J Neurosurg 120:1193–1200, 2014 ©AANS, 2014
Suppression of cerebral aneurysm formation in rats by a tumor necrosis factor–a inhibitor Laboratory investigation Toshihiro Yokoi, M.D.,1 Takahiro Isono, Ph.D., 2 Makoto Saitoh, M.D.,1 Yayoi Yoshimura, M.D.,1 and Kazuhiko Nozaki, M.D., Ph.D.1 1 Department of Neurosurgery and 2General Research Laboratory, Shiga University of Medical Science, Shiga, Japan
Object. Although cerebral aneurysmal subarachnoid hemorrhage is a devastating disease for humans, effective medical treatments have not yet been established. Recent reports have shown that regression of some inflammatoryrelated mediators has protective effects in experimental cerebral aneurysm models. This study corroborated the effectiveness of tumor necrosis factor–a (TNF-a) inhibitor for experimentally induced cerebral aneurysms in rats. Methods. Five-week-old male rats were prepared for induction of cerebral aneurysms and divided into 3 groups, 2 groups administered different concentrations of a TNF-a inhibitor (etanercept), and 1 control group. One month after aneurysm induction, 7-T MRI was performed. The TNF-a inhibitor groups received subcutaneous injection of 25 mg or 2.5 mg of etanercept, and the control group received subcutaneous injection of normal saline every week. The TNF-a inhibitor administrations were started at 1 month after aneurysm induction to evaluate its suppressive effects on preexisting cerebral aneurysms. Arterial circles of Willis were obtained and evaluated 3 months after aneurysm induction. Results. Rats administered a TNF-a inhibitor experienced significant increases in media thickness and reductions in aneurysmal size compared with the control group. Immunohistochemical staining showed that treatment with a TNF-a inhibitor suppressed matrix metalloproteinase (MMP)–9 and inducible nitric oxide synthase (iNOS) expression through the luminal surface of the endothelial cell layer, the media and the adventitia at the site of aneurysmal formation, and the anterior cerebral artery–olfactory artery bifurcation. Quantitative polymerase chain reaction also showed suppression of MMP-9 and iNOS by TNF-a inhibitor administration. Conclusions. Therapeutic administration of a TNF-a inhibitor significantly reduced the formation of aneurysms in rats. These data also suggest that TNF-a suppression reduced some inflammatory-related mediators that are in the downstream pathway of nuclear factor-kB. (http://thejns.org/doi/abs/10.3171/2014.1.JNS13818)
Key Words • tumor necrosis factor–α inhibitor • cerebral aneurysm • nuclear factor kappa B • rat • vascular disorders
C
erebral aneurysmal subarachnoid hemorrhage is a catastrophic disease for humans, but effective medical treatments have not yet been established. The pathogenesis of cerebral saccular aneurysms has been investigated using several aneurysm models.5,15,28,32,33 Hashimoto and colleagues established an experimentally induced cerebral aneurysm model in rats, and hemodynamic stress has been emphasized for aneurysmal formation. In the early stage after aneurysm induction, disruption of the elastic laminae occurs,22,24 which is followed by infiltra-
Abbreviations used in this paper: ACA = anterior cerebral artery; IKK = inhibitor of kB kinase; IL = interleukin; iNOS = inducible nitric oxide synthase; MMP = matrix metalloproteinase; NF-kB = nuclear factor-kB; PCR = polymerase chain reaction; TNF = tumor necrosis factor.
J Neurosurg / Volume 120 / May 2014
tion of the inflammatory-related mediator to the arterial wall, and proteolytic damage to the arterial wall caused by inflammation-related mediators appears to play a crucial role. Several kinds of mediators have been reported to be decisive causes of the formation of abdominal aortic aneurysms,13,23 and Chyatte et al. demonstrated the expression of immunoglobulin, macrophages, and T-lymphocytes in humans in the walls of unruptured cerebral aneurysms.11 Macrophages can induce programmed cell death through a tumor necrosis factor (TNF)–a dependent pathway.8 Jayaraman et al. have demonstrated TNF-a mRNA and protein in ruptured cerebral aneurysms in humans.19 Tumor necrosis factor–a activation induces apoptosis via activation of caspase-8,1 which leads to the activation of inducible nitric oxide synthase (iNOS). Aoki et al. showed important roles of nuclear factor-kB (NF-kB) in the induc1193
T. Yokoi et al. tion and formation of cerebral aneurysms in rat aneurysmal models.4 Nuclear factor-kB also regulates the transcription of some proinflammatory genes such as iNOS36 and matrix metalloproteinases (MMPs),9 which are of functional importance for the progression of cerebral aneurysms. Recent reports have shown that regression of some inflammatoryrelated molecules have protective effects in experimental cerebral aneurysm models.2–4,11,16,28 One of the main activators of NF-kB is TNF-a, which is one of the main proinflammatory cytokines and plays a fundamental role in initiating and regulating the cascade of events leading to inflammatory reactions.20 The main aim of this study was to elucidate the role of TNF-a in the formation and augmentation of cerebral aneurysms, to seek possible medical therapeutic approaches for the suppression and prevention of aneurysmal formation and subarachnoid hemorrhage.
thickness 1.5 mm, scanning length 40 mm, 32 slices, with no gap. We conducted MRI 3 times on each rat, with the slice offset shifted to the same direction by 0.5° every time. In all 3 groups, 1 of the rats was chosen by random sampling at 1 month after aneurysm induction. The 7-T MR angiography revealed a saccular-type aneurysm at the right anterior cerebral artery (ACA)–olfactory artery bifurcation in all 3 groups (Fig. 1). Administration of TNF-α Inhibitor
To examine the effect of a TNF-a inhibitor on preexisting aneurysms, TNF-a inhibitor administration started 1 month after aneurysm induction. We used etanercept as a TNF-a inhibitor. Etanercept was provided by Takeda Pharmaceutical Co. Ltd. and Pfizer Co., Inc. Animals in
Methods Experimentally Induced Cerebral Aneurysms in Rats
Animal care and experiments complied with Japanese community standards on the care and use of laboratory animals, and all protocols were permitted by the Ethical Committee of the Research Center of Animal Life Science at Shiga University of Medical Science. Cerebral aneurysms were induced using a method previously described.29 While anesthetized with 50 mg/kg of intraperitoneal pentobarbital, the left common carotid artery and posterior branches of the bilateral renal arteries were ligated at the same time with 3-0 nylon thread in 5-week-old male Sprague-Dawley rats (Oriental Bioservice). A total of 36 rats were operated on. All of the aneurysm-induced rats (n = 36) were divided into 3 groups in random order: 1) a high-dose TNF-a inhibitor group (n = 12); 2) a low-dose TNF-a inhibitor group (n = 12); and 3) a vehicle group (control group, n = 12). After aneurysm induction, animals in all groups were fed with a high-salt diet containing 8% sodium chloride (Oriental Bioservicen) for 3 months. At 1 and 3 months after aneurysm induction, systemic blood pressure was measured by the tail-cuff method (Softron) with rats kept in a small container without any anesthesia. Magnetic Resonance Imaging
We conducted 7-T MRI at 1 month after aneurysm induction while the rats were anesthetized using an intraperitoneal injection of 30 mg/kg of pentobarbital. The main purpose of this MRI evaluation was confirmation of aneurysm formation when the etanercept administration was started. We intended to emphasize that the effectiveness of this drug was reduction of or cure from the preexisting aneurysm, not prevention of aneurysm formation. The MRI was performed on a Unity INOVA 7T MR machine (Varian) equipped with a Magnex gradient system capable of producing pulse gradients of 400 mT/m in each of the 3 orthogonal axes, and with the JMTB-7.0/400/SS conducting magnet (Jastec; bore size 400 mm, central field magnetic force 7 T). We used a 38-mm volume coil for the brain scan procedure. The MRI parameters were as follows: TR 40 msec, TE 3.24 msec, flip angle 45°,
1194
Fig. 1. Magnetic resonance angiograms obtained 1 month after aneurysm induction in each of the 3 groups. Arrowheads indicate saccular aneurysms at the bifurcation of the ACA and olfactory artery. A: Control group. B: Low-dose etanercept group. C: High-dose etanercept group.
J Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression the high-dose TNF-a inhibitor group received subcutaneous injection of 25 mg of etanercept with 0.5 ml of normal saline every week for 2 months. Those in the low-dose TNF-a inhibitor group received 2.5 mg of etanercept with 0.5 ml of normal saline in the same fashion. The control group received subcutaneous injection of 0.5 ml of normal saline every week for 2 months. The doses were selected based on previous studies that demonstrated the effectiveness of etanercept in other disease models.21,27,31 Evaluation of Induced Cerebral Aneurysms in Rats
Arterial circles of Willis were evaluated 3 months after aneurysm induction. After systemic blood pressure was measured by the tail-cuff method, rats were deeply anesthetized and perfused transcardially with 4% paraformaldehyde by perfusion pump (Atto) at 100–150 ml/m. We conducted this immobilization and euthanasia of 7 rats in each group by random sampling. The ACA and olfactory artery bifurcation was stripped and embedded in optimal cutting temperature compound (Sakura). Fivemm sections were cut in the sagittal plane, mounted on silane-coated slides, and observed under a light microscope after H & E and Masson trichrome staining. To evaluate the pathological changes occurring in aneurysmal walls, we analyzed the thinning of the medial smooth-muscle cell layer and aneurysmal size. The thickness of media was evaluated by the ratio of minimal thickness in aneurysmal walls to thickness in surrounding normal arterial walls. Aneurysmal size was calculated as the mean of the maximal longitudinal diameter and the maximal transverse diameter.
Quantitative Polymerase Chain Reaction
For the analysis of gene expression of cerebral aneurysms in rats, total RNA was extracted from the frozen arterial circles of Willis by the acid guanidium thiocyanate–chloroform method as previously reported.10 Realtime polymerase chain reaction (PCR) was performed with a LightCycler 480 SYBR MasterIMix and LightCycler 480 System II (Roche Diagnostics) by 45 cycles of denaturation (95°C, 15 sec), annealing (60°C, 15 sec), and extension (72°C, 15 sec). Gene expression was normalized with the β-actin gene. The rat-specific primer sequences are listed in Table 1. We conducted this quantitative PCR of 3 rats in each group by random sampling. All quantification analysis was performed in triplicate.
Immunohistochemical Analysis
The ACA and olfactory artery bifurcation was stripped and embedded in optimal cutting temperature compound. Five-mm sections were cut and mounted on silane-coated slides in the sagittal plane. After blocking with 5% donkey serum (Jackson Immune Research), primary antibodies were incubated for 1 hour at room temperature followed by incubation peroxidase-labeled secondary antibodies (simple stain MAX-PO; Nichirei) for 1 hour at room temperature. The primary antibodies and titer of antibodies used in the present study were goat polyclonal MMP-9 antibody (Santa Cruz Biotechnology, Inc.) and rabbit polyclonal anti–iNOS antibody (Santa Cruz Biotechnology, Inc.). We conducted this immunohistochemical analysis of 2 rats in each group by random sampling.
Statistical Analysis
Data (means ± SDs) were analyzed using the MannWhitney U-test for 2-group comparisons. Differences were considered statistically significant at p < 0.05.
Results Effect of Etanercept on Aneurysmal Formation
In each group, systolic blood pressure was significantly elevated at 3 months after aneurysm induction as compared with the systolic blood pressure at 1 month after aneurysm induction. There was no significant difference at 1 month or 3 months after aneurysm induction between the control group (74.8 ± 2.4 mm Hg after 1 month, 118.8 ± 2.8 mm Hg after 3 months), low-dose etanercept group (75.8 ± 2.1 mm Hg after 1 month, 115.7 ± 21.2 mm Hg after 3 months) and high-dose etanercept group (76.1 ± 1.9 mm Hg after 1 month, 121.1 ± 1.9 mm Hg after 3 months; Fig. 2A and B). The maximum size of the aneurysm was significantly smaller in the low-dose and high-dose etanercept groups than in the control group, and the maximum size of the aneurysm in the high-dose etanercept group was significantly smaller than in the low-dose etanercept group (Fig. 2C). The thickness of media was significantly larger in the low-dose and high-dose etanercept groups than in the control group (Fig. 2D). Aneurysm formation was markedly suppressed in the etanercept groups, and the internal elastic membrane was also thicker in the etanercept-treated groups as compared with the control group (Fig. 3). We
TABLE 1: Oligonucleotides used for quantitative real-time PCR Gene
Forward Primer
Reverse Primer
IKKα IKKβ NF-κB IL-1β iNOS MMP-9 β-actin
GCTAAGTACCAAAAACAGAGAACG TCAAAACCAGCATCCAGATTGAC CTGCCTGCTCCTGGAGGGTG CCCTGCAGCTGGAGAGTGTG AGGTGCTATTCCCAGCCCAAC TTCAAGGACGGTCGGTATTGG AAGTCCCTCACCCTCCCAAAG
CCATTGCTAGAAGAGGCACATC GCCATCATCCGTTCTACCAGG GCTCATAGAGAGGCTCAAAGTTC GGGTTCCATGGTGAAGTCAAC CAGGGATTCTGGAACATTCTGTG CTTCTTGGACTGCGGATCCTC AAGCAATGCTGTCACCTTCCC
J Neurosurg / Volume 120 / May 2014
1195
T. Yokoi et al.
Fig. 2. Bar graphs showing the effects of etanercept on the progression of cerebral aneurysms. A and B: Graphs showing systolic blood pressure before etanercept administration (A) and at 2 months after etanercept administration (B). There were no significant differences between the 3 groups (control, 0 mg; etanercept, 2.5 and 25 mg) at these two time points. C: Graph of aneurysmal sizes in the control group and the etanercept groups. The maximum size is the longest diameter of the aneurysm. The mean value is the average of the longest diameter and the rectangular diameter of the aneurysm. D: Relative median thickness of aneurysmal walls compared with that of surrounding normal arterial walls in the control and etanercept-treated groups. Data were analyzed using the Mann-Whitney U-test. * p < 0.05, ** p < 0.01.
created these definitions to measure each length objectively. In this study, the evaluators were not blinded; however, the methodology of each evaluation was standardized. Immunohistochemical Staining
The discontinuity of the internal elastic lamina at the ACA–olfactory artery bifurcation occurred in all 3 groups, but apparent outward bulging of the arterial wall was distinct in the control group. There was some elastin, which formed from tropoelastin. There was some inflammation-related reaction just outside of the internal elastic laminae. The cells in the photomicrographs were infiltrated monocytes from the internal vessels, which differentiate into macrophages and dendritic cells. According to the immunohistochemical analysis, iNOS and MMP9 were expressed mainly in the area with fragmentation or disappearance of the internal elastic lamina (Fig. 4). This tendency was obvious in the control group and lowdose TNF-a inhibitor group. The expressions of iNOS and MMP-9 proteins in the media were reduced at the aneurysm formation site in the etanercept groups, but we could not find a significant reduction in the expression of these molecules in the adventitia due to edge artifact.
Quantitative PCR Analysis
We conducted a significance test between rats in the
1196
control group and those in the high-dose etanercept group. In the etanercept group, mRNA expression levels of MMP9, iNOS, and interleukin (IL)-1b were significantly lower than those in the control group at 3 months after aneurysm induction (Fig. 5A). In the etanercept group, mRNA expression levels of NF-kB, phospho-IKKa, and phosphoIKKb were lower than those in the control group at 3 months after aneurysm induction (Fig. 5B).
Discussion
Recent studies revealed the involvement of inflammation in cerebral aneurysm formation.14,17 Arterial walls are continuously loaded by circulating blood flow, which generates hemodynamic force. Because hemodynamic force with subsequent mechanical injury gives rise to infiltration of macrophages into the arterial wall, iNOS is constitutively expressed mainly in smooth muscle cells. Histopathological studies on clipped human aneurysms have identified macrophages and lymphocytes in the aneurysmal wall.11,14 Chyatte et al.11 revealed that the number of macrophages accumulated in the luminal surface of the endothelium and in the adventitia increase with progression of an aneurysm. Hashimoto et al. investigated the total and phosphorylated levels of different signaling proteins or cytokines produced by inflammatory cells known to participate in vascular remodeling or inflammation of cerebral aneurysms such as J Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression
Fig. 3. Photomicrographs of H & E (A–C) and Masson trichrome staining (D–F) of the ACA–olfactory artery bifurcation in a rat 3 months after aneurysm induction. * Outer lumen of the vessels. ** Internal lumen of the vessels. Bar = 50 mm.
MMP.18 Investigations in several animal models of aortic aneurysms have demonstrated that increased macrophage expression of MMP-9 plays a critical role in the development and progression of abdominal aortic aneurysms.7,26 In addition to the mechanisms above, the functional role of NF-kB that activates MMP-9 expression has been demonstrated in a variety of animal models of abdominal aortic aneurysms.25,30 A recent paper indicated that activation of NF-kB also appeared at the site of cerebral aneurysm formation.4 Cerebral aneurysms tend to be formed at the arterial bifurcation by hemodynamic shear stress, and fluid shear stress has been shown to promote
the translocation into the nucleus of NF-kB in cultured endothelial cells by activating IkB kinase.6 One of the main activators of NF-kB is TNF-a, which is one of the main proinflammatory cytokines and plays a key role in initiating and regulating the cascade of events leading to inflammatory reactions.20 Tumor necrosis factor–a is encoded on chromosome 6 and exists in its biologically active form as a homotrimer of a 17-kD subunit.34 Tumor necrosis factor–a can locate upstream of the NK-kB pathway, and TNF-a–induced NF-kB activation results from activation of the inhibitor of the kB kinase (IKK) complex, which phosphorylates
Fig. 4. Immunohistochemical staining of iNOS (A–C) and MMP-9 (D–F) 3 months after aneurysm induction. Arrowheads indicate iNOS-positive cells. Arrows indicate MMP-9–positive cells. * Outer lumen of the vessels. ** Internal lumen of the vessels. Bar = 50 mm.
J Neurosurg / Volume 120 / May 2014
1197
T. Yokoi et al.
Fig. 5. Bar graphs showing quantitative PCR-measured mRNA expression. A: Expression of MMP-9, iNOS, and IL-b of the control group (Cont.) and high-dose etanercept-treated group (TNF; n = 3 per group). Error bars represent standard errors from 3 independent experiments. B: Expression of NF-kB, phospho-IKKa, and phospho-IKKb of control group (Cont.) and high-dose etanercept-treated group (TNF; n = 3 per group). Error bars represent standard errors from 3 independent experiments.
the inhibitor of kB family members that are normally bound to NF-kB and thereby retains it in the cytoplasm.35 Tumor necrosis factor–a has a broad range of biological activities associated with inflammatory-related disorders. The significant increase in mRNA expression of TNF-a was also observed in human cerebral aneurysms.19 The increased expression of TNF-a in cerebral aneurysms may lead to activation of its downstream signaling components to initiate vessel weakening and remodeling via inflammation and apoptosis.19 Thus, activation of the 1198
proinflammatory cytokine TNF-a may contribute to the development of abnormal vasculature during aneurysmal formation. We are planning to determine the relationship between an immune reaction and TNF-a upregulation by using immunohistochemical double staining of CD-68 and the secondary antibody of anti-rat TNF-a. After we discontinued the administration of the TNF-α inhibitor in the aneurysmal model, we did not observe the arterial circles of Willis. We have no data about the change in aneurysms after we ceased adminJ Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression istration of the TNF-a inhibitor. We are currently working on observing the changes in aneurysms after ceasing the administration of TNF-α inhibitor in rats. We assume that hemodynamic stress will cause aneurysmal formation in these animals as well, using sodium loading and lasting renal hypertension. To reduce the matured aneurysms would require suppression of inflammatory cells infiltrated into the aneurysmal wall. In this paper, we examined the distribution of TNFa inhibitor in cerebral aneurysm development using an experimental model in rats. We showed that aneurysmal formation was significantly reduced by 2-month treatment with etanercept 1 month after aneurysm induction in rats, which suggests that TNF-a may be involved in the enlargement of cerebral aneurysms. These data suggest that inhibition of TNF-a and its downstream signaling components contributes to the pathological mechanisms of cerebral aneurysms via the suppressive effect for proinflammatory status. The suppression of not only NF-kB, phospho-IKKa, and phospho-IKKb mRNAs but also iNOS and MMP-9 mRNA (one of the downstream molecules of the NF-kB pathway) by a TNF-a inhibitor might indicate that the inhibition of aneurysm formation by the TNF-a inhibitor occurs through an NF-kB pathway. One of the major target molecules of TNF-a is NF-kB, and its activation leads to macrophage recruitment into the aneurysmal walls. Macrophages secrete MMP-9, which causes extracellular matrix degradation in aneurysmal walls, and release of nitric oxide via iNOS upregulation. A genetic analysis also revealed that a TNF-a gene or linked locus significantly influences the risk of aneurysmal subarachnoid hemorhhage.12 There is considerable theoretical evidence for the potential of TNF-a inhibitors to affect cerebral aneurysms.37 To our knowledge, this is the first study that demonstrated that therapeutic administration of a TNF-a inhibitor significantly reduces aneurysm formation in mammals, possibly through an NF-kB–related manner. The results of this study suggest that TNF-a inhibitors may have therapeutic potential in the prevention of cerebral aneurysm formation. Additional investigations in higher mammals will be needed to determine the possible clinical application of TNF-a inhibitors to human cerebral aneurysms. We are currently studying the effectiveness and side effects of these inhibitors using mammal models.
Conclusions
Therapeutic administration of a TNF-a inhibitor significantly reduced aneurysm formation in rats. These data suggest that the inhibition of TNF-a might be a novel tool in the treatment of cerebral aneurysms by reducing some inflammatory-related mediators. Acknowledgment We thank Mrs. Akiyo Ushio (Central Research Laboratory, Shiga University of Medical Science) for assistance with quantitative real-time PCR. Disclosure The authors report no conflict of interest concerning the mate-
J Neurosurg / Volume 120 / May 2014
rials or methods used in this study or the findings specified in this paper. Author contributions to the study and manuscript preparation include the following. Conception and design: Yokoi. Acquisition of data: Yokoi, Isono, Saitoh, Yoshimura. Analysis and interpretation of data: Yokoi, Isono. Drafting the article: Yokoi, Isono. Critically revising the article: all authors. Reviewed submitted version of manuscript: all authors. Approved the final version of the manuscript on behalf of all authors: Yokoi. Statistical analysis: Yokoi. Administrative/technical/material support: Yokoi. Study supervision: Nozaki. References 1. Alikhani M, Alikhani Z, Raptis M, Graves DT: TNF-alpha in vivo stimulates apoptosis in fibroblasts through caspase-8 activation and modulates the expression of pro-apoptotic genes. J Cell Physiol 201:341–348, 2004 2. Aoki T, Kataoka H, Ishibashi R, Nozaki K, Hashimoto N: Simvastatin suppresses the progression of experimentally induced cerebral aneurysms in rats. Stroke 39:1276–1285, 2008 3. Aoki T, Kataoka H, Morimoto M, Nozaki K, Hashimoto N: Macrophage-derived matrix metalloproteinase-2 and -9 promote the progression of cerebral aneurysms in rats. Stroke 38: 162–169, 2007 4. Aoki T, Kataoka H, Shimamura M, Nakagami H, Wakayama K, Moriwaki T, et al: NF-kappaB is a key mediator of cerebral aneurysm formation. Circulation 116:2830–2840, 2007 5. Aoki T, Nishimura M: The development and the use of experimental animal models to study the underlying mechanisms of CA formation. J Biomed Biotechnol 2011:535921, 2011 6. Bhullar IS, Li YS, Miao H, Zandi E, Kim M, Shyy JY, et al: Fluid shear stress activation of IκB kinase is integrin-dependent. J Biol Chem 273:30544–30549, 1998 7. Bigatel DA, Elmore JR, Carey DJ, Cizmeci-Smith G, Franklin DP, Youkey JR: The matrix metalloproteinase inhibitor BB-94 limits expansion of experimental abdominal aortic aneurysms. J Vasc Surg 29:130–139, 1999 8. Boyle JJ, Weissberg PL, Bennett MR: Tumor necrosis factoralpha promotes macrophage-induced vascular smooth muscle cell apoptosis by direct and autocrine mechanisms. Arterioscler Thromb Vasc Biol 23:1553–1558, 2003 9. Chase AJ, Bond M, Crook MF, Newby AC: Role of nuclear factor-kappa B activation in metalloproteinase-1, -3, and -9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo. Arterioscler Thromb Vasc Biol 22:765– 771, 2002 10. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159, 1987 11. Chyatte D, Bruno G, Desai S, Todor DR: Inflammation and intracranial aneurysms. Neurosurgery 45:1137–1147, 1999 12. Fontanella M, Rainero I, Gallone S, Rubino E, Fenoglio P, Valfrè W, et al: Tumor necrosis factor-alpha gene and cerebral aneurysms. Neurosurgery 60:668–673, 2007 13. Freestone T, Turner RJ, Coady A, Higman DJ, Greenhalgh RM, Powell JT: Inflammation and matrix metalloproteinases in the enlarging abdominal aortic aneurysm. Arterioscler Thromb Vasc Biol 15:1145–1151, 1995 14. Frösen J, Tulamo R, Paetau A, Laaksamo E, Korja M, Laakso A, et al: Saccular intracranial aneurysm: pathology and mechanisms. Acta Neuropathol 123:773–786, 2012 15. Fukuda S, Hashimoto N, Naritomi H, Nagata I, Nozaki K, Kondo S, et al: Prevention of rat cerebral aneurysm formation by inhibition of nitric oxide synthase. Circulation 101:2532– 2538, 2000 16. Handler FP, Blumenthal HT: Inflammatory factor in pathogenesis of cerebrovascular aneurysms. J Am Med Assoc 155: 1479–1483, 1954
1199
T. Yokoi et al. 17. Hasan DM, Mahaney KB, Brown RD Jr, Meissner I, Piepgras DG, Huston J, et al: Aspirin as a promising agent for decreasing incidence of cerebral aneurysm rupture. Stroke 42:3156– 3162, 2011 18. Hashimoto T, Meng H, Young WL: Intracranial aneurysms: links among inflammation, hemodynamics and vascular remodeling. Neurol Res 28:372–380, 2006 19. Jayaraman T, Berenstein V, Li X, Mayer J, Silane M, Shin YS, et al: Tumor necrosis factor alpha is a key modulator of inflammation in cerebral aneurysms. Neurosurgery 57:558–564, 2005 20. Jayaraman T, Paget A, Shin YS, Li X, Mayer J, Chaudhry H, et al: TNF-alpha-mediated inflammation in cerebral aneurysms: a potential link to growth and rupture. Vasc Health Risk Manag 4:805–817, 2008 21. Joussen AM, Poulaki V, Mitsiades N, Kirchhof B, Koizumi K, Döhmen S, et al: Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression. FASEB J 16:438–440, 2002 22. Kim C, Cervós-Navarro J, Kikuchi H, Hashimoto N, Hazama F: Degenerative changes in the internal elastic lamina relating to the development of saccular cerebral aneurysms in rats. Acta Neurochir (Wien) 121:76–81, 1993 23. Koch AE, Kunkel SL, Pearce WH, Shah MR, Parikh D, Evanoff HL, et al: Enhanced production of the chemotactic cytokines interleukin-8 and monocyte chemoattractant protein-1 in human abdominal aortic aneurysms. Am J Pathol 142:1423–1431, 1993 24. Kondo S, Hashimoto N, Kikuchi H, Hazama F, Nagata I, Kataoka H: Apoptosis of medial smooth muscle cells in the development of saccular cerebral aneurysms in rats. Stroke 29: 181–189, 1998 25. Lawrence DM, Singh RS, Franklin DP, Carey DJ, Elmore JR: Rapamycin suppresses experimental aortic aneurysm growth. J Vasc Surg 40:334–338, 2004 26. Manning MW, Cassis LA, Daugherty A: Differential effects of doxycycline, a broad-spectrum matrix metalloproteinase inhibitor, on angiotensin II-induced atherosclerosis and abdominal aortic aneurysms. Arterioscler Thromb Vasc Biol 23:483–488, 2003 27. Moreland LW, Schiff MH, Baumgartner SW, Tindall EA, Fleischmann RM, Bulpitt KJ, et al: Etanercept therapy in rheumatoid arthritis. A randomized, controlled trial. Ann Intern Med 130:478–486, 1999 28. Moriwaki T, Takagi Y, Sadamasa N, Aoki T, Nozaki K,
1200
Hashimoto N: Impaired progression of cerebral aneurysms in interleukin-1β-deficient mice. Stroke 37:900–905, 2006 29. Nagata I, Handa H, Hashimoto N: Experimentally induced cerebral aneurysms in rats: part IV—cerebral angiography. Surg Neurol 12:419–424, 1979 30. Nakashima H, Aoki M, Miyake T, Kawasaki T, Iwai M, Jo N, et al: Inhibition of experimental abdominal aortic aneurysm in the rat by use of decoy oligodeoxynucleotides suppressing activity of nuclear factor κB and ets transcription factors. Circulation 109:132–138, 2004 31. Roh M, Zhang Y, Murakami Y, Thanos A, Lee SC, Vavvas DG, et al: Etanercept, a widely used inhibitor of tumor necrosis factor-α (TNF-α), prevents retinal ganglion cell loss in a rat model of glaucoma. PLoS ONE 7:e40065, 2012 32. Sadamasa N, Nozaki K, Hashimoto N: Disruption of gene for inducible nitric oxide synthase reduces progression of cerebral aneurysms. Stroke 34:2980–2984, 2003 33. Sadamasa N, Nozaki K, Kita-Matsuo H, Saito S, Moriwaki T, Aoki T, et al: Gene expression during the development of experimentally induced cerebral aneurysms. J Vasc Res 45:343– 349, 2008 34. Smith RA, Baglioni C: The active form of tumor necrosis factor is a trimer. J Biol Chem 262:6951–6954, 1987 35. Wullaert A, Heyninck K, Beyaert R: Mechanisms of crosstalk between TNF-induced NF-κB and JNK activation in hepatocytes. Biochem Pharmacol 72:1090–1101, 2006 36. Xie QW, Whisnant R, Nathan C: Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma and bacterial lipopolysaccharide. J Exp Med 177:1779–1784, 1993 37. Young AM, Karri SK, You W, Ogilvy CS: Specific TNF-alpha inhibition in cerebral aneurysm formation and subarachnoid hemorrhage. Curr Drug Saf 7:190–196, 2012
Manuscript submitted April 22, 2013. Accepted January 16, 2014. Please include this information when citing this paper: published online March 14, 2014; DOI: 10.3171/2014.1.JNS13818. Address correspondence to: Toshihiro Yokoi, M.D., Department of Neurosurgery, Shiga University of Medical Science, Seta, Tsukinowa-cho Otsu, Shiga, Japan 520-2192. email: tyokoi@belle. shiga-med.ac.jp.
J Neurosurg / Volume 120 / May 2014
Suppression of cerebral aneurysm formation in rats by a tumor necrosis factor–a inhibitor Laboratory investigation Toshihiro Yokoi, M.D.,1 Takahiro Isono, Ph.D., 2 Makoto Saitoh, M.D.,1 Yayoi Yoshimura, M.D.,1 and Kazuhiko Nozaki, M.D., Ph.D.1 1 Department of Neurosurgery and 2General Research Laboratory, Shiga University of Medical Science, Shiga, Japan
Object. Although cerebral aneurysmal subarachnoid hemorrhage is a devastating disease for humans, effective medical treatments have not yet been established. Recent reports have shown that regression of some inflammatoryrelated mediators has protective effects in experimental cerebral aneurysm models. This study corroborated the effectiveness of tumor necrosis factor–a (TNF-a) inhibitor for experimentally induced cerebral aneurysms in rats. Methods. Five-week-old male rats were prepared for induction of cerebral aneurysms and divided into 3 groups, 2 groups administered different concentrations of a TNF-a inhibitor (etanercept), and 1 control group. One month after aneurysm induction, 7-T MRI was performed. The TNF-a inhibitor groups received subcutaneous injection of 25 mg or 2.5 mg of etanercept, and the control group received subcutaneous injection of normal saline every week. The TNF-a inhibitor administrations were started at 1 month after aneurysm induction to evaluate its suppressive effects on preexisting cerebral aneurysms. Arterial circles of Willis were obtained and evaluated 3 months after aneurysm induction. Results. Rats administered a TNF-a inhibitor experienced significant increases in media thickness and reductions in aneurysmal size compared with the control group. Immunohistochemical staining showed that treatment with a TNF-a inhibitor suppressed matrix metalloproteinase (MMP)–9 and inducible nitric oxide synthase (iNOS) expression through the luminal surface of the endothelial cell layer, the media and the adventitia at the site of aneurysmal formation, and the anterior cerebral artery–olfactory artery bifurcation. Quantitative polymerase chain reaction also showed suppression of MMP-9 and iNOS by TNF-a inhibitor administration. Conclusions. Therapeutic administration of a TNF-a inhibitor significantly reduced the formation of aneurysms in rats. These data also suggest that TNF-a suppression reduced some inflammatory-related mediators that are in the downstream pathway of nuclear factor-kB. (http://thejns.org/doi/abs/10.3171/2014.1.JNS13818)
Key Words • tumor necrosis factor–α inhibitor • cerebral aneurysm • nuclear factor kappa B • rat • vascular disorders
C
erebral aneurysmal subarachnoid hemorrhage is a catastrophic disease for humans, but effective medical treatments have not yet been established. The pathogenesis of cerebral saccular aneurysms has been investigated using several aneurysm models.5,15,28,32,33 Hashimoto and colleagues established an experimentally induced cerebral aneurysm model in rats, and hemodynamic stress has been emphasized for aneurysmal formation. In the early stage after aneurysm induction, disruption of the elastic laminae occurs,22,24 which is followed by infiltra-
Abbreviations used in this paper: ACA = anterior cerebral artery; IKK = inhibitor of kB kinase; IL = interleukin; iNOS = inducible nitric oxide synthase; MMP = matrix metalloproteinase; NF-kB = nuclear factor-kB; PCR = polymerase chain reaction; TNF = tumor necrosis factor.
J Neurosurg / Volume 120 / May 2014
tion of the inflammatory-related mediator to the arterial wall, and proteolytic damage to the arterial wall caused by inflammation-related mediators appears to play a crucial role. Several kinds of mediators have been reported to be decisive causes of the formation of abdominal aortic aneurysms,13,23 and Chyatte et al. demonstrated the expression of immunoglobulin, macrophages, and T-lymphocytes in humans in the walls of unruptured cerebral aneurysms.11 Macrophages can induce programmed cell death through a tumor necrosis factor (TNF)–a dependent pathway.8 Jayaraman et al. have demonstrated TNF-a mRNA and protein in ruptured cerebral aneurysms in humans.19 Tumor necrosis factor–a activation induces apoptosis via activation of caspase-8,1 which leads to the activation of inducible nitric oxide synthase (iNOS). Aoki et al. showed important roles of nuclear factor-kB (NF-kB) in the induc1193
T. Yokoi et al. tion and formation of cerebral aneurysms in rat aneurysmal models.4 Nuclear factor-kB also regulates the transcription of some proinflammatory genes such as iNOS36 and matrix metalloproteinases (MMPs),9 which are of functional importance for the progression of cerebral aneurysms. Recent reports have shown that regression of some inflammatoryrelated molecules have protective effects in experimental cerebral aneurysm models.2–4,11,16,28 One of the main activators of NF-kB is TNF-a, which is one of the main proinflammatory cytokines and plays a fundamental role in initiating and regulating the cascade of events leading to inflammatory reactions.20 The main aim of this study was to elucidate the role of TNF-a in the formation and augmentation of cerebral aneurysms, to seek possible medical therapeutic approaches for the suppression and prevention of aneurysmal formation and subarachnoid hemorrhage.
thickness 1.5 mm, scanning length 40 mm, 32 slices, with no gap. We conducted MRI 3 times on each rat, with the slice offset shifted to the same direction by 0.5° every time. In all 3 groups, 1 of the rats was chosen by random sampling at 1 month after aneurysm induction. The 7-T MR angiography revealed a saccular-type aneurysm at the right anterior cerebral artery (ACA)–olfactory artery bifurcation in all 3 groups (Fig. 1). Administration of TNF-α Inhibitor
To examine the effect of a TNF-a inhibitor on preexisting aneurysms, TNF-a inhibitor administration started 1 month after aneurysm induction. We used etanercept as a TNF-a inhibitor. Etanercept was provided by Takeda Pharmaceutical Co. Ltd. and Pfizer Co., Inc. Animals in
Methods Experimentally Induced Cerebral Aneurysms in Rats
Animal care and experiments complied with Japanese community standards on the care and use of laboratory animals, and all protocols were permitted by the Ethical Committee of the Research Center of Animal Life Science at Shiga University of Medical Science. Cerebral aneurysms were induced using a method previously described.29 While anesthetized with 50 mg/kg of intraperitoneal pentobarbital, the left common carotid artery and posterior branches of the bilateral renal arteries were ligated at the same time with 3-0 nylon thread in 5-week-old male Sprague-Dawley rats (Oriental Bioservice). A total of 36 rats were operated on. All of the aneurysm-induced rats (n = 36) were divided into 3 groups in random order: 1) a high-dose TNF-a inhibitor group (n = 12); 2) a low-dose TNF-a inhibitor group (n = 12); and 3) a vehicle group (control group, n = 12). After aneurysm induction, animals in all groups were fed with a high-salt diet containing 8% sodium chloride (Oriental Bioservicen) for 3 months. At 1 and 3 months after aneurysm induction, systemic blood pressure was measured by the tail-cuff method (Softron) with rats kept in a small container without any anesthesia. Magnetic Resonance Imaging
We conducted 7-T MRI at 1 month after aneurysm induction while the rats were anesthetized using an intraperitoneal injection of 30 mg/kg of pentobarbital. The main purpose of this MRI evaluation was confirmation of aneurysm formation when the etanercept administration was started. We intended to emphasize that the effectiveness of this drug was reduction of or cure from the preexisting aneurysm, not prevention of aneurysm formation. The MRI was performed on a Unity INOVA 7T MR machine (Varian) equipped with a Magnex gradient system capable of producing pulse gradients of 400 mT/m in each of the 3 orthogonal axes, and with the JMTB-7.0/400/SS conducting magnet (Jastec; bore size 400 mm, central field magnetic force 7 T). We used a 38-mm volume coil for the brain scan procedure. The MRI parameters were as follows: TR 40 msec, TE 3.24 msec, flip angle 45°,
1194
Fig. 1. Magnetic resonance angiograms obtained 1 month after aneurysm induction in each of the 3 groups. Arrowheads indicate saccular aneurysms at the bifurcation of the ACA and olfactory artery. A: Control group. B: Low-dose etanercept group. C: High-dose etanercept group.
J Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression the high-dose TNF-a inhibitor group received subcutaneous injection of 25 mg of etanercept with 0.5 ml of normal saline every week for 2 months. Those in the low-dose TNF-a inhibitor group received 2.5 mg of etanercept with 0.5 ml of normal saline in the same fashion. The control group received subcutaneous injection of 0.5 ml of normal saline every week for 2 months. The doses were selected based on previous studies that demonstrated the effectiveness of etanercept in other disease models.21,27,31 Evaluation of Induced Cerebral Aneurysms in Rats
Arterial circles of Willis were evaluated 3 months after aneurysm induction. After systemic blood pressure was measured by the tail-cuff method, rats were deeply anesthetized and perfused transcardially with 4% paraformaldehyde by perfusion pump (Atto) at 100–150 ml/m. We conducted this immobilization and euthanasia of 7 rats in each group by random sampling. The ACA and olfactory artery bifurcation was stripped and embedded in optimal cutting temperature compound (Sakura). Fivemm sections were cut in the sagittal plane, mounted on silane-coated slides, and observed under a light microscope after H & E and Masson trichrome staining. To evaluate the pathological changes occurring in aneurysmal walls, we analyzed the thinning of the medial smooth-muscle cell layer and aneurysmal size. The thickness of media was evaluated by the ratio of minimal thickness in aneurysmal walls to thickness in surrounding normal arterial walls. Aneurysmal size was calculated as the mean of the maximal longitudinal diameter and the maximal transverse diameter.
Quantitative Polymerase Chain Reaction
For the analysis of gene expression of cerebral aneurysms in rats, total RNA was extracted from the frozen arterial circles of Willis by the acid guanidium thiocyanate–chloroform method as previously reported.10 Realtime polymerase chain reaction (PCR) was performed with a LightCycler 480 SYBR MasterIMix and LightCycler 480 System II (Roche Diagnostics) by 45 cycles of denaturation (95°C, 15 sec), annealing (60°C, 15 sec), and extension (72°C, 15 sec). Gene expression was normalized with the β-actin gene. The rat-specific primer sequences are listed in Table 1. We conducted this quantitative PCR of 3 rats in each group by random sampling. All quantification analysis was performed in triplicate.
Immunohistochemical Analysis
The ACA and olfactory artery bifurcation was stripped and embedded in optimal cutting temperature compound. Five-mm sections were cut and mounted on silane-coated slides in the sagittal plane. After blocking with 5% donkey serum (Jackson Immune Research), primary antibodies were incubated for 1 hour at room temperature followed by incubation peroxidase-labeled secondary antibodies (simple stain MAX-PO; Nichirei) for 1 hour at room temperature. The primary antibodies and titer of antibodies used in the present study were goat polyclonal MMP-9 antibody (Santa Cruz Biotechnology, Inc.) and rabbit polyclonal anti–iNOS antibody (Santa Cruz Biotechnology, Inc.). We conducted this immunohistochemical analysis of 2 rats in each group by random sampling.
Statistical Analysis
Data (means ± SDs) were analyzed using the MannWhitney U-test for 2-group comparisons. Differences were considered statistically significant at p < 0.05.
Results Effect of Etanercept on Aneurysmal Formation
In each group, systolic blood pressure was significantly elevated at 3 months after aneurysm induction as compared with the systolic blood pressure at 1 month after aneurysm induction. There was no significant difference at 1 month or 3 months after aneurysm induction between the control group (74.8 ± 2.4 mm Hg after 1 month, 118.8 ± 2.8 mm Hg after 3 months), low-dose etanercept group (75.8 ± 2.1 mm Hg after 1 month, 115.7 ± 21.2 mm Hg after 3 months) and high-dose etanercept group (76.1 ± 1.9 mm Hg after 1 month, 121.1 ± 1.9 mm Hg after 3 months; Fig. 2A and B). The maximum size of the aneurysm was significantly smaller in the low-dose and high-dose etanercept groups than in the control group, and the maximum size of the aneurysm in the high-dose etanercept group was significantly smaller than in the low-dose etanercept group (Fig. 2C). The thickness of media was significantly larger in the low-dose and high-dose etanercept groups than in the control group (Fig. 2D). Aneurysm formation was markedly suppressed in the etanercept groups, and the internal elastic membrane was also thicker in the etanercept-treated groups as compared with the control group (Fig. 3). We
TABLE 1: Oligonucleotides used for quantitative real-time PCR Gene
Forward Primer
Reverse Primer
IKKα IKKβ NF-κB IL-1β iNOS MMP-9 β-actin
GCTAAGTACCAAAAACAGAGAACG TCAAAACCAGCATCCAGATTGAC CTGCCTGCTCCTGGAGGGTG CCCTGCAGCTGGAGAGTGTG AGGTGCTATTCCCAGCCCAAC TTCAAGGACGGTCGGTATTGG AAGTCCCTCACCCTCCCAAAG
CCATTGCTAGAAGAGGCACATC GCCATCATCCGTTCTACCAGG GCTCATAGAGAGGCTCAAAGTTC GGGTTCCATGGTGAAGTCAAC CAGGGATTCTGGAACATTCTGTG CTTCTTGGACTGCGGATCCTC AAGCAATGCTGTCACCTTCCC
J Neurosurg / Volume 120 / May 2014
1195
T. Yokoi et al.
Fig. 2. Bar graphs showing the effects of etanercept on the progression of cerebral aneurysms. A and B: Graphs showing systolic blood pressure before etanercept administration (A) and at 2 months after etanercept administration (B). There were no significant differences between the 3 groups (control, 0 mg; etanercept, 2.5 and 25 mg) at these two time points. C: Graph of aneurysmal sizes in the control group and the etanercept groups. The maximum size is the longest diameter of the aneurysm. The mean value is the average of the longest diameter and the rectangular diameter of the aneurysm. D: Relative median thickness of aneurysmal walls compared with that of surrounding normal arterial walls in the control and etanercept-treated groups. Data were analyzed using the Mann-Whitney U-test. * p < 0.05, ** p < 0.01.
created these definitions to measure each length objectively. In this study, the evaluators were not blinded; however, the methodology of each evaluation was standardized. Immunohistochemical Staining
The discontinuity of the internal elastic lamina at the ACA–olfactory artery bifurcation occurred in all 3 groups, but apparent outward bulging of the arterial wall was distinct in the control group. There was some elastin, which formed from tropoelastin. There was some inflammation-related reaction just outside of the internal elastic laminae. The cells in the photomicrographs were infiltrated monocytes from the internal vessels, which differentiate into macrophages and dendritic cells. According to the immunohistochemical analysis, iNOS and MMP9 were expressed mainly in the area with fragmentation or disappearance of the internal elastic lamina (Fig. 4). This tendency was obvious in the control group and lowdose TNF-a inhibitor group. The expressions of iNOS and MMP-9 proteins in the media were reduced at the aneurysm formation site in the etanercept groups, but we could not find a significant reduction in the expression of these molecules in the adventitia due to edge artifact.
Quantitative PCR Analysis
We conducted a significance test between rats in the
1196
control group and those in the high-dose etanercept group. In the etanercept group, mRNA expression levels of MMP9, iNOS, and interleukin (IL)-1b were significantly lower than those in the control group at 3 months after aneurysm induction (Fig. 5A). In the etanercept group, mRNA expression levels of NF-kB, phospho-IKKa, and phosphoIKKb were lower than those in the control group at 3 months after aneurysm induction (Fig. 5B).
Discussion
Recent studies revealed the involvement of inflammation in cerebral aneurysm formation.14,17 Arterial walls are continuously loaded by circulating blood flow, which generates hemodynamic force. Because hemodynamic force with subsequent mechanical injury gives rise to infiltration of macrophages into the arterial wall, iNOS is constitutively expressed mainly in smooth muscle cells. Histopathological studies on clipped human aneurysms have identified macrophages and lymphocytes in the aneurysmal wall.11,14 Chyatte et al.11 revealed that the number of macrophages accumulated in the luminal surface of the endothelium and in the adventitia increase with progression of an aneurysm. Hashimoto et al. investigated the total and phosphorylated levels of different signaling proteins or cytokines produced by inflammatory cells known to participate in vascular remodeling or inflammation of cerebral aneurysms such as J Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression
Fig. 3. Photomicrographs of H & E (A–C) and Masson trichrome staining (D–F) of the ACA–olfactory artery bifurcation in a rat 3 months after aneurysm induction. * Outer lumen of the vessels. ** Internal lumen of the vessels. Bar = 50 mm.
MMP.18 Investigations in several animal models of aortic aneurysms have demonstrated that increased macrophage expression of MMP-9 plays a critical role in the development and progression of abdominal aortic aneurysms.7,26 In addition to the mechanisms above, the functional role of NF-kB that activates MMP-9 expression has been demonstrated in a variety of animal models of abdominal aortic aneurysms.25,30 A recent paper indicated that activation of NF-kB also appeared at the site of cerebral aneurysm formation.4 Cerebral aneurysms tend to be formed at the arterial bifurcation by hemodynamic shear stress, and fluid shear stress has been shown to promote
the translocation into the nucleus of NF-kB in cultured endothelial cells by activating IkB kinase.6 One of the main activators of NF-kB is TNF-a, which is one of the main proinflammatory cytokines and plays a key role in initiating and regulating the cascade of events leading to inflammatory reactions.20 Tumor necrosis factor–a is encoded on chromosome 6 and exists in its biologically active form as a homotrimer of a 17-kD subunit.34 Tumor necrosis factor–a can locate upstream of the NK-kB pathway, and TNF-a–induced NF-kB activation results from activation of the inhibitor of the kB kinase (IKK) complex, which phosphorylates
Fig. 4. Immunohistochemical staining of iNOS (A–C) and MMP-9 (D–F) 3 months after aneurysm induction. Arrowheads indicate iNOS-positive cells. Arrows indicate MMP-9–positive cells. * Outer lumen of the vessels. ** Internal lumen of the vessels. Bar = 50 mm.
J Neurosurg / Volume 120 / May 2014
1197
T. Yokoi et al.
Fig. 5. Bar graphs showing quantitative PCR-measured mRNA expression. A: Expression of MMP-9, iNOS, and IL-b of the control group (Cont.) and high-dose etanercept-treated group (TNF; n = 3 per group). Error bars represent standard errors from 3 independent experiments. B: Expression of NF-kB, phospho-IKKa, and phospho-IKKb of control group (Cont.) and high-dose etanercept-treated group (TNF; n = 3 per group). Error bars represent standard errors from 3 independent experiments.
the inhibitor of kB family members that are normally bound to NF-kB and thereby retains it in the cytoplasm.35 Tumor necrosis factor–a has a broad range of biological activities associated with inflammatory-related disorders. The significant increase in mRNA expression of TNF-a was also observed in human cerebral aneurysms.19 The increased expression of TNF-a in cerebral aneurysms may lead to activation of its downstream signaling components to initiate vessel weakening and remodeling via inflammation and apoptosis.19 Thus, activation of the 1198
proinflammatory cytokine TNF-a may contribute to the development of abnormal vasculature during aneurysmal formation. We are planning to determine the relationship between an immune reaction and TNF-a upregulation by using immunohistochemical double staining of CD-68 and the secondary antibody of anti-rat TNF-a. After we discontinued the administration of the TNF-α inhibitor in the aneurysmal model, we did not observe the arterial circles of Willis. We have no data about the change in aneurysms after we ceased adminJ Neurosurg / Volume 120 / May 2014
A TNF-a inhibitor in cerebral aneurysm suppression istration of the TNF-a inhibitor. We are currently working on observing the changes in aneurysms after ceasing the administration of TNF-α inhibitor in rats. We assume that hemodynamic stress will cause aneurysmal formation in these animals as well, using sodium loading and lasting renal hypertension. To reduce the matured aneurysms would require suppression of inflammatory cells infiltrated into the aneurysmal wall. In this paper, we examined the distribution of TNFa inhibitor in cerebral aneurysm development using an experimental model in rats. We showed that aneurysmal formation was significantly reduced by 2-month treatment with etanercept 1 month after aneurysm induction in rats, which suggests that TNF-a may be involved in the enlargement of cerebral aneurysms. These data suggest that inhibition of TNF-a and its downstream signaling components contributes to the pathological mechanisms of cerebral aneurysms via the suppressive effect for proinflammatory status. The suppression of not only NF-kB, phospho-IKKa, and phospho-IKKb mRNAs but also iNOS and MMP-9 mRNA (one of the downstream molecules of the NF-kB pathway) by a TNF-a inhibitor might indicate that the inhibition of aneurysm formation by the TNF-a inhibitor occurs through an NF-kB pathway. One of the major target molecules of TNF-a is NF-kB, and its activation leads to macrophage recruitment into the aneurysmal walls. Macrophages secrete MMP-9, which causes extracellular matrix degradation in aneurysmal walls, and release of nitric oxide via iNOS upregulation. A genetic analysis also revealed that a TNF-a gene or linked locus significantly influences the risk of aneurysmal subarachnoid hemorhhage.12 There is considerable theoretical evidence for the potential of TNF-a inhibitors to affect cerebral aneurysms.37 To our knowledge, this is the first study that demonstrated that therapeutic administration of a TNF-a inhibitor significantly reduces aneurysm formation in mammals, possibly through an NF-kB–related manner. The results of this study suggest that TNF-a inhibitors may have therapeutic potential in the prevention of cerebral aneurysm formation. Additional investigations in higher mammals will be needed to determine the possible clinical application of TNF-a inhibitors to human cerebral aneurysms. We are currently studying the effectiveness and side effects of these inhibitors using mammal models.
Conclusions
Therapeutic administration of a TNF-a inhibitor significantly reduced aneurysm formation in rats. These data suggest that the inhibition of TNF-a might be a novel tool in the treatment of cerebral aneurysms by reducing some inflammatory-related mediators. Acknowledgment We thank Mrs. Akiyo Ushio (Central Research Laboratory, Shiga University of Medical Science) for assistance with quantitative real-time PCR. Disclosure The authors report no conflict of interest concerning the mate-
J Neurosurg / Volume 120 / May 2014
rials or methods used in this study or the findings specified in this paper. Author contributions to the study and manuscript preparation include the following. Conception and design: Yokoi. Acquisition of data: Yokoi, Isono, Saitoh, Yoshimura. Analysis and interpretation of data: Yokoi, Isono. Drafting the article: Yokoi, Isono. Critically revising the article: all authors. Reviewed submitted version of manuscript: all authors. Approved the final version of the manuscript on behalf of all authors: Yokoi. Statistical analysis: Yokoi. Administrative/technical/material support: Yokoi. Study supervision: Nozaki. References 1. Alikhani M, Alikhani Z, Raptis M, Graves DT: TNF-alpha in vivo stimulates apoptosis in fibroblasts through caspase-8 activation and modulates the expression of pro-apoptotic genes. J Cell Physiol 201:341–348, 2004 2. Aoki T, Kataoka H, Ishibashi R, Nozaki K, Hashimoto N: Simvastatin suppresses the progression of experimentally induced cerebral aneurysms in rats. Stroke 39:1276–1285, 2008 3. Aoki T, Kataoka H, Morimoto M, Nozaki K, Hashimoto N: Macrophage-derived matrix metalloproteinase-2 and -9 promote the progression of cerebral aneurysms in rats. Stroke 38: 162–169, 2007 4. Aoki T, Kataoka H, Shimamura M, Nakagami H, Wakayama K, Moriwaki T, et al: NF-kappaB is a key mediator of cerebral aneurysm formation. Circulation 116:2830–2840, 2007 5. Aoki T, Nishimura M: The development and the use of experimental animal models to study the underlying mechanisms of CA formation. J Biomed Biotechnol 2011:535921, 2011 6. Bhullar IS, Li YS, Miao H, Zandi E, Kim M, Shyy JY, et al: Fluid shear stress activation of IκB kinase is integrin-dependent. J Biol Chem 273:30544–30549, 1998 7. Bigatel DA, Elmore JR, Carey DJ, Cizmeci-Smith G, Franklin DP, Youkey JR: The matrix metalloproteinase inhibitor BB-94 limits expansion of experimental abdominal aortic aneurysms. J Vasc Surg 29:130–139, 1999 8. Boyle JJ, Weissberg PL, Bennett MR: Tumor necrosis factoralpha promotes macrophage-induced vascular smooth muscle cell apoptosis by direct and autocrine mechanisms. Arterioscler Thromb Vasc Biol 23:1553–1558, 2003 9. Chase AJ, Bond M, Crook MF, Newby AC: Role of nuclear factor-kappa B activation in metalloproteinase-1, -3, and -9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo. Arterioscler Thromb Vasc Biol 22:765– 771, 2002 10. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159, 1987 11. Chyatte D, Bruno G, Desai S, Todor DR: Inflammation and intracranial aneurysms. Neurosurgery 45:1137–1147, 1999 12. Fontanella M, Rainero I, Gallone S, Rubino E, Fenoglio P, Valfrè W, et al: Tumor necrosis factor-alpha gene and cerebral aneurysms. Neurosurgery 60:668–673, 2007 13. Freestone T, Turner RJ, Coady A, Higman DJ, Greenhalgh RM, Powell JT: Inflammation and matrix metalloproteinases in the enlarging abdominal aortic aneurysm. Arterioscler Thromb Vasc Biol 15:1145–1151, 1995 14. Frösen J, Tulamo R, Paetau A, Laaksamo E, Korja M, Laakso A, et al: Saccular intracranial aneurysm: pathology and mechanisms. Acta Neuropathol 123:773–786, 2012 15. Fukuda S, Hashimoto N, Naritomi H, Nagata I, Nozaki K, Kondo S, et al: Prevention of rat cerebral aneurysm formation by inhibition of nitric oxide synthase. Circulation 101:2532– 2538, 2000 16. Handler FP, Blumenthal HT: Inflammatory factor in pathogenesis of cerebrovascular aneurysms. J Am Med Assoc 155: 1479–1483, 1954
1199
T. Yokoi et al. 17. Hasan DM, Mahaney KB, Brown RD Jr, Meissner I, Piepgras DG, Huston J, et al: Aspirin as a promising agent for decreasing incidence of cerebral aneurysm rupture. Stroke 42:3156– 3162, 2011 18. Hashimoto T, Meng H, Young WL: Intracranial aneurysms: links among inflammation, hemodynamics and vascular remodeling. Neurol Res 28:372–380, 2006 19. Jayaraman T, Berenstein V, Li X, Mayer J, Silane M, Shin YS, et al: Tumor necrosis factor alpha is a key modulator of inflammation in cerebral aneurysms. Neurosurgery 57:558–564, 2005 20. Jayaraman T, Paget A, Shin YS, Li X, Mayer J, Chaudhry H, et al: TNF-alpha-mediated inflammation in cerebral aneurysms: a potential link to growth and rupture. Vasc Health Risk Manag 4:805–817, 2008 21. Joussen AM, Poulaki V, Mitsiades N, Kirchhof B, Koizumi K, Döhmen S, et al: Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression. FASEB J 16:438–440, 2002 22. Kim C, Cervós-Navarro J, Kikuchi H, Hashimoto N, Hazama F: Degenerative changes in the internal elastic lamina relating to the development of saccular cerebral aneurysms in rats. Acta Neurochir (Wien) 121:76–81, 1993 23. Koch AE, Kunkel SL, Pearce WH, Shah MR, Parikh D, Evanoff HL, et al: Enhanced production of the chemotactic cytokines interleukin-8 and monocyte chemoattractant protein-1 in human abdominal aortic aneurysms. Am J Pathol 142:1423–1431, 1993 24. Kondo S, Hashimoto N, Kikuchi H, Hazama F, Nagata I, Kataoka H: Apoptosis of medial smooth muscle cells in the development of saccular cerebral aneurysms in rats. Stroke 29: 181–189, 1998 25. Lawrence DM, Singh RS, Franklin DP, Carey DJ, Elmore JR: Rapamycin suppresses experimental aortic aneurysm growth. J Vasc Surg 40:334–338, 2004 26. Manning MW, Cassis LA, Daugherty A: Differential effects of doxycycline, a broad-spectrum matrix metalloproteinase inhibitor, on angiotensin II-induced atherosclerosis and abdominal aortic aneurysms. Arterioscler Thromb Vasc Biol 23:483–488, 2003 27. Moreland LW, Schiff MH, Baumgartner SW, Tindall EA, Fleischmann RM, Bulpitt KJ, et al: Etanercept therapy in rheumatoid arthritis. A randomized, controlled trial. Ann Intern Med 130:478–486, 1999 28. Moriwaki T, Takagi Y, Sadamasa N, Aoki T, Nozaki K,
1200
Hashimoto N: Impaired progression of cerebral aneurysms in interleukin-1β-deficient mice. Stroke 37:900–905, 2006 29. Nagata I, Handa H, Hashimoto N: Experimentally induced cerebral aneurysms in rats: part IV—cerebral angiography. Surg Neurol 12:419–424, 1979 30. Nakashima H, Aoki M, Miyake T, Kawasaki T, Iwai M, Jo N, et al: Inhibition of experimental abdominal aortic aneurysm in the rat by use of decoy oligodeoxynucleotides suppressing activity of nuclear factor κB and ets transcription factors. Circulation 109:132–138, 2004 31. Roh M, Zhang Y, Murakami Y, Thanos A, Lee SC, Vavvas DG, et al: Etanercept, a widely used inhibitor of tumor necrosis factor-α (TNF-α), prevents retinal ganglion cell loss in a rat model of glaucoma. PLoS ONE 7:e40065, 2012 32. Sadamasa N, Nozaki K, Hashimoto N: Disruption of gene for inducible nitric oxide synthase reduces progression of cerebral aneurysms. Stroke 34:2980–2984, 2003 33. Sadamasa N, Nozaki K, Kita-Matsuo H, Saito S, Moriwaki T, Aoki T, et al: Gene expression during the development of experimentally induced cerebral aneurysms. J Vasc Res 45:343– 349, 2008 34. Smith RA, Baglioni C: The active form of tumor necrosis factor is a trimer. J Biol Chem 262:6951–6954, 1987 35. Wullaert A, Heyninck K, Beyaert R: Mechanisms of crosstalk between TNF-induced NF-κB and JNK activation in hepatocytes. Biochem Pharmacol 72:1090–1101, 2006 36. Xie QW, Whisnant R, Nathan C: Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma and bacterial lipopolysaccharide. J Exp Med 177:1779–1784, 1993 37. Young AM, Karri SK, You W, Ogilvy CS: Specific TNF-alpha inhibition in cerebral aneurysm formation and subarachnoid hemorrhage. Curr Drug Saf 7:190–196, 2012
Manuscript submitted April 22, 2013. Accepted January 16, 2014. Please include this information when citing this paper: published online March 14, 2014; DOI: 10.3171/2014.1.JNS13818. Address correspondence to: Toshihiro Yokoi, M.D., Department of Neurosurgery, Shiga University of Medical Science, Seta, Tsukinowa-cho Otsu, Shiga, Japan 520-2192. email: tyokoi@belle. shiga-med.ac.jp.
J Neurosurg / Volume 120 / May 2014
