Veterinary Microbiology 176 (2015) 328–336

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Superoxide dismutase of Streptococcus suis serotype 2 plays a role in anti-autophagic response by scavenging reactive oxygen species in infected macrophages Lihua Fang a, Hongxia Shen a, Yulong Tang b, Weihuan Fang a,* a Institute of Preventive Veterinary Medicine & Zhejiang Provincial Key Laboratory of Preventive Veterinary Medicine, Zhejiang University, Hangzhou, Zhejiang 310058, China b Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, Hunan 410125, China

A R T I C L E I N F O

A B S T R A C T

Article history: Received 29 October 2014 Received in revised form 4 February 2015 Accepted 5 February 2015

Streptococcus suis serotype 2 (SS2) causes septic shock and meningitis. However, its pathogenesis is still not well-understood. We have recently shown that superoxide dismutase sodA of SS2 is a virulence factor probably by increasing resistance to oxidative stresses. Reactive oxygen species (ROS) are products of the respiratory burst of phagocytic cells and have been shown to activate autophagy. We wanted to know if and how SS2 explores its sodA to interfere with cell autophagic responses. A sodA deletion mutant (Dsod) was compared with its parent and complemented strain in autophagic response in the murine macrophage cell line RAW264.7. We found that the Dsod mutant induced significant autophagic responses in infected cells, shown as increased LC3 lipidation (LC3II) and EGFP-LC3 punctae, than those infected by its parent or complemented strain at 1 or 2 h post-infection. Co-localization of the autophagosomal EGFP-LC3 vesicles with lysosomes was seen in cells infected with Dsod mutant and its parent strain, indicating that SS2 infection induced complete autophagic responses. Reduced autophagic responses of cells infected with the wild-type strain might be related to decreased ROS by the scavenging effect of its sodA, as shown by increased superoxide anion or ROS level in cells infected with the Dsod mutant and in the cell free xanthine oxidase–hypoxanthine ROSgenerating system, as compared with its parent or complemented strain. Taken together, SS2 makes use of its sodA for survival not only by scavenging ROS but also by alleviating the host autophagic responses due to ROS stimulation. ß 2015 Elsevier B.V. All rights reserved.

Keywords: Streptococcus suis type 2 Superoxide dismutase Autophagy Reactive oxygen species

1. Introduction Streptococcus suis serotype 2 (SS2) is the causative agent of several forms of illness of pigs, such as arthritis, endocarditis, meningitis and septicemia. It is also recognized as a zoonotic agent causing human meningitis

* Corresponding author. Tel.: +86 571 88982242; fax: +86 571 88982242. E-mail address: [email protected] (W. Fang). http://dx.doi.org/10.1016/j.vetmic.2015.02.006 0378-1135/ß 2015 Elsevier B.V. All rights reserved.

(Han et al., 2001; Tang et al., 2011) and severe toxic shock syndrome. Virulence factors of SS2 so far defined include the antiphagocytic capsular polysaccharide, suilysin, cell wall-associated and extracellular proteins, fibronectin-binding proteins, serum opacity factor, etc. (Feng et al., 2014). However, its pathogenesis is still poorly understood. Once in the blood stream, SS2 faces phagocytosis by neutrophils and macrophages, the first line of host defense (Wu et al., 2014). Phagocytosis-associated respiratory

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

burst would generate antimicrobial reactive oxygen species (ROS), such as superoxide (O2), hydrogen peroxide (H2O2), and hydroxyl radical OH3 (Ambrozova et al., 2010). The superoxide anion O2 is known to be the major ROS that regulates autophagy, another cellular process related to microbial infection (Scherz-Shouval and Elazar, 2011). During bacterial infection, autophagy potentially captures bacteria that have escaped from phagosomes into the cytoplasm, thereby delivering the bacteria into autophagolysosomes where they are destroyed (Campoy and Colombo, 2009). Most studies of bacterial autophagy used intracellular bacteria. Only intracellular bacteria or their products are processed by autophagy (Campoy and Colombo, 2009; Tang et al., 2014). Some pathogens, once inside the autophagosomes, could modify this compartment to establish an environment necessary for its survival (Mostowy, 2013). On the other hand, some bacterial species encode antioxidant enzymes such as superoxide dismutase and/or catalase to cope with ROS from the host for their survival (Iiyama et al., 2007). We have recently demonstrated that the superoxide dismutase (sodA) of SS2 is functional in anti-oxidative stresses by phagocytes (Tang et al., 2012b). However, it remains unknown if autophagy is part of SS2 pathogenesis, and if sodA is explored as an anti-autophagic mechanism by reducing the superoxide anion. Here, we reveal that infection with the Dsod mutant triggered more pronounced autophagic response than its parent or complemented strain during the first two hours of infection, suggesting that sodA of SS2 was functional as an anti-autophagic factor. Since there was more intracellular O2 in macrophages infected with Dsod mutant than the wild-type strain and purified sodA of SS2 could scavenge ROS produced in vitro by the hypoxanthine–xanthine system, we conclude that scavenging superoxide anions by sodA contributed to the antiautophagic response of S. suis type 2. 2. Materials and methods 2.1. Bacterial strains and plasmids S. suis type 2 strain ZJ081101 was a clinical strain from the lung of a diseased pig. Unless otherwise indicated, SS2 strains were grown in Brain Heart Infusion (BHI, Oxoid, UK) at 37 8C and E. coli strains, in Luria-Bertani (LB) broth or LB agar at 37 8C. The sodA deletion mutant (SS2-Dsod) and complemented strain (SS2-cDsod) carrying the expression plasmid pSET2s::sodA were constructed in our laboratory (Tang et al., 2012). Antibiotics (all from Sigma) were added, where necessary, to the culture media at the following concentrations: chloramphenicol (Cm) at 4 mg/ml for SS2 Dsod mutant and complemented strain. E. coli strains DH5a and BL21 were used for general manipulation of plasmids and prokaryotic expression of SS2 sodA. The recombinant eukaryotic expression vectors pcDNA-egfp and pcDNA-egfp-LC3B were constructed earlier in our laboratory (Zhu et al., 2012). 2.2. Expression and purification of recombinant SS2-sodA The ORF of sodA was amplified from the genome DNA of SS2 strain ZJ081101 by PCR with the primer pairs:

329

sod-EcoRI: CCGGAATTCATGACAAT TATTTTACCAGACCTTCCA and sod-SalI: CGCGTCGACTTTAGCTGCTTTAT AAAGTTCGTTAACC. The fragment was cloned into pET30a (Invitrogen) using the EcoRI and SalI sites. The recombinant plasmid pET-sodA was transformed into E. coli BL21 (DE3). Expression of recombinant protein (rSS2-sodA) was induced by adding isopropyl-b-Dthiogalactopyranoside (IPTG, 1 mM/L) to the log phase culture at 37 8C for 4 h. The his-tagged rSS2-sodA was purified using HisTrap columns (GE Healthcare) according to the manufacturer instruction and concentrated by membrane ultrafiltration (Millipore) and stored at 80 8C till use. 2.3. Cells culture and bacterial infection Infection of RAW264.7 macrophages cells or cells stably expressing EGFP-LC3B (Zhu et al., 2012) with SS2 strains followed the procedures according to an earlier paper (Cybulski et al., 2009). Briefly, the cells were grown in the 1640 medium containing 10% fetal calf serum (FCS, Gibco) in tissue culture plates at 37 8C and 5% CO2. The bacterial strains (wild-type, Dsod mutant or complemented strain) were grown to logarithmic phase in BHI for 6 h at 37 8C, harvested by centrifugation, washed once and resuspended in sterile 10 mM PBS, pH 7.2. The confluent cell monolayers were infected at MOI (multiplicity of infection) of about 100:1 for 1 and/or 2 h (or 3 h in the initial experiments) at 37 8C and 5% CO2, and washed twice with PBS before further analysis as described below. For confocal microscopic detection of autophagosome formation, the macrophage cells stably expressing EGFP-LC3B were cultured in a petri dish containing a coverslip (10 mm in diameter) and confluent monolayers were infected with wild-type, Dsod mutant or complemented strain (about 100:1 MOI). The cells mock-infected and rapamycin (0.5 mM, Millipore) pretreated for 8 h were used as negative and positive controls. For analysis of co-localization between GFP-LC3 punctae and lysosomes, infection of EGFP-LC3B-expressing macrophages with the wild-type strain or its Dsod mutant was the same as above. Positive and negative controls were included by treating the uninfected cells with Rapamycin and 3-methyladenine (3-MA) (both from Sigma). 3-MA is able to block the fusion of autophagosomes and lysosomes (Petiot et al., 2000). Lysotracker (Invitrogen) was used to label the lysosomes for confocal microscopy. 2.4. SDS-PAGE and immunoblotting The infected cells after washing were lysed for 10 min in ice-cold lysis buffer (50 mM Tris–HCl pH 8.0, 140 mM NaCl, 1.5 mM MgCl2, 0.5% NP-40) with complete protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany). Cell debris was pelleted by centrifugation and clear supernatants transferred to new tubes. Protein concentration was measured by BCA protein assay kit (MultiSciences Hangzhou, China) and the protein samples were either used directly for SDS-PAGE or stored at 80 8C till use. Protein samples were mixed with 5  SDS-PAGE loading buffer and boiled for 5 min. Equal amounts of

330

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

proteins were subjected to 15% SDS-PAGE gel and then electrotransferred onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked for 2 h in Tris-buffered saline (25 mM Tris at pH 7.5, 182,150 mM NaCl, and 0.05% Tween 20) containing 5% nonfat milk powder, and then incubated for 1 h with the primary antibodies: rabbit anti-LC3B polyclonal IgG (Sigma–Aldrich) or mouse anti-actin monoclonal IgG (MultiSciences) diluted 1:1000 with the antibody diluent (Beyotime). Blots were washed and then incubated for another hour with goat anti-rabbit or anti-mouse HRPlabeled antibodies (1:5000 dilution) (KPL, Gaithersburg, MD, USA). The blots were revealed using the ECL Plus detection system (Thermo, Marina, CA, USA). Images were captured directly by the Gel 3100 Chemiluminescent and Fluorescent imaging system (Sagecreation, Beijing, China). Band density was quantified with the Quantity One software (Bio-Rad, Hercules, CA, USA) and normalized to b-actin signal (expressed as the ratio of LC3-II to b-actin). 2.5. Confocal microscopy Cells treated or infected as afore-mentioned were washed with PBS, fixed and permeabilized with 80% cold acetone in PBS at 20 8C for 20 min, and washed again with PBS. Cells were then counter-stained with 40 ,6-diamidino2-phenylindole (DAPI) nucleic acid stain (Invitrogen). Fluorescence of EGFP-LC3 was observed under a confocal microscope (Leica TCS SP5, Munich, Germany) at 10  60 magnification with the numerical aperture of 1.45 and oil immersion lens. The average number of EGFPLC3 punctae per cell from at least 60 cells per sample was counted (Mizushima et al., 2010). For staining of acidic compartments, 50 nM LysoTracker Red DND-99 (Invitrogen) was added to the medium. The medium was removed after 15 min of incubation. After three times of washing with PBS, the cells were immediately observed for colocalization of autophagosomal EGFP-LC3 punctae with lysosomes under the confocal microscope.

2.7. Flow cytometric analysis of superoxide anions and H2O2 in cells infected with S. suis type 2 strains Generation of reactive oxygen species was determined by flow cytometry after staining of the infected cells with dihydroethidium (DHE) or 5-(and-6)-chloromethyl20,70-dichlorodihydrofluorescein diacetate acetylester (CM-DCFDA) (Guthrie and Welch, 2006). DHE is oxidized to red fluorescent ethidium by O2, and CM-DCFDA to green fluorescent dichlorofluorescein by H2O2. Briefly, the cells were centrifuged and the pellet was resuspended in 0.8 ml PBS in Eppendorf tubes. DHE (final concentration 3.2 mM) or CM-DCFDA (final concentration 5 mM) was added into the cell suspension and then gently mixed. The mixtures were incubated in dark at 37 8C for 15 min. The cell suspensions were then transferred into 5-ml Falcon FACS tubes and analyzed within 10 min on FACS Caliber flow cytometer (Becton Dickinson, San Jose, CA, USA). 2.8. Chemiluminescence assay Luminol-enhanced chemiluminescence was used to measure O2 produced in the xanthine oxidase–hypoxanthine system (Archambaud et al., 2006). The chemiluminescence response was measured using microtitre plate luminometer (SpectraMax M5 Multi-Mode Microplate Reader, Molecular Devices, USA) (Radi et al., 1990). Added into each well was a volume of 185 ml of the premix of luminol (1 mM), hypoxanthine (500uM, Sigma) in KRG buffer (pH 7.4) and 10 ml of the activator (bacterial suspension at OD = 0.3), or different concentrations of commercial superoxide dismutase (SOD, Sigma) or SS2 sodA expressed in E. coli. Chemiluminescence was measured immediately after adding 5 ml of xanthine oxidase (0.2 units/ml, Sigma). 2.9. Statistical analysis All experiments were performed in triplicate and repeated at least three times. Data are presented as mean  SD from three independent experiments. Group means were compared by one-way ANOVA.

2.6. Macrophage phagocytosis and intracellular bacterial survival assay 3. Results The confluent macrophages cells in 12-well plates were pretreated for 2 h with 5 mM/L of 3-methyladenine and then infected with wild-type, Dsod mutant or complemented strains (about 1:100 MOI) in the 1640 medium containing 5% FCS. Infection was allowed to proceed at 37 8C and 5% CO2 for 45 min. The free bacterial cells were removed by three times of washing with PBS. The infected cell monolayers were treated with gentamicin (100 mg/ml) for 1 h. Part of the wells were then washed again and lysed with deionized water for 10 min and intracellular bacteria were enumerated by plating serial dilutions of the lysates on the BHI agar plates as CFUt1. The remaining wells were subjected to further incubation at 37 8C and 5% CO2 in the 1640 medium containing 5% FCS and 20 mg/ml of gentamicin, and intracellular bacteria were enumerated as above (CFUt2). Intracellular survival (%) was calculated as CFUt2/CFUt1  100%.

3.1. S. suis type 2 explores sodA for its anti-autophagic response Since LC3-II is localized on autophagic vacuoles, as opposed to LC3-I present in the cytosol, after posttranslational modification from LC3, increased concentration of LC3-II has been used as a hallmark of autophagy (Kabeya et al., 2000). Initially we found that the LC3-II level was elevated from the first hour post-infection (p.i.) in the Dsod mutant, while in cells infected with the wild-type strain increased LC3-II was significant only at 3 h p.i. (Fig. 1A). Therefore, we speculated that sodA might play a role in the anti-autophagic response during the first two hours of SS2 infection. Fig. 1B and C shows that infection with the Dsod mutant triggered more pronounced autophagic response than the wild-type or complemented

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

331

Fig. 1. Infection of macrophages with Streptococcus suis type 2 Dsod mutant aggravated autophagic response as shown by Western blotting. (A) Preliminary experiment showing increased LC3-II in RAW264.7 macrophage cells infected with Dsod mutant as compared with the wild-type strain (WT) at 1 and 2 h post-infection. (B) Representative Western blotting image of LC3-II conversion in cells infected with the wild-type, Dsod and its complemented strain (cDsod) at 1 and 2 h of infection. Mock-infected and rapamycin (Rapa) were included as negative and positive controls. (C) Densitometric ratio of LC3-II to b-actin of three independent experiments of panel B. *P < 0.05, **P < 0.01.

strain (P < 0.01 or 0.05) at both time points of 1 and 2 h p.i., as shown by the elevated ratio of LC3-II to b-actin. Using macrophage cells stably expressing EGFP-LC3, we also found that SS2-Dsod infected cells induced more autophagosomes (shown as increased numbers of punctae, Fig. 2A) than the wild-type strain at 1 and 2 h p.i. (P < 0.05 and/or 0.01) (Fig. 2B). Therefore, it is apparent that S. suis type 2 deploys its sodA to relieve the host autophagic response. 3.2. S. suis type 2 infection induces a complete autophagic response Some pathogens induce early stages of autophagy but block the fusion of autophagosomes with lysosomes. It is, therefore, important to investigate whether SS2 infection induces a complete autophagic response. In the macrophage cells stably expressing EGFP-LC3 that were infected with SS2 or its Dsod mutant, the EGFP-LC3+ vesicles were co-localized with lysosomes (LysoTracker staining) (Fig. 3), indicating that a fraction of autophagosomes had fused with lysosomes. In contrast, there was almost no co-localization

between autophagosomes and LysoTracker stained lysosomes in cells treated with 3-methyladenine (3-MA). These data clearly show that SS2 infection could trigger the autophagic process and induce the formation of autolysosomes. 3.3. Reactive oxygen species, but not autophagic response, plays a major role in killing of bacterial cells within macrophages Autophagic response may be detrimental to the bacteria or viruses infecting the cells. We examined if autophagy played a role in killing intracellular bacteria. The chemical 3-MA was used to inhibit initiation of the autophagic process. Although the mutant strain was more readily phagocytosed (Fig. 4A, P < 0.05), we found that intracellular survival of the Dsod mutant was lower than the wild-type or complemented strain (Fig. 4B), suggesting that the ROS generated by the macrophages played a major role in intracellular killing of the mutant strain. However, SS2 might employ its sodA to counteract ROS-induced antimicrobial effect, shown as high intracellular survival

332

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

Fig. 2. Infection of macrophages with Streptococcus suis type 2 Dsod mutant aggravated autophagic response as shown by increased EGFP-LC3 punctae. (A) Representative confocal microscopic images of EGFP-LC3 punctae in RAW264.7 cells infected with the wild-type, Dsod and its complemented strain (cDsod) at 1 and 2 h of infection. Mock-infected and rapamycin (Rapa) were included as negative and positive controls. (B and C) Mean  SD of EGFP-LC3 punctae per cell from at least 60–80 cells of 3 independent experiments. *P < 0.05, **P < 0.01.

rate in the wild-type or complemented strain than the Dsod mutant. Although 3-MA did not seem to affect survival of the mutant strain, it did have effect on the survival of the wild-type and complemented strain, lower in the 3-MA treated cells than the untreated counterparts (though not significantly different statistically because of wide variations among experiments, Fig. 4B). 3.4. Superoxide anion level was elevated in cells infected with the Dsod mutant Production of O2 and H2O2 is a chain reaction, where O2 is converted to H2O2 by SOD, and H2O2 can be converted either to H2O by other antioxidant enzymes (such as catalase) or to OH by Fe2+ or Cu+. It is known that ROS generated in phagocytes by NADPH oxidase is

involved in autophagy by targeting LC3 to phagosomes and for subsequent degradation (Scherz-Shouval and Elazar, 2011). Therefore, we sought to determine if deletion of the sodA gene of SS2 could change the intracellular ROS. Fig. 5 shows that the macrophage cells infected with the Dsod mutant had higher fluorescent response than those infected with the wild-type or complemented strain at both time points (Fig. 5A and B), indicating higher level of intracellular O2 due to deletion of the sodA gene, while there was no significant difference of H2O2 levels in the infected cells by different strains (datas are not shown). We further explored if SS2 sodA contributed to scavenging of ROS generated in the cell free hypoxanthine/xanthine oxidase system. Inoculation of the wild-type or complemented strain, but not the Dsod mutant, led to significant reduction of ROS as shown

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

333

Fig. 3. Co-localization of autophagosomes and lysosomes in RAW264.7 cells infected with the wild-type (WT) and Dsod strains at 2 h of infection. 3Methyladenine (3-MA) and rapamycin (Rapa) were included as negative and positive controls.

by decreased chemiluminescence units, an effect similar to the commercial SOD though to a lesser extent (Fig. 6A and B). Moreover, purified sodA of SS2 expressed in E. coli could also eliminate ROS in the system effectively (Fig. 6C and D). These results suggest that reduced autophagic responses of S. suis type 2 infected cells may be related to reduced ROS by the scavenging effect of its sodA. 4. Discussion Of the 35 serotypes, S. suis type 2 is the most virulent and most frequently isolated serotype in both pigs and humans (Berthelot-Herault et al., 2005). Earlier studies focused on identification of virulence factors that might be involved in SS2 pathogenecity. A recent review by Feng et al. (2014) indicates that there are more than 60 bacterial components that have been identified as being related to SS2 virulence, including surface and secreted factors, proteinases/enzymes,

and transcriptional regulators. Our early report has indicated that SS2 encodes sodA that is anti-oxidative and involved in pathogenecity in cell and mouse models (Tang et al., 2012). Here we further show that SS2 deploys its sodA to counteract the autophagic response of macrophages probably by scavenging their ROS that is known to regulate autophagy (Scherz-Shouval and Elazar, 2011). Previous studies have shown that several bacterial species could induce autophagy, although the pathways involved and the impact on infection outcomes vary with bacteria (Huang and Brumell, 2014). Autophagy plays a role in innate immune defenses against invading pathogens, such as group A Streptococcus, Shigella flexneri, Mycobacterium tuberculosis (Yano et al., 2008). Listeria monocytogenes employs inlK and actA to evade from autophagic killing (Birmingham et al., 2007; Yoshikawa et al., 2009). However, there is paucity of information if and how extracellular bacteria like SS2 is involved in autophagy.

334

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

Fig. 4. Phagocytosis and intracellular survival of Streptococcus suis type 2 wild-type, Dsod and its complemented (cDsod) strain in macrophages with or without treatment with 3-methyladenine (3-MA). (A) Phagocytosis; (B) intracellular survival. Results are expressed mean  SD of three independent experiments. (C) Over-expression of sodA in the Dsod mutant carrying sodA-expression plasmid as shown by Western blotting using anti-sodA and anti-GAPDH polyclonal antibodies.

We found that LC3 lipidation was more pronounced in the Dsod mutant infected macrophages than those infected with the wild-type or complemented strain. This led us to postulate that sodA might be utilized by SS2 to reduce the ROS during the phagocytic process, thus lessening the ROS-induced autophagy. To investigate this possibility, we used the fluorescent indicator dihydroethidium that can be oxidized by superoxide anion to determine ROS level in macrophage cells or in cell-free ROS system generated by hypoxanthine and xanthine oxidase. In macrophage cells infected with the Dsod mutant, the fluorescent units (reflecting intracellular O2 level) were higher than those infected with the wild-type or complemented strain, suggesting the role of sodA of SS2 in reducing intracellular O2. This was further supported by the facts that the Dsod mutant failed to eliminate ROS effectively as compared with the wild-type strain, and that SS2 sodA expressed in E. coli caused significant removal of artificially generated ROS. It is well known that ROS generated from respiratory burst of stimulated macrophages was antibacterial (Chen et al., 2008). Reduced survival in infected macrophages was seen with the Dsod mutant, as compared with the wild-type or complemented strain in this study and elsewhere (Tang et al., 2012), suggesting that sodA helps SS2 to counteract ROS for its survival. On the other hand, autophagic responses to infections could be antimicrobial (Campoy and Colombo, 2009) or pro-bacterial (Mostowy and Cossart, 2012), depending on the types of pathogens and/or signaling pathways involved (Huang and Brumell, 2014; Mostowy, 2013). However, we did not observe an apparent effect of autophagy on SS2 survival although inhibition of autophagy with 3-MA appeared to reduce intracellular bacterial numbers of the wild-type or complemented SS2 strain, but with no statistical significance. We assume that ROS plays the predominant antimicrobial role over autophagy in the activated phagocytes or there might be some other virulence factors in SS2 that could be involved in the compromising effect on phagocytosed bacteria.

A

B O2- 1 hour

** 15

**

ns

10 5 0

mock

WT

Δsod

O2- 2 hour

20

cΔsod

Fluorescent units

Fluorescent units

20

**

**

15 ns 10 5 0

mock

WT

Δsod

cΔsod

Fig. 5. Deletion of the sod gene increased the superoxide anion level in Streptococcus suis type 2 infected macrophages as measured by flow cytometery. (A and B) Intracellular O2 of macrophages infected with wild-type (WT), Dsod mutant and complemented (cDsod) strains at 1 and 2 h post-infection. (C and D) Intracellular H2O2 of macrophages infected with wild-type, mutant and complemented strains at 1 and 2 h post-infection. The percentage of fluorescence represents the levels of intracellular O2 or H2O2. Data were shown as mean  SD of three independent experiments, each in duplicate wells.

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

A

B

16000

10000

HX-XO SOD 1U blank

14000 12000 10000

** *

8000

WT

Δ sod cΔ sod

RCL

CL units

335

8000

**

6000

6000

4000

4000

2000

2000 0

HX-XO SOD 1U

WT

Δsod

cΔsod

6. 0

5. 0

4. 0

3. 0

2. 0

1. 0

0

0 Time (m in)

C

D

8000

2000

6000

1500 RCL

CL units

**

1000

4000

500

2000

0

HX-XO

2. 0

1. 5

1. 0

0. 5

0

0

1*10 -3U

1*10 -2U

2U

sodA

Time(m:s) Fig. 6. Scavenging of in vitro formed reactive oxygen species by Streptococcus suis type 2 and its sodA as analyzed by luminol enhanced chemiluminescence. The cell free reactive oxygen species were generated by hypoxanthine (HX, 1 mM) and xanthine oxidase (XO, 2.5 mU/ml). (A) Chemiluminesence profiles (CL units) in the HX-XO system inoculated with the wild-type SS2, mutant and complemented strains. Reference superoxide dismutase (SOD) and untreated wells (blank) were included as positive and negative control. (B) Comparison of relative CL units (RCL) at one minute of measurement of panel A. (C) CL units in the HX-XO system treated with different levels of purified sodA of SS2. (D) Comparison of RCL at one minute of measurement of panel C. The results were expressed as mean  SD of three experiments.

In bone marrow derived macrophages, listeriolysin O (LLO) was found to induce autophagy while the autophagic response did not affect the fate of intracellular L. monocytogenes (Meyer-Morse et al., 2010). This could be due to partial damage of the autophagosomes by LLO, thus preventing further fusion with the lysosomes with eventual formation of spacious listeria-containing autophagosome (Birmingham et al., 2008). The alpha hemolysin (Hla) of Staphylococcus aureus could induce autophagy via a noncanonical pathway, while it was also able to prevent autophagosomal and lysosomal fusion, thus preventing bacterial destruction (Mestre et al., 2010). In HeLa cells infected with S. pyogenes, the autophagic response due to streptolysin (SLO) expression was associated with intracellular killing. However, studies in human keratinocytes found that SLO secretion was favorable to intracellular bacterial survival that was counteracted upon deletion of the gene encoding NAD glycohydrolase (O’Seaghdha and Wessels, 2013). These studies have revealed the complexity of autophagic responses and the involvement of cytotoxic lysins in authophagy induction and in autophagosomelysosome fusion. S. suis type 2 expresses hemolysin (suilysin) that has been described to be involved in the modulation of

its interactions with host cells, such as neutrophils, endothelial cells, epithelial cells, macrophages and dendritic cells (Seitz et al., 2014). Further research is needed if and how suilysin is involved in autophagic response and what will be its effect on the fate of SS2 in infected cells. In conclusion, we provide clear evidence that S. suis type 2 employs its sodA to scavenge superoxide anions not only for the anti-oxidant effect to counteract the antimicrobial effects of ROS, but also for lessened autophagic response which may have been exacerbated by ROS in activated macrophages. Acknowledgements This work is part of the research funded by the Chinese Ministry of Agriculture (project no. 201303041). We thank Ms J. H. Li at Zhejiang University Core Facility Consortium for flow cytometry analysis. References Archambaud, C., Nahori, M.A., Pizarro-Cerda, J., Cossart, P., Dussurget, O., 2006. Control of Listeria superoxide dismutase by phosphorylation. J. Biol. Chem. 281, 31812–31822.

336

L. Fang et al. / Veterinary Microbiology 176 (2015) 328–336

Ambrozova, G., Pekarova, M., Lojek, A., 2010. Effect of polyunsaturated fatty acids on the reactive oxygen and nitrogen species production by raw 264.7 macrophages. Eur. J. Nutr. 49 (3), 133–139. Berthelot-Herault, F., Gottschalk, M., Morvan, H., Kobisch, M., 2005. Dilemma of virulence of Streptococcus suis: Canadian isolate 891591 characterized as a virulent strain using a standardized experimental model in pigs. Can. J. Vet. Res. 69, 236–240. Birmingham, C.L., Canadien, V., Gouin, E., Troy, E.B., Yoshimori, T., Cossart, P., Higgins, D.E., Brumell, J.H., 2007. Listeria monocytogenes evades killing by autophagy during colonization of host cells. Autophagy 3, 442–451. Birmingham, C.L., Higgins, D.E., Brumell, J.H., 2008. Avoiding death by autophagy: interactions of Listeria monocytogenes with the macrophage autophagy system. Autophagy 4, 368–371. Campoy, E., Colombo, M.I., 2009. Autophagy in intracellular bacterial infection. Biochim. Biophys. Acta 1793, 1465–1477. Chen, Y., McMillan-Ward, E., Kong, J., Israels, S.J., Gibson, S.B., 2008. Oxidative stress induces autophagic cell death independent of apoptosis in transformed and cancer cells. Cell Death Differ. 15, 171–182. Cybulski Jr., R.J., Sanz, P., Alem, F., Stibitz, S., Bull, R.L., O’Brien, A.D., 2009. Four superoxide dismutases contribute to Bacillus anthracis virulence and provide spores with redundant protection from oxidative stress. Infect. Immun. 77, 274–285. Feng, Y., Zhang, H., Wu, Z., Wang, S., Cao, M., Hu, D., Wang, C., 2014. Streptococcus suis infection: an emerging/reemerging challenge of bacterial infectious diseases? Virulence 5, 477–497. Guthrie, H.D., Welch, G.R., 2006. Determination of intracellular reactive oxygen species and high mitochondrial membrane potential in Percoll-treated viable boar sperm using fluorescence-activated flow cytometry. J. Anim. Sci. 84, 2089–2100. Han, D.U., Choi, C., Ham, H.J., Jung, J.H., Cho, W.S., Kim, J., Higgins, R., Chae, C., 2001. Prevalence, capsular type and antimicrobial susceptibility of Streptococcus suis isolated from slaughter pigs in Korea. Can. J. Vet. Res. – Rev. Can. Rech. Vet. 65, 151–155. Huang, J., Brumell, J.H., 2014. Bacteria-autophagy interplay: a battle for survival. Nat. Rev. Microbiol. 12, 101–114. Iiyama, K., Chieda, Y., Lee, J.M., Kusakabe, T., Yasunaga-Aoki, C., Shimizu, S., 2007. Effect of superoxide dismutase gene inactivation on virulence of Pseudomonas aeruginosa PAO1 toward the silkworm, Bombyx mori. Appl. Environ. Microbiol. 73, 1569–1575. Kabeya, Y., Mizushima, N., Ueno, T., Yamamoto, A., Kirisako, T., Noda, T., Kominami, E., Ohsumi, Y., Yoshimori, T., 2000. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO (Eur. Mol. Biol. Organ.) J. 19, 5720–5728. Mestre, M.B., Fader, C.M., Sola, C., Colombo, M.I., 2010. Alpha-hemolysin is required for the activation of the autophagic pathway in Staphylococcus aureus-infected cells. Autophagy 6, 110–125. Meyer-Morse, N., Robbins, J.R., Rae, C.S., Mochegova, S.N., Swanson, M.S., Zhao, Z., Virgin, H.W., Portnoy, D., 2010. Listeriolysin O is necessary and sufficient to induce autophagy during Listeria monocytogenes infection. PLoS ONE 5, e8610.

Mizushima, N., Yoshimori, T., Levine, B., 2010. Methods in mammalian autophagy research. Cell 140, 313–326. Mostowy, S., 2013. Autophagy and bacterial clearance: a not so clear picture. Cell. Microbiol. 15, 395–402. Mostowy, S., Cossart, P., 2012. Bacterial autophagy: restriction or promotion of bacterial replication? Trends Cell Biol. 22, 283–291. O’Seaghdha, M., Wessels, M.R., 2013. Streptolysin O and its co-toxin NADglycohydrolase protect group A Streptococcus from Xenophagic killing. PLoS Pathog. 9, e1003394. Petiot, A., Ogier-Denis, E., Blommaart, E.F., et al., 2000. Distinct classes of phosphatidylinositol 30 -kinases are involved in signaling pathways that control macroautophagy in HT-29 cells. J. Biol. Chem. 275, 992–998. Radi, R., Rubbo, H., Thomson, L., Prodanov, E., 1990. Luminol chemiluminescence hypoxanthine as xanthine using xanthine and oxidase substrates. Free Radic. Biol. Med. 8, 121–126. Scherz-Shouval, R., Elazar, Z., 2011. Regulation of autophagy by ROS: physiology and pathology. Trends Biochem. Sci. 36, 30–38. Seitz, M., Beineke, A., Singpiel, A., Willenborg, J., Dutow, P., Goethe, R., Valentin-Weigand, P., Klos, A., Baums, C.G., 2014. Role of capsule and suilysin in mucosal infection of complement-deficient mice with Streptococcus suis. Infect. Immun. 82, 2460–2471. Tang, Y., Li, F., Tan, B., Liu, G., Kong, X., Hardwidge, P.R., Yin, Y., 2014. Enterotoxigenic Escherichia coli infection induces intestinal epithelial cell autophagy. Vet. Microbiol. 171, 160–164. Tang, Y., Wu, W., Zhang, X., Lu, Z., Chen, J., Fang, W., 2012. Catabolite control protein A of Streptococcus suis type 2 contributes to sugar metabolism and virulence. J. Microbiol. 50, 994–1002. Tang, Y., Zhang, X., Wu, W., Lu, Z., Fang, W., 2012b. Inactivation of the sodA gene of Streptococcus suis type 2 encoding superoxide dismutase leads to reduced virulence to mice. Vet. Microbiol. 158, 360–366. Tang, Y., Zhao, H., Wu, W., Wu, D., Li, X., Fang, W., 2011. Genetic and virulence characterization of Streptococcus suis type 2 isolates from swine in the provinces of Zhejiang and Henan, China. Folia Microbiol. (Praha) 56, 541–548. Wu, Z., Wu, C., Shao, J., Zhu, Z., Wang, W., Zhang, W., Tang, M., Pei, N., Fan, H., Li, J., Yao, H., Gu, H., Xu, X., Lu, C., 2014. The Streptococcus suis transcriptional landscape reveals adaptation mechanisms in pig blood and cerebrospinal fluid. RNA 20, 882–898. Yano, T., Mita, S., Ohmori, H., Oshima, Y., Fujimoto, Y., Ueda, R., Takada, H., Goldman, W.E., Fukase, K., Silverman, N., Yoshimori, T., Kurata, S., 2008. Autophagic control of listeria through intracellular innate immune recognition in drosophila. Nat. Immunol. 9, 908–916. Yoshikawa, Y., Ogawa, M., Hain, T., Yoshida, M., Fukumatsu, M., Kim, M., Mimuro, H., Nakagawa, I., Yanagawa, T., Ishii, T., Kakizuka, A., Sztul, E., Chakraborty, T., Sasakawa, C., 2009. Listeria monocytogenes ActAmediated escape from autophagic recognition. Nat. Cell Biol. 11, 1233–1240. Zhu, B., Xu, F., Li, J., Shuai, J., Li, X., Fang, W., 2012. Porcine circovirus type 2 explores the autophagic machinery for replication in PK-15 cells. Virus Res. 163, 476–485.