shown in l Among the limonoids tested, only one gedunin-type limonoid, 7deacetylgedunin (1), displayed more than 95 % of inhibitory ac" Fig. 2). A gedunin-type tivity, without any significant toxicity (l limonoid with a hydroxy group at C-7α was more active than that with an acetoxy or a keto group, as has been observed for compounds 1–3. It was subsequently found that compound 1 exhibited remarkable activity with an IC50 value of 4.9 ± 0.1 µM " Fig. 3) compared to indomethacin, a nonsteroidal anti-inflam(l matory agent (IC50 = 28.8 ± 0.1 µM). 7-Deacetylgedunin (1) has not only been found in Xylocarpus plants, but it has also been found in Azadirachta indica (Meliaceae) [27]. It has recently been reported to possess cytotoxicity against some cancer cell lines [27]. Also, our previous reports have shown that it provided anti-inflammatory activity in the preliminary screening assay [26]; however, its molecular mechanism of action has not yet been investigated. Further, 7-deacetylgedunin (1) was tested on macrophage cells to examine whether it can reduce iNOS expression, a protein expression of inflammation-associated molecules triggered by LPS and IFNγ. RAW 264.7 cells were treated with LPS and IFNγ with or without the indicated concentrations of 1 to observe the effect " Fig. 4, upon treatment with on iNOS expression. As shown in l LPS and IFNγ, the protein expression level of iNOS increased markedly, while the expression level was almost undetectable in unstimulated cells. Pretreatment of the cells with different concentrations of 1 led to a decrease in iNOS expression in a dose-dependent manner. Additionally, the result obtained suggested that the treatment of 1 at a concentration of 10 µM also attenuated " Fig. 5 A). The reLPS and IFNγ-induced iNOS mRNA expression (l duction in NO concentration in the cell culture supernatant was " Fig. 5 B) concomitantly with the mRNA expresfurther found (l sion. These data indicated that 1 can downregulate LPS and IFNγ-induced iNOS expression at the transcriptional level. To elucidate the molecular mechanism of 1 in suppressing LPS and IFNγ-induced iNOS mRNA expression, the activation of the NF-κB and MAPK signaling pathways was investigated. The crucial steps in the NF-κB activation are ubiquitination and subsequent degradation of IκB and nuclear translocation of NF-κB. NF-κB is a heterodimeric complex consisting of p65 and p50 subunits, normally existing in the cytoplasm of the unstimulated cells, due to an association with inhibitory proteins, IκB. However, when the cells are activated by proinflammatory stimuli, IκB are rapidly phosphorylated, degraded, and thereby dissociated from NF-κB. The free active NF-κB complex is then translocated into the nucleus where it regulates gene expression [28, 29]. The degradation of IκBα and the subsequent nuclear translocation of the p65 subunit of NF-κB are both important in NF-κB activation by various stimuli. Thus, we investigated the effect of 1 on the degradation of IκBα by Western blotting. A time-course experiment showed that the level of IκBα obviously decreased at 15 and 30 min after treatment with LPS and IFNγ, whereas IκBα degrada-
" Fig. 6). Consistent with this supprestion was protected by 1 (l sion of IκBα degradation, pretreatment with 1 clearly suppressed the level of phosphor-p65 compared to cells treated with DMSO, " Fig. 7). To further confirm this inhibitory the vehicle control (l effect of 1 on NF-κB activation, we therefore monitored its impact on the nuclear translocation of NF-κB p65 by a localization study using immunofluorescence staining. In LPS and IFNγ co-stimulated control cells, p65 was normally sequestered in the cytoplasm " Fig. 8 A), while the nuclear localat the start of the stimulation (l ization of p65 in RAW 264.7 cells was significantly induced within 15 min of the stimulation. Obviously, upon treatment with 1 for 15 min, the nuclear localization of p65 from cytoplasm into nucleus was inhibited; however, it was recovered at 30 min " Fig. 8 B). This suggested that compound 1 suppresses NF-κB (l activation by delaying, not abrogating, the nuclear localization of NF-κB p65. The phosphorylation of MAPKs (p38, ERK1/2, and SAPK/JNK) has been proven to be a critical component in the production of NO and proinflammatory cytokines in stimulated macrophages [30]. To further explore whether the inhibition of NO production by 1 is mediated through the MAPK pathway, the presence of phosphor-p38, phosphor-ERK1/2, and phosphor-SAPK/JNK in compound 1-treated or DMSO-treated cells upon LPS and IFNγ stimulation was investigated. Interestingly, pretreatment of the cells with 1 markedly suppressed LPS and IFNγ-induced phosphorylation of p38 and SAPK/JNK after 15 min of stimulation, whereas the level of ERK1/2 phosphorylation was slightly reduced " Fig. 9). Consequently, the suppression of the NF-κB and MAPK (l activation pathways by 1, upon stimulation with LPS and IFNγ, cooperatively contributed to its anti-inflammatory activity. Taken together, our finding indicated that a gedunin limonoid, 7deacetylgedunin (1), has promising anti-inflammatory activity by interfering with iNOS expression, which is mediated mainly by suppressing the NF-κB and MAPK pathways. Hence, this compound might have therapeutic potential for inflammation-related diseases.
Materials and Methods !
Cell lines, chemicals, and biochemicals Mouse macrophage RAW 264.7 cells (ATCC No. TIB-71) were obtained from ATCC. Indomethacin (purity ≥ 97% by HPLC), lipopolysaccharide (LPS, from E. coli, purity < 1% protein and < 1 % mRNA), mouse recombinant interferon-γ (IFNγ, purity ≥ 98% by SDS-PAGE), MTT (purity ≥ 97.5 % by HPLC), and dimethyl sulfoxide (DMSO, purity ≥ 99 %, cell culture grade) were purchased from Sigma-Aldrich. DMEM, FBS, Hepes free acid, and sodium pyruvate were obtained from Thermo Scientific. Mammalian protein extraction buffer was obtained from GE Healthcare Bio-Science. RevertAid™ Reverse Transcriptase and Maxima™ SYBR Green qPCR Master Mix were purchased from Fermentas. TRIzol® reagent was purchased from Life Technologies. All antibodies were purchased from Cell Signaling Technology. Unless stated otherwise, all other reagents were from Sigma-Aldrich.
Cell culture RAW 264.7 cells were maintained in DMEM supplemented with 10 % (v/v) FBS, 100 mM sodium pyruvate, Hepes free acid, penicillin G (100 U/mL), and streptomycin (100 µg/mL) at 37 °C in a humidified incubator with 5% CO2. The medium was routinely changed every two days.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
313
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Original Papers
Fig. 1 Chemical structures of tested limonoids isolated from seeds of Xylocarpus spp.
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
314
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
Fig. 2
Effect of isolated limonoids 1–31 on NO inhibition and cytotoxicity in RAW 264.7 cells. NO production and cell viability were measured in triplicate.
Fig. 3 A Chemical structure of 7-deacetylgedunin (1). B Concentration-response curve of 1 on NO inhibition and cytotoxicity in RAW 264.7 macrophage cells. Cell viability was measured in triplicate.
Origin and purity of tested limonoids
Nitric oxide inhibitory assay
Limonoids of Xylocarpus sp. were from the compound library of our laboratory. These compounds were obtained from seeds and/or seed kernels of X. granatum, X. moluccensis, and X. rumphii, collected in Thailand. All compounds had a purity > 96 % by 1 H NMR analysis. Compounds 1, 3, 5, and 24–29 were isolated from seed kernels of X. granatum [23], whereas 8–10 were obtained from X. moluccensis [24], both of which were collected in Samutsongkram province. Compounds 7, 11–12, 15–16, and 23 were isolated from X. moluccensis collected in Phuket [26], and compounds 17–22 were isolated from X. rumphii from Rayong province [25]. Compounds 2, 4, 6, and 31 were obtained from X. granatum, while 13–14 and 30 were isolated from X. moluccensis, both of which were from Suratthani province (Supporting Information).
Since NO is extremely unstable and undergoes repaid oxidative degradation to nitrite (NO2−) and nitrate (NO3−), followed by the conversion of nitrate to nitrite, the amount of NO was thus indirectly determined by measuring the amount of nitrite in the cell culture supernatant using Greiss reagent [31]. RAW 264.7 cells were seeded in 96-well plates at a density of 1 × 104 cells/well in 100 µL and were incubated overnight at 37 °C and 5% CO2. Subsequently, cells were treated by various concentrations of the test compounds and vehicle (DMSO) for 2 h, followed by LPS (100 ng/ mL) and IFNγ (10 ng/mL). After an additional 24 h of incubation, the nitrite released in culture medium was reacted with Griess reagent, followed by incubation for 10 min under dark conditions at room temperature. The absorbance was measured at 540 nm, and the inhibitory activities were calculated from a standard calibration curve obtained from different concentrations of sodium nitrite. Indomethacin was used as a positive control [32–33].
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
315
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Original Papers
Fig. 4 Effect of 1 on the expression of iNOS protein. A Inhibitory effect of 1 on iNOS expression in RAW 264.7 cells in a time-dependent manner. Cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/ mL) for the indicated time. B Dose-dependent inhibitory effect of 1 on iNOS expression. Cells were pretreated with the indicated concentrations of 1 for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for a further 3 h. The levels of iNOS protein were examined by Western blot analysis.
Fig. 5 A Inhibitory effect of 1 on iNOS gene expression in RAW 264.7 cells. Cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for a further 6 h. Expression of the iNOS gene was quantified by qRT‑PCR. B Inhibitory effect of 1 on NO production in RAW 264.7 cells. The concentration of NO in the cell culture supernatant was determined by Greiss reagent.
Cell viability assay After the Griess reaction, MTT solution in PBS (0.5 mg/mL, final concentration) was added to each well and further incubated for 4 h. The medium was discarded, and 0.04 N HCl in isopropanol (100 µL) was added to dissolve the formazan crystals. The absorbance was measured at 540 nm, and the percent survival was determined by comparison with a control group.
Western blot analysis Cells treated as indicated in the text were washed with cold PBS and lysed with cell lysis buffer according to the manufacturerʼs instructions. Cell lysates were centrifuged at 5000 rpm for 5 min, and supernatants were collected as samples. Equal amounts (30 µg) of total protein in each cell lysate were separated in 10 % SDS-PAGE and transferred to a PVDF membrane. The membranes were blocked with 3 % skim milk in PBS containing 0.05 % Tween20 and incubated overnight at 4 °C with corresponding primary antibodies in 3 % skim milk in PBS containing 0.05 % Tween-20, followed by incubation with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The signals were detected using the chemiluminescence method.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
Quantitative reverse transcription polymerase chain reaction (qRT‑PCR) Cells pretreated with 10 µM of compound 1 or vehicle for 2 h were incubated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for 6 h. Total RNA was isolated from the cell culture by using TRIzol® reagent, according to the manufacturerʼs instructions, and cDNA was synthesized from 0.2 µg RNA by using RevertAid™ reverse transcriptase. The quantitative real-time PCR was performed by using Maxima™ SYBR Green qPCR Master Mix, according to the manufacturerʼs instructions. The specific primers used to amplify were as follows: iNOS: 5′-CCCTTCCGAAGTTTCTGGCAGCAGC‑3′ (forward) and 5′-GGCTGTCAGAGCCTCGTGGTCTTGG‑3′ (reverse); β-actin: 5′-ACCAACTGGGACGACATGGAGAA‑3′ (forward) and 5′GTGGTGGTGAAGCTGTAGCC‑3′ (reverse) [34]. PCR was performed with the following conditions: initial denaturation step at 95 °C for 3 min, repeated cycling (40 times) step of denaturation for 30 s, annealing at 60 °C (55 °C for β-actin) for 30 s, and elongation at 72 °C for 1 min, followed by one cycle of 72 °C for 10 min for the final extension. The relative expression levels were calculated and analyzed by the 2-ΔΔCT method [35].
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
316
Original Papers
317
Fig. 7 Effect of 1 on the activation of the NF-κB pathway and phosphorylation of p65. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of phosphorylated and total p65 was assessed by Western blot analysis. The detection of β-actin was carried out to confirm the equal loading of proteins. B The ratios of phosphorylated and total p65 protein are presented.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Fig. 6 Effect of 1 on the activation of the NF-κB pathway and the degradation of IκBα. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of IκBα was assessed by Western blot analysis and the detection of β-actin was carried out to confirm the equal loading of proteins. B Densitometric analysis of IκBα expression was normalized on the basis of β-actin levels.
Original Papers
Fig. 8 Immunofluorescence microscopy analysis of the nuclear translocation of p65 in RAW 264.7 cells. Cells were pretreated with 1 at 10 µM (A) and vehicle control, DMSO, (B) for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time, following staining for NF-κB p65. The cells were observed under a fluorescent microscope. (Color figure available online only.)
Fig. 9 Effect of 1 on the activation of the MAPK pathway. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/ mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of phosphorylated and total ERK1/2, phosphorylated and total p38, and phosphorylated and total SAPK/JNK was assessed by Western blot analysis. B to D The ratios of phosphorylated and total protein are presented.
Immunofluorescence staining The NF-κB p65 nuclear localization was detected by immunofluorescence assays using a fluorescence microscope. For this study, macrophages RAW 264.7 were seeded directly on 8-well
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
glass slides for 12 h, pretreated for 2 h with 1 (10 µM). Cells were stimulated with LPS and IFN-γ in the presence of 1 or DMSO for 0, 15, 30, and 60 min. Cells were washed with PBS, fixed with 4 % paraformaldehyde in PBS for 10 min, permeabilized with 0.2 %
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
318
Triton-X 100 for 2 min, and then blocked with 10% anti-FcγR blocker (2.4G2) in 10 % FBS for 10 min at room temperature. After blocking, cells were stained with rabbit anti-p65 antibody in 1.5 % FBS and incubated for 1 h. After washing with PBS, the secondary antibody, anti-rabbit IgG [H + L, (Fab′)2 fragment] Alexa Fluor® 555 (Cell Signaling Technology), was added and incubated for 1 h in the dark. The position of the cell nuclei was examined with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI). After washing with PBS, the coverslips were mounted onto glass slides with anti-fade medium (Mowiol), the fluorescence was visualized using inverted fluorescent microscopy, and the images were recorded.
Statistical analysis Unless otherwise indicated, all data were analyzed by an independent t-test using SPSS software. The results were considered to be significant when p < 0.05.
Supporting information Extraction and isolation of limonoids 2, 4, 6, 13-14, and 30–31 are available as Supporting Information.
Acknowledgements !
This work was supported by the Thailand Research Fund and Chulalongkorn University through the Royal Golden Jubilee PhD program (Grant No. PHD/0009/2553), and the 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment). This research has also been partially supported by the Ratchadaphiseksomphot Endowment Fund of Chulalongkorn University (RES560530208-AS).
Conflict of Interest !
The authors declare no conflict of interest.
References 1 Weninger SC, Yankner BA. Inflammation and Alzheimerʼs disease: the good, the bad, and the ugly. Nat Med 2001; 7: 527–528 2 Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From bronchoconstriction to airways inflammation and remodeling. Am J Respir Crit Care Med 2000; 161: 1720–1745 3 Libby P. Inflammation in atherosclerosis. Nature 2002; 420: 868–874 4 Rajput S, Wilber A. Roles of inflammation in cancer initiation, progression, and metastasis. Front Biosci (Schol Ed) 2010; 2: 176–183 5 Christodoulou C, Choy EH. Joint inflammation and cytokine inhibition in rheumatoid arthritis. Clin Exp Med 2006; 6: 13–19 6 Tufekci KU, Meuwissen R, Genc S, Genc K. Inflammation in Parkinsonʼs disease. Adv Protein Chem Struct Biol 2012; 88: 69–132 7 Lonkar P, Dedon PC. Reactive species and DNA damage in chronic inflammation: reconciling chemical mechanisms and biological fates. Int J Cancer 2011; 128: 1999–2009 8 Fujihara M, Muroi M, Tanamoto K, Suzuki T, Azuma H, Ikeda H. Molecular mechanisms of macrophage activation and deactivation by lipopolysaccharide: roles of the receptor complex. Pharmacol Ther 2003; 100: 171–194 9 Aktan F. iNOS-mediated nitric oxide production and its regulation. Life Sci 2004; 75: 639–653 10 Mancino A, Lawrence T. Nuclear-κB and tumor associated macrophages. Clin Cancer Res 2010; 16: 784–789 11 Korhonen R, Lahti A, Kankaanranta H, Moilanen E. Nitric oxide production and signaling in inflammation. Curr Drug Targets Inflamm Allergy 2005; 4: 471–479
12 Kubo I, Miura I, Nakanishi K. The structure of xylomollin, a secoiridoid hemiacetal acetal. J Am Chem Soc 1976; 98: 6704–6705 13 Alvi KA, Crews P, Aalbersberg B, Prasad R. Limonoids from the Fijian medicinal plant dabi (Xylocarpus). Tetrahedron Lett 1991; 47: 8943–8948 14 Kokpol U, Chavasiri W, Tip-pyang S, Veerachato G, Zhao FL, Simpson J, Weavers RT. A limonoid from Xylocarpus granatum. Phytochemistry 1995; 41: 903–905 15 Yin S, Wang XN, Fan CQ, Lin LP, Ding J, Yue JM. Limonoids from the seeds of the marine mangrove Xylocarpus granatum. J Nat Prod 2007; 70: 682–685 16 Wu J, Zhang S, Bruhn T, Xiao Q, Ding H, Bringmann G. Xylogranatins F–R: antifeedants from the Chinese mangrove, Xylocarpus granatum, a new biogenetic pathway to tetranotriterpenoids. Chem Eur J 2008; 14: 1129–1144 17 Li MY, Yang SX, Pan JY, Xiao Q, Satyanandamurty T, Wu J. Moluccensins A–G, phragmalins with a conjugated C‑30 carbonyl group from a Krishna mangrove, Xylocarpus moluccensis. J Nat Prod 2009; 72: 1657–1662 18 Wu J, Yang SX, Li MY, Feng G, Pan JY, Xiao Q, Sinkkonen J, Satyanandamurty T. Limonoids and tirucallane derivatives from seeds of a Krishna mangrove, Xylocarpus moluccensis. J Nat Prod 2010; 73: 644–649 19 Li J, Li MY, Feng G, Zhang J, Karonen M, Sinkkonen J, Satyanandamurty T, Wu J. Moluccensins R–Y, limonoids from the seeds of a mangrove, Xylocarpus moluccensis. J Nat Prod 2012; 75: 1277–1283 20 Toume K, Kamiya K, Arai MA, Mori N, Sadhu SK, Ahmed F, Ishibashi M. Xylogranin B: a potent Wnt signal inhibitory limonoid from Xylocarpus granatum. Org Lett 2013; 15: 6106–6109 21 Li J, Li MY, Bruhn T, Katele FZ, Xiao Q, Pedpradab P, Wu J, Bringmann G. Thaixylomolins A–C: limonoids featuring two new motifs from the Thai Xylocarpus moluccensis. Org Lett 2013; 15: 3682–3685 22 Lakshmi V, Gupta P. An overview of the genus Xylocarpus. Nat Prod Res 2008; 22: 1197–1224 23 Pudhom K, Sommit D, Nuclear P, Ngamrojanavanich N, Petsom A. Protoxylocarpins F–H, protolimonoids from seed kernels of Xylocarpus granatum. J Nat Prod 2009; 72: 2188–2191 24 Pudhom K, Sommit D, Nuclear P, Ngamrojanavanich N, Petsom A. Moluccensins H–J, 30-ketophragmalin limonoids from Xylocarpus moluccensis. J Nat Prod 2010; 73: 263–266 25 Sarigaputi C, Nuanyai T, Teerawatananond T, Pengpreecha S, Muangsin N, Pudhom K. Xylorumphiins A–D, mexicanolide limonoids from the seed kernels of Xylocarpus rumphii. J Nat Prod 2010; 73: 1456–1459 26 Ravangpai W, Sommit D, Teerawatananond T, Sinpranee N, Palaga T, Pengpreecha S, Muangsin N, Pudhom K. Limonoids from seeds of Thai Xylocarpus moluccensis. Bioorg Med Chem Lett 2011; 21: 4485–4489 27 Kikuchi T, Ishii K, Noto T, Takahashi A, Tabata K, Suzuki T, Akihisa T. Cytotoxic and apoptosis-inducing activities of limonoids from the seeds of Azadirachta indica (Neem). J Nat Prod 2011; 74: 866–870 28 Lawrence T, Fong C. The resolution of inflammation: anti-inflammatory roles for NF-kappaB. Int J Biochem Cell Biol 2010; 42: 519–523 29 Karin M, Greten FR. NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 2005; 5: 749– 759 30 Zhou HY, Shin EM, Guo LY, Youn UJ, Bae K, Kang SS, Zou LB, Kim YS. Antiinflammatory activity of 4-methoxyhonokiol is a function of the inhibition of iNOS and COX‑2 expression in RAW 264.7 macrophages via NF-κB, JNK and p 38 MAPK in activation. Eur J Pharmacol 2008; 586: 340–349 31 Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite, and [15 N] nitrate in biological fluids. Anal Biochem 1982; 126: 131–138 32 Mendes SAC, Mansoor TA, Rodrigues A, Armas JB, Ferreira MJU. Anti-inflammatory guaiane-type sesquiterpenes from the fruits of Pittosporum undulatum. Phytochemistry 2013; 95: 308–314 33 Shih MF, Cheng YD, Shen CR, Cherng JY. A molecular pharmacology study into the anti-inflammatory actions of Euphorbia hirta L. on the LPS-induced RAW 264.7 cells through selective iNOS protein inhibition. J Nat Med 2010; 64: 330–335 34 Chantaranothai C, Palaga T, Karnchanatat A, Sangvanich P. Inhibition of nitric oxide production in the macrophage-like RAW 264.7 cell line by protein from the rhizomes of Zingiberaceae plants. Prep Biochem Biotechnol 2013; 43: 60–78 35 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method. Methods 2001; 25: 402–408
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
319
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Copyright of Planta Medica is the property of Georg Thieme Verlag Stuttgart and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Suppression of Inducible Nitric Oxide Synthase Pathway by 7-Deacetylgedunin, a Limonoid from Xylocarpus sp.
Authors
Chanin Sarigaputi 1, Nuanpan Sangpech 2, Tanapat Palaga 3, Khanitha Pudhom 4
Affiliations
1 2 3 4
Key words " gedunin l " limonoid l " anti‑inflammatory effect l " nitric oxide l " iNOS l
received revised accepted
June 27, 2014 January 6, 2015 January 7, 2015
Bibliography DOI http://dx.doi.org/ 10.1055/s-0034-1396308 Published online February 25, 2015 Planta Med 2015; 81: 312–319 © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0032‑0943 Correspondence Khanitha Pudhom Department of Chemistry Faculty of Science Chulalongkorn University Payatai Road, Patumwan Bangkok 10330 Thailand Phone: + 66 22 18 76 41 Fax: + 66 22 54 13 09 [email protected] Correspondence Tanapat Palaga Department of Microbiology Faculty of Science Chulalongkorn University Payatai Road, Patumwan Bangkok10330 Thailand Phone: + 66 22 18 50 70 Fax: + 66 22 52 75 76 [email protected]
Program in Biotechnology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand Medical Microbiology Interdisciplinary Program, Graduate School, Chulalongkorn University, Bangkok, Thailand Department of Microbiology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand Department of Chemistry, Faculty of Science, Chulalongkorn University, Bangkok, Thailand
Abstract !
In this study, limonoids isolated from Xylocarpus plants were tested for their in vitro anti-inflammatory effects. The results demonstrated that only 7-deacetylgedunin (1), a gedunin-type limonoid, significantly inhibited lipopolysaccharideand interferon-γ-stimulated production of nitric oxide in murine macrophage RAW 264.7 cells. The suppression of nitric oxide production by 1 was correlated with the downregulation of mRNA
Introduction !
Inflammation is a critical process in the host defense system response to stimuli such as pathogens or irritants. However, long-lasting chronic inflammation is known to directly or indirectly contribute to various diseases, including cancer, rheumatoid arthritis, atherosclerosis, asthma, and Alzheimerʼs and Parkinsonʼs diseases [1–6]. Upon inflammatory stimulation, macrophages play an important role and produce inflammatory mediators, such as nitric oxide (NO), and proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), interferon-γ (IFNγ), and interleukins [7, 8]. The high-output of NO sustainably produced by inducible nitric oxide synthase (iNOS) in activated macrophages has been found to play a major role in many inflammatory diseases [9]. Inflammatory stimuli, lipopolysaccharides (LPS) or a combination with IFN-γ, trigger NO production and upregulate iNOS expression in stimulated macrophages via nuclear factor (NF)-κB and mitogen-activated protein kinases (MAPKs) signaling pathways [10]. Therefore, the effective blockade of NO production might be an essential approach for the development of therapeutic agents [11]. Limonoids are tetranortriterpene derivatives from a precursor with a 4,4,8-trimethyl-17-fu-
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
and protein expression of inducible nitric oxide synthase. Mechanistic studies revealed that the transcriptional activity of nuclear factor-κB, IκBα degradation, and the activation of mitogen-activated protein kinases, stimulated with lipopolysaccharide and interferon-γ, were suppressed by 1. Supporting information available online at http://www.thieme-connect.de/products
ranylsteroid skeleton. The genus Xylocarpus (Meliaceae) has proved to be a rich source of an array of structurally diverse limonoids [12–17], some of which display interesting biological properties, including insecticidal, antifeedant, anticancer, and anti-inflammatory activities [18–21]. All species of Xylocarpus plants provide similar traditional usages [22]. The bark has been used in dysentery, diarrhea, other abdominal troubles, and as a febrifuge, while the root is used for treating cholera. The seeds are used as a poultice for swelling, and the seed ash is applied as a treatment for itching. Additionally, the bark pressings of both Xylocarpus granatum and Xylocarpus moluccensis are utilized to treat cholera and fever, including that caused by malaria. Recently we reported the isolation and identification of a number of limonoids from the seeds of three Thai mangroves in this genus, X. granatum, X. moluccensis, and X. rumphii [23–26]. As part of an ongoing program to search for anti-inflammatory agents from Thai natural products and based on the activity of the extracts of the Xylocarpus plants, the present study was undertaken to evaluate the effects of isolated limonoids on inflammatory responses and to investigate the molecular mechanism of action of selected limonoids.
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
312
Results and Discussion !
Thirty-one known limonoids obtained from seeds of Xylocarpus " Fig. 1), including phragmalins, mexicanolides, gedunins, sp. (l andirobins, and protolimonoids, were examined for anti-inflammatory activities by monitoring their inhibition of NO production in RAW 264.7 murine macrophages co-stimulated with LPS and IFNγ. Cells were pretreated with tested limonoids at a single dose of 25 µM for 2 h, then activated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for an additional 24 h. In addition, the cell viability " Fig. 2. was determined by the MTT assay. Results are shown in l Among the limonoids tested, only one gedunin-type limonoid, 7deacetylgedunin (1), displayed more than 95 % of inhibitory ac" Fig. 2). A gedunin-type tivity, without any significant toxicity (l limonoid with a hydroxy group at C-7α was more active than that with an acetoxy or a keto group, as has been observed for compounds 1–3. It was subsequently found that compound 1 exhibited remarkable activity with an IC50 value of 4.9 ± 0.1 µM " Fig. 3) compared to indomethacin, a nonsteroidal anti-inflam(l matory agent (IC50 = 28.8 ± 0.1 µM). 7-Deacetylgedunin (1) has not only been found in Xylocarpus plants, but it has also been found in Azadirachta indica (Meliaceae) [27]. It has recently been reported to possess cytotoxicity against some cancer cell lines [27]. Also, our previous reports have shown that it provided anti-inflammatory activity in the preliminary screening assay [26]; however, its molecular mechanism of action has not yet been investigated. Further, 7-deacetylgedunin (1) was tested on macrophage cells to examine whether it can reduce iNOS expression, a protein expression of inflammation-associated molecules triggered by LPS and IFNγ. RAW 264.7 cells were treated with LPS and IFNγ with or without the indicated concentrations of 1 to observe the effect " Fig. 4, upon treatment with on iNOS expression. As shown in l LPS and IFNγ, the protein expression level of iNOS increased markedly, while the expression level was almost undetectable in unstimulated cells. Pretreatment of the cells with different concentrations of 1 led to a decrease in iNOS expression in a dose-dependent manner. Additionally, the result obtained suggested that the treatment of 1 at a concentration of 10 µM also attenuated " Fig. 5 A). The reLPS and IFNγ-induced iNOS mRNA expression (l duction in NO concentration in the cell culture supernatant was " Fig. 5 B) concomitantly with the mRNA expresfurther found (l sion. These data indicated that 1 can downregulate LPS and IFNγ-induced iNOS expression at the transcriptional level. To elucidate the molecular mechanism of 1 in suppressing LPS and IFNγ-induced iNOS mRNA expression, the activation of the NF-κB and MAPK signaling pathways was investigated. The crucial steps in the NF-κB activation are ubiquitination and subsequent degradation of IκB and nuclear translocation of NF-κB. NF-κB is a heterodimeric complex consisting of p65 and p50 subunits, normally existing in the cytoplasm of the unstimulated cells, due to an association with inhibitory proteins, IκB. However, when the cells are activated by proinflammatory stimuli, IκB are rapidly phosphorylated, degraded, and thereby dissociated from NF-κB. The free active NF-κB complex is then translocated into the nucleus where it regulates gene expression [28, 29]. The degradation of IκBα and the subsequent nuclear translocation of the p65 subunit of NF-κB are both important in NF-κB activation by various stimuli. Thus, we investigated the effect of 1 on the degradation of IκBα by Western blotting. A time-course experiment showed that the level of IκBα obviously decreased at 15 and 30 min after treatment with LPS and IFNγ, whereas IκBα degrada-
" Fig. 6). Consistent with this supprestion was protected by 1 (l sion of IκBα degradation, pretreatment with 1 clearly suppressed the level of phosphor-p65 compared to cells treated with DMSO, " Fig. 7). To further confirm this inhibitory the vehicle control (l effect of 1 on NF-κB activation, we therefore monitored its impact on the nuclear translocation of NF-κB p65 by a localization study using immunofluorescence staining. In LPS and IFNγ co-stimulated control cells, p65 was normally sequestered in the cytoplasm " Fig. 8 A), while the nuclear localat the start of the stimulation (l ization of p65 in RAW 264.7 cells was significantly induced within 15 min of the stimulation. Obviously, upon treatment with 1 for 15 min, the nuclear localization of p65 from cytoplasm into nucleus was inhibited; however, it was recovered at 30 min " Fig. 8 B). This suggested that compound 1 suppresses NF-κB (l activation by delaying, not abrogating, the nuclear localization of NF-κB p65. The phosphorylation of MAPKs (p38, ERK1/2, and SAPK/JNK) has been proven to be a critical component in the production of NO and proinflammatory cytokines in stimulated macrophages [30]. To further explore whether the inhibition of NO production by 1 is mediated through the MAPK pathway, the presence of phosphor-p38, phosphor-ERK1/2, and phosphor-SAPK/JNK in compound 1-treated or DMSO-treated cells upon LPS and IFNγ stimulation was investigated. Interestingly, pretreatment of the cells with 1 markedly suppressed LPS and IFNγ-induced phosphorylation of p38 and SAPK/JNK after 15 min of stimulation, whereas the level of ERK1/2 phosphorylation was slightly reduced " Fig. 9). Consequently, the suppression of the NF-κB and MAPK (l activation pathways by 1, upon stimulation with LPS and IFNγ, cooperatively contributed to its anti-inflammatory activity. Taken together, our finding indicated that a gedunin limonoid, 7deacetylgedunin (1), has promising anti-inflammatory activity by interfering with iNOS expression, which is mediated mainly by suppressing the NF-κB and MAPK pathways. Hence, this compound might have therapeutic potential for inflammation-related diseases.
Materials and Methods !
Cell lines, chemicals, and biochemicals Mouse macrophage RAW 264.7 cells (ATCC No. TIB-71) were obtained from ATCC. Indomethacin (purity ≥ 97% by HPLC), lipopolysaccharide (LPS, from E. coli, purity < 1% protein and < 1 % mRNA), mouse recombinant interferon-γ (IFNγ, purity ≥ 98% by SDS-PAGE), MTT (purity ≥ 97.5 % by HPLC), and dimethyl sulfoxide (DMSO, purity ≥ 99 %, cell culture grade) were purchased from Sigma-Aldrich. DMEM, FBS, Hepes free acid, and sodium pyruvate were obtained from Thermo Scientific. Mammalian protein extraction buffer was obtained from GE Healthcare Bio-Science. RevertAid™ Reverse Transcriptase and Maxima™ SYBR Green qPCR Master Mix were purchased from Fermentas. TRIzol® reagent was purchased from Life Technologies. All antibodies were purchased from Cell Signaling Technology. Unless stated otherwise, all other reagents were from Sigma-Aldrich.
Cell culture RAW 264.7 cells were maintained in DMEM supplemented with 10 % (v/v) FBS, 100 mM sodium pyruvate, Hepes free acid, penicillin G (100 U/mL), and streptomycin (100 µg/mL) at 37 °C in a humidified incubator with 5% CO2. The medium was routinely changed every two days.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
313
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Original Papers
Fig. 1 Chemical structures of tested limonoids isolated from seeds of Xylocarpus spp.
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
314
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
Fig. 2
Effect of isolated limonoids 1–31 on NO inhibition and cytotoxicity in RAW 264.7 cells. NO production and cell viability were measured in triplicate.
Fig. 3 A Chemical structure of 7-deacetylgedunin (1). B Concentration-response curve of 1 on NO inhibition and cytotoxicity in RAW 264.7 macrophage cells. Cell viability was measured in triplicate.
Origin and purity of tested limonoids
Nitric oxide inhibitory assay
Limonoids of Xylocarpus sp. were from the compound library of our laboratory. These compounds were obtained from seeds and/or seed kernels of X. granatum, X. moluccensis, and X. rumphii, collected in Thailand. All compounds had a purity > 96 % by 1 H NMR analysis. Compounds 1, 3, 5, and 24–29 were isolated from seed kernels of X. granatum [23], whereas 8–10 were obtained from X. moluccensis [24], both of which were collected in Samutsongkram province. Compounds 7, 11–12, 15–16, and 23 were isolated from X. moluccensis collected in Phuket [26], and compounds 17–22 were isolated from X. rumphii from Rayong province [25]. Compounds 2, 4, 6, and 31 were obtained from X. granatum, while 13–14 and 30 were isolated from X. moluccensis, both of which were from Suratthani province (Supporting Information).
Since NO is extremely unstable and undergoes repaid oxidative degradation to nitrite (NO2−) and nitrate (NO3−), followed by the conversion of nitrate to nitrite, the amount of NO was thus indirectly determined by measuring the amount of nitrite in the cell culture supernatant using Greiss reagent [31]. RAW 264.7 cells were seeded in 96-well plates at a density of 1 × 104 cells/well in 100 µL and were incubated overnight at 37 °C and 5% CO2. Subsequently, cells were treated by various concentrations of the test compounds and vehicle (DMSO) for 2 h, followed by LPS (100 ng/ mL) and IFNγ (10 ng/mL). After an additional 24 h of incubation, the nitrite released in culture medium was reacted with Griess reagent, followed by incubation for 10 min under dark conditions at room temperature. The absorbance was measured at 540 nm, and the inhibitory activities were calculated from a standard calibration curve obtained from different concentrations of sodium nitrite. Indomethacin was used as a positive control [32–33].
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
315
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Original Papers
Fig. 4 Effect of 1 on the expression of iNOS protein. A Inhibitory effect of 1 on iNOS expression in RAW 264.7 cells in a time-dependent manner. Cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/ mL) for the indicated time. B Dose-dependent inhibitory effect of 1 on iNOS expression. Cells were pretreated with the indicated concentrations of 1 for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for a further 3 h. The levels of iNOS protein were examined by Western blot analysis.
Fig. 5 A Inhibitory effect of 1 on iNOS gene expression in RAW 264.7 cells. Cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for a further 6 h. Expression of the iNOS gene was quantified by qRT‑PCR. B Inhibitory effect of 1 on NO production in RAW 264.7 cells. The concentration of NO in the cell culture supernatant was determined by Greiss reagent.
Cell viability assay After the Griess reaction, MTT solution in PBS (0.5 mg/mL, final concentration) was added to each well and further incubated for 4 h. The medium was discarded, and 0.04 N HCl in isopropanol (100 µL) was added to dissolve the formazan crystals. The absorbance was measured at 540 nm, and the percent survival was determined by comparison with a control group.
Western blot analysis Cells treated as indicated in the text were washed with cold PBS and lysed with cell lysis buffer according to the manufacturerʼs instructions. Cell lysates were centrifuged at 5000 rpm for 5 min, and supernatants were collected as samples. Equal amounts (30 µg) of total protein in each cell lysate were separated in 10 % SDS-PAGE and transferred to a PVDF membrane. The membranes were blocked with 3 % skim milk in PBS containing 0.05 % Tween20 and incubated overnight at 4 °C with corresponding primary antibodies in 3 % skim milk in PBS containing 0.05 % Tween-20, followed by incubation with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The signals were detected using the chemiluminescence method.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
Quantitative reverse transcription polymerase chain reaction (qRT‑PCR) Cells pretreated with 10 µM of compound 1 or vehicle for 2 h were incubated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for 6 h. Total RNA was isolated from the cell culture by using TRIzol® reagent, according to the manufacturerʼs instructions, and cDNA was synthesized from 0.2 µg RNA by using RevertAid™ reverse transcriptase. The quantitative real-time PCR was performed by using Maxima™ SYBR Green qPCR Master Mix, according to the manufacturerʼs instructions. The specific primers used to amplify were as follows: iNOS: 5′-CCCTTCCGAAGTTTCTGGCAGCAGC‑3′ (forward) and 5′-GGCTGTCAGAGCCTCGTGGTCTTGG‑3′ (reverse); β-actin: 5′-ACCAACTGGGACGACATGGAGAA‑3′ (forward) and 5′GTGGTGGTGAAGCTGTAGCC‑3′ (reverse) [34]. PCR was performed with the following conditions: initial denaturation step at 95 °C for 3 min, repeated cycling (40 times) step of denaturation for 30 s, annealing at 60 °C (55 °C for β-actin) for 30 s, and elongation at 72 °C for 1 min, followed by one cycle of 72 °C for 10 min for the final extension. The relative expression levels were calculated and analyzed by the 2-ΔΔCT method [35].
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
316
Original Papers
317
Fig. 7 Effect of 1 on the activation of the NF-κB pathway and phosphorylation of p65. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of phosphorylated and total p65 was assessed by Western blot analysis. The detection of β-actin was carried out to confirm the equal loading of proteins. B The ratios of phosphorylated and total p65 protein are presented.
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Fig. 6 Effect of 1 on the activation of the NF-κB pathway and the degradation of IκBα. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of IκBα was assessed by Western blot analysis and the detection of β-actin was carried out to confirm the equal loading of proteins. B Densitometric analysis of IκBα expression was normalized on the basis of β-actin levels.
Original Papers
Fig. 8 Immunofluorescence microscopy analysis of the nuclear translocation of p65 in RAW 264.7 cells. Cells were pretreated with 1 at 10 µM (A) and vehicle control, DMSO, (B) for 2 h and then stimulated with LPS (100 ng/mL) and IFNγ (10 ng/mL) for the indicated time, following staining for NF-κB p65. The cells were observed under a fluorescent microscope. (Color figure available online only.)
Fig. 9 Effect of 1 on the activation of the MAPK pathway. RAW 264.7 cells were pretreated with 1 at 10 µM for 2 h and then stimulated with LPS (100 ng/ mL) and IFNγ (10 ng/mL) for the indicated time. A The expression of phosphorylated and total ERK1/2, phosphorylated and total p38, and phosphorylated and total SAPK/JNK was assessed by Western blot analysis. B to D The ratios of phosphorylated and total protein are presented.
Immunofluorescence staining The NF-κB p65 nuclear localization was detected by immunofluorescence assays using a fluorescence microscope. For this study, macrophages RAW 264.7 were seeded directly on 8-well
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
glass slides for 12 h, pretreated for 2 h with 1 (10 µM). Cells were stimulated with LPS and IFN-γ in the presence of 1 or DMSO for 0, 15, 30, and 60 min. Cells were washed with PBS, fixed with 4 % paraformaldehyde in PBS for 10 min, permeabilized with 0.2 %
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
318
Triton-X 100 for 2 min, and then blocked with 10% anti-FcγR blocker (2.4G2) in 10 % FBS for 10 min at room temperature. After blocking, cells were stained with rabbit anti-p65 antibody in 1.5 % FBS and incubated for 1 h. After washing with PBS, the secondary antibody, anti-rabbit IgG [H + L, (Fab′)2 fragment] Alexa Fluor® 555 (Cell Signaling Technology), was added and incubated for 1 h in the dark. The position of the cell nuclei was examined with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI). After washing with PBS, the coverslips were mounted onto glass slides with anti-fade medium (Mowiol), the fluorescence was visualized using inverted fluorescent microscopy, and the images were recorded.
Statistical analysis Unless otherwise indicated, all data were analyzed by an independent t-test using SPSS software. The results were considered to be significant when p < 0.05.
Supporting information Extraction and isolation of limonoids 2, 4, 6, 13-14, and 30–31 are available as Supporting Information.
Acknowledgements !
This work was supported by the Thailand Research Fund and Chulalongkorn University through the Royal Golden Jubilee PhD program (Grant No. PHD/0009/2553), and the 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment). This research has also been partially supported by the Ratchadaphiseksomphot Endowment Fund of Chulalongkorn University (RES560530208-AS).
Conflict of Interest !
The authors declare no conflict of interest.
References 1 Weninger SC, Yankner BA. Inflammation and Alzheimerʼs disease: the good, the bad, and the ugly. Nat Med 2001; 7: 527–528 2 Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From bronchoconstriction to airways inflammation and remodeling. Am J Respir Crit Care Med 2000; 161: 1720–1745 3 Libby P. Inflammation in atherosclerosis. Nature 2002; 420: 868–874 4 Rajput S, Wilber A. Roles of inflammation in cancer initiation, progression, and metastasis. Front Biosci (Schol Ed) 2010; 2: 176–183 5 Christodoulou C, Choy EH. Joint inflammation and cytokine inhibition in rheumatoid arthritis. Clin Exp Med 2006; 6: 13–19 6 Tufekci KU, Meuwissen R, Genc S, Genc K. Inflammation in Parkinsonʼs disease. Adv Protein Chem Struct Biol 2012; 88: 69–132 7 Lonkar P, Dedon PC. Reactive species and DNA damage in chronic inflammation: reconciling chemical mechanisms and biological fates. Int J Cancer 2011; 128: 1999–2009 8 Fujihara M, Muroi M, Tanamoto K, Suzuki T, Azuma H, Ikeda H. Molecular mechanisms of macrophage activation and deactivation by lipopolysaccharide: roles of the receptor complex. Pharmacol Ther 2003; 100: 171–194 9 Aktan F. iNOS-mediated nitric oxide production and its regulation. Life Sci 2004; 75: 639–653 10 Mancino A, Lawrence T. Nuclear-κB and tumor associated macrophages. Clin Cancer Res 2010; 16: 784–789 11 Korhonen R, Lahti A, Kankaanranta H, Moilanen E. Nitric oxide production and signaling in inflammation. Curr Drug Targets Inflamm Allergy 2005; 4: 471–479
12 Kubo I, Miura I, Nakanishi K. The structure of xylomollin, a secoiridoid hemiacetal acetal. J Am Chem Soc 1976; 98: 6704–6705 13 Alvi KA, Crews P, Aalbersberg B, Prasad R. Limonoids from the Fijian medicinal plant dabi (Xylocarpus). Tetrahedron Lett 1991; 47: 8943–8948 14 Kokpol U, Chavasiri W, Tip-pyang S, Veerachato G, Zhao FL, Simpson J, Weavers RT. A limonoid from Xylocarpus granatum. Phytochemistry 1995; 41: 903–905 15 Yin S, Wang XN, Fan CQ, Lin LP, Ding J, Yue JM. Limonoids from the seeds of the marine mangrove Xylocarpus granatum. J Nat Prod 2007; 70: 682–685 16 Wu J, Zhang S, Bruhn T, Xiao Q, Ding H, Bringmann G. Xylogranatins F–R: antifeedants from the Chinese mangrove, Xylocarpus granatum, a new biogenetic pathway to tetranotriterpenoids. Chem Eur J 2008; 14: 1129–1144 17 Li MY, Yang SX, Pan JY, Xiao Q, Satyanandamurty T, Wu J. Moluccensins A–G, phragmalins with a conjugated C‑30 carbonyl group from a Krishna mangrove, Xylocarpus moluccensis. J Nat Prod 2009; 72: 1657–1662 18 Wu J, Yang SX, Li MY, Feng G, Pan JY, Xiao Q, Sinkkonen J, Satyanandamurty T. Limonoids and tirucallane derivatives from seeds of a Krishna mangrove, Xylocarpus moluccensis. J Nat Prod 2010; 73: 644–649 19 Li J, Li MY, Feng G, Zhang J, Karonen M, Sinkkonen J, Satyanandamurty T, Wu J. Moluccensins R–Y, limonoids from the seeds of a mangrove, Xylocarpus moluccensis. J Nat Prod 2012; 75: 1277–1283 20 Toume K, Kamiya K, Arai MA, Mori N, Sadhu SK, Ahmed F, Ishibashi M. Xylogranin B: a potent Wnt signal inhibitory limonoid from Xylocarpus granatum. Org Lett 2013; 15: 6106–6109 21 Li J, Li MY, Bruhn T, Katele FZ, Xiao Q, Pedpradab P, Wu J, Bringmann G. Thaixylomolins A–C: limonoids featuring two new motifs from the Thai Xylocarpus moluccensis. Org Lett 2013; 15: 3682–3685 22 Lakshmi V, Gupta P. An overview of the genus Xylocarpus. Nat Prod Res 2008; 22: 1197–1224 23 Pudhom K, Sommit D, Nuclear P, Ngamrojanavanich N, Petsom A. Protoxylocarpins F–H, protolimonoids from seed kernels of Xylocarpus granatum. J Nat Prod 2009; 72: 2188–2191 24 Pudhom K, Sommit D, Nuclear P, Ngamrojanavanich N, Petsom A. Moluccensins H–J, 30-ketophragmalin limonoids from Xylocarpus moluccensis. J Nat Prod 2010; 73: 263–266 25 Sarigaputi C, Nuanyai T, Teerawatananond T, Pengpreecha S, Muangsin N, Pudhom K. Xylorumphiins A–D, mexicanolide limonoids from the seed kernels of Xylocarpus rumphii. J Nat Prod 2010; 73: 1456–1459 26 Ravangpai W, Sommit D, Teerawatananond T, Sinpranee N, Palaga T, Pengpreecha S, Muangsin N, Pudhom K. Limonoids from seeds of Thai Xylocarpus moluccensis. Bioorg Med Chem Lett 2011; 21: 4485–4489 27 Kikuchi T, Ishii K, Noto T, Takahashi A, Tabata K, Suzuki T, Akihisa T. Cytotoxic and apoptosis-inducing activities of limonoids from the seeds of Azadirachta indica (Neem). J Nat Prod 2011; 74: 866–870 28 Lawrence T, Fong C. The resolution of inflammation: anti-inflammatory roles for NF-kappaB. Int J Biochem Cell Biol 2010; 42: 519–523 29 Karin M, Greten FR. NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 2005; 5: 749– 759 30 Zhou HY, Shin EM, Guo LY, Youn UJ, Bae K, Kang SS, Zou LB, Kim YS. Antiinflammatory activity of 4-methoxyhonokiol is a function of the inhibition of iNOS and COX‑2 expression in RAW 264.7 macrophages via NF-κB, JNK and p 38 MAPK in activation. Eur J Pharmacol 2008; 586: 340–349 31 Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite, and [15 N] nitrate in biological fluids. Anal Biochem 1982; 126: 131–138 32 Mendes SAC, Mansoor TA, Rodrigues A, Armas JB, Ferreira MJU. Anti-inflammatory guaiane-type sesquiterpenes from the fruits of Pittosporum undulatum. Phytochemistry 2013; 95: 308–314 33 Shih MF, Cheng YD, Shen CR, Cherng JY. A molecular pharmacology study into the anti-inflammatory actions of Euphorbia hirta L. on the LPS-induced RAW 264.7 cells through selective iNOS protein inhibition. J Nat Med 2010; 64: 330–335 34 Chantaranothai C, Palaga T, Karnchanatat A, Sangvanich P. Inhibition of nitric oxide production in the macrophage-like RAW 264.7 cell line by protein from the rhizomes of Zingiberaceae plants. Prep Biochem Biotechnol 2013; 43: 60–78 35 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method. Methods 2001; 25: 402–408
Sarigaputi C et al. Suppression of Inducible …
Planta Med 2015; 81: 312–319
319
This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.
Original Papers
Copyright of Planta Medica is the property of Georg Thieme Verlag Stuttgart and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
